The present invention relates to methods of scalably producing microorganisms by propagating them within plant tissues and introducing them into agricultural seeds to improve their shelf-life during long-term storage, to produce substances of interest, and to create libraries of microbes.
1. A method of producing a indol-3 carboxylic acid within a bacterial colonized cereal plant bioreactor, the method comprising:
a. germinating a cereal seed into which at least one inoculant bacterial endophyte has been introduced, wherein the bacterial endophyte is from the genus b. growing the bacterial colonized cereal plant bioreactor under conditions such that the bacterial endophyte proliferates and the indol-3 carboxylic acid is produced in the bacterial colonized cereal plant bioreactor, wherein the indol-3 carboxylic acid is produced at a higher concentration in the bacterial colonized cereal plant bioreactor compared to an isoline plant grown from a non-inoculated cereal seed. 2. The method of 3. A method of producing an ACC-deaminase within a bacterial colonized cereal plant bioreactor, the method comprising:
a. germinating a cereal seed into which at least one inoculant bacterial endophyte has been introduced, wherein the bacterial endophyte is from the genus b. growing the bacterial colonized cereal plant bioreactor under conditions such that the bacterial endophyte proliferates and the ACC-deaminase is produced in the bacterial colonized cereal plant bioreactor, wherein the ACC-deaminase is produced at a higher concentration in the bacterial colonized cereal plant bioreactor compared to an isoline plant grown from a non-inoculated cereal seed. 4. The method of 5. The method of 6. The method of 7. The method of 8. A method of producing a ribonucleoside diphosphate reductase within a bacterial colonized cereal plant bioreactor, the method comprising:
a. germinating a cereal seed into which at least one inoculant bacterial endophyte has been introduced, wherein the bacterial endophyte is from the genus b. growing the bacterial colonized cereal plant bioreactor under conditions such that the bacterial endophyte proliferates and the ribonucleoside diphosphate reductase is produced in the bacterial colonized cereal plant bioreactor, wherein the ribonucleoside diphosphate reductase is produced at a higher concentration in the bacterial colonized cereal plant bioreactor compared to an isoline plant grown from a non-inoculated cereal seed. 9. The method of 10. The method of 11. The method of 12. The method of 13. The method of 14. The method of 15. The method of 16. The method of 17. The method of
This application is the National Stage of International Application No. PCT/US2014/072400, filed Dec. 24, 2014, which claims priority to the following applications: International Application No. PCT/US2014/054160 filed Sep. 04, 2014; Provisional Application No. 62/017,796, filed Jun. 26, 2014; Provisional Application No. 62/017,809, filed Jun. 26, 2014; Provisional Application No. 62/017,813 filed Jun. 26, 2014; Provisional Application No. 62/017,815 filed Jun. 26 2014; Provisional Application No. 62/017,816 filed Jun. 26, 2014; Provisional Application No. 62/017,818 filed Jun. 26, 2014; International Application No. PCT/US2014/044427 filed Jun. 26, 2014; and Provisional Application No. 61/920,560 filed Dec. 24, 2013; and is a continuation of U.S. application Ser. No. 14/315,804 filed Jun. 26, 2014, now U.S. Pat. No. 9,364,005. Each application is herein incorporated in its entirety by reference. The instant application contains a Sequence Listing which has been filed electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jun. 24, 2016, is named 28412PCT_CRF_sequencelisting.txt and is 2,453,823 bytes in size. Since the biotechnology revolution, there has been a desire to grow a diversity of microbes in low-cost, simple, and scalable culture systems. There has also been a need to generate shelf-stable formulations that can allow low-cost storage of valuable microbes. The present invention relates to methods of scalably producing microorganisms by propagating them within plant tissues and introducing them into agricultural seeds to improve their shelf-life during long-term storage. The present invention is based on the surprising discovery that microbes can be viably incorporated into the seeds of plants by inoculation of various plant tissues. The inventors have discovered that, when a preparation of microorganisms is applied to a plant under select conditions, the microorganisms can gain entry when grain formation starts and establish populations inside, and hence colonize the seed. The methods described herein can be used to introduce new microbes into plants and their seeds as a means of supporting the scalable expansion and storage of the desired microbe. The methods also can produce plants and seeds that uniformly comprise desired microbes and microbial products. These methods can be used to generate plants with valuable microbial constituents that can be difficult to produce with current lab or industrial cultivation methods and can produce seeds comprising microbes in a form that allows the microbe's storage for prolonged periods at room temperature. Also provided are novel compositions of plants, plant parts and seeds containing microbes. In some aspects, disclosed herein is a method of generating a bacterial endophyte library, comprising the steps of providing an inoculum comprising a plurality of bacterial endophyte entities, contacting the inoculum with a cereal plant seed, wherein the cereal plant seed is substantially depleted of surface endophytes, under conditions such that at least two bacterial endophyte entities present in the inoculum are incorporated into a cereal plant grown or derived from the plant seed, such that a bacterial endophyte library is generated within the cereal plant at a concentration of 106 CFU per plant. In certain embodiments, the at least two bacterial endophyte entities are exogenous to the cereal plant seed. In some embodiments, the bacterial endophyte library comprises at least three bacterial endophyte entities. In some embodiments, the bacterial endophyte library comprises at least five bacterial endophyte entities. In some embodiments, the bacterial endophyte library comprises at least ten bacterial endophyte entities. In some embodiments, the bacterial endophyte library comprises at least one bacterial entity not detectably present in the cereal plant seed. In other embodiments, the at least two bacterial endophyte entities comprise a first bacterial endophyte entity exhibiting a first phenotype and a second bacterial endophyte entity exhibiting a second phenotype. In certain embodiments, the first and second phenotypes are selected from catalase activity, oxidase activity, casein hydrolysis activity, gelatin hydrolysis activity, ACC-deaminase activity, exopolysaccharide activity, amylase activity, cellulase activity, chitinase activity, hemolytic activity, lipase activity, pectinase activity, phosphatase activity, protease activity, xylanase activity, production of an auxin, production of an antimicrobial, production of HCN, production of NH3, production of AHL, production of PHB, production of a siderophore, mineral phosphate solubilization, and production of acetoin. In some embodiments, the method further comprises the steps of planting a plurality of the cereal plant seeds and allowing the plants to grow, wherein the bacterial endophyte is present at 1010CFU per acre of plants planted according to established agricultural practices. In further embodiments, at least one of the bacterial endophyte entities is capable of using methanol or ethanol as their main carbon source. In some aspects, disclosed herein is a seed preparation comprising the bacterial endophyte library disclosed above, disposed on a plurality of seeds. In other aspects, disclosed herein is a method of producing an endophyte population in a bioreactor, comprising introducing into a bioreactor comprising a cereal plant material at least one bacterial endophyte entity, wherein the bacterial endophyte entity is localized an to an intercellular space of the cereal plant material, under conditions such that the bacterial endophyte entity proliferates within the intercellular space, thereby producing an endophyte population within the bioreactor. In some embodiments, the cereal plant material comprises a root. In some embodiments, the bacterial endophyte is selected from Table 10. In some embodiments, the cereal plant material comprises a shoot. In some embodiments, the bacterial endophyte is selected from Table 11. In some embodiments, the cereal plant material comprises a seed. In some embodiments, the bacterial endophyte is selected from Table 12. In other aspects, disclosed herein is a synthetic combination comprising the bioreactor and the endophyte population. In further aspects, disclosed herein is a method of endophyte propagation comprising the steps of providing an inoculum comprising one or a plurality of bacterial endophyte entities of Table 1, contacting the inoculum with a cereal plant seed, cereal plant seedling, or a cereal plant, under conditions such that at least one bacterial endophyte entity present in the inoculum is incorporated into a cereal plant grown or derived from the cereal plant seed, cereal plant seedling, or cereal plant, wherein the at least one bacterial endophyte entity is propagated within the cereal plant. In some embodiments, the at least one bacterial endophyte entity comprises a bacterial endophyte entity exogenous to the grown cereal plant. In further aspects, disclosed herein is a method for archiving an endophyte population, comprising the steps of: a) providing an isolated endophyte population, b) contacting the provided isolated endophyte population with a cereal plant seed under conditions that an endophyte population comprising a plurality of bacterial endophyte entities are present in an intercellular space of a cereal plant grown or derived from the cereal plant seed, c) providing conditions that permit the endophyte to grow and divide in the inoculated agricultural plant, and d) isolating one or more seeds from the grown cereal plant, wherein the seeds comprise the isolated endophyte population, thereby archiving the endophyte population within the isolated one or more seeds. In some embodiments, the endophyte population has enhanced stability relative to an unarchived endophyte. In other embodiments, the endophyte population is exogenous to the cereal plant seed. In further embodiments, the endophyte population is present in a substantially anhydrous state. In other embodiments, the endophyte population is present in a substantially anaerobic state. In some embodiments, the endophyte population is substantially resistant to at least one biotic stress. In some embodiments, the endophyte population is substantially resistant to at least one abiotic stress. In certain embodiments, the endophyte population comprises at least about 1×103endophytes. In some embodiments, the endophyte population is propagated in culture. In some embodiments, the endophyte population is unamplified by propagation in culture. In some embodiments, the endophyte population is propagated in cereal plants. In some embodiments, the endophyte population comprises a first bacterial endophyte entity isolated from a plant selected from corn, wheat, soy, cotton, rice, and canola. In some embodiments, the endophyte population comprises a first bacterial endophyte entity isolated from a plant selected from soy, cotton and canola. In some embodiments, the endophyte population comprises a first bacterial endophyte entity isolated from a plant environment selected from root, shoot, seed, and rhizosphere. In certain embodiments, the plant environment is root and the endophyte is selected from Table 10. In certain embodiments, the plant environment is shoot and the endophyte is selected from Table 11. In certain embodiments, the plant environment is seed and the endophyte is selected from Table 12. In certain embodiments, the plant environment is endosphere and the endophyte is selected from Table 13. In further aspects, disclosed herein is a method of propagating a bacterial endophyte, comprising: a) providing a bacterial endophyte preparation that is isolated from a host plant or the environment thereof, wherein the bacterial endophyte is capable of growing and dividing in a recipient agricultural plant, b) contacting the recipient plant with the bacterial endophyte preparation to produce an inoculated agricultural plant, c) providing conditions that permit the endophyte to grow and divide in the inoculated agricultural plant, and d) isolating inoculated agricultural plant seeds produced from the inoculated agricultural plant, wherein the agricultural plant seeds contain the endophyte and progeny thereof, thereby propagating the bacterial endophyte. In some embodiments, the bacterial endophyte is not cultured. In certain embodiments, the method comprises repeating steps a)-d) one or more times to generate a sufficient quantity of agricultural seeds to populate a field. In some embodiments, the bacterial endophyte population comprises a plurality of bacterial entities. In other embodiments, the method further comprises planting the inoculated agricultural plant seeds. In further aspects, disclosed herein is a method of protecting an endophyte, comprising the steps of a) providing an endophyte preparation that is isolated from a host plant or the environment thereof, wherein the endophyte is capable of growing and dividing in a recipient agricultural plant, and wherein the endophyte is susceptible to a biotic or an abiotic stress, b) contacting the recipient plant with the endophyte preparation to produce an inoculated agricultural plant, c) providing conditions that permit the endophyte to grow and divide in the inoculated agricultural plant, d) isolating inoculated agricultural plant seeds produced from the inoculated agricultural plant, wherein the agricultural plant seeds contain the endophyte and progeny thereof, and e) storing the isolated agricultural plant seeds, thereby protecting the endophyte. In additional aspects, disclosed herein is a method of generating a population of agricultural seed-endophyte combinations, comprising a. producing an agricultural seed comprising an endophyte, by the method comprising i) obtaining a first agricultural plant, ii) contacting the first agricultural plant with an endophyte preparation such that a first endophyte present in the endophyte preparation is incorporated into a first agricultural seed derived from the first agricultural plant; and
In other aspects, disclosed herein is a method of generating a microbial endophyte library, comprising the steps of providing an inoculum comprising a plurality of microbial endophyte entities, contacting the inoculum with a part of a plant under conditions such that at least two microbial endophyte entities present in the inoculum are incorporated into the plant, such that a microbial endophyte library is generated within a seed derived from the inoculated plant. In some embodiments, the seed comprises at least 10, 100, 1000, or at least 10,000 CFU/seed of each of the microbial endophyte of the inoculum. In other embodiments, the plant is a cereal plant. In yet other embodiments, the microbial endophyte is a fungus or a bacterium. In further aspects, disclosed herein is a method of generating a microbial endophyte library, comprising the steps of contacting a plant seed with an inoculum comprising a plurality of microbial endophyte entities, wherein the resulting contacted seed comprises an endophyte belonging to a family selected from the group consisting of Microbacteriaceae, Chitinophagaceae, Bacillaceae, Planococcaceae, Clostridiaceae, Comamonadaceae, Oxalobacteraceae, Enterobacteriaceae, Pseudomonadaceae, Xanthomonadaceae and one or more of the microbial endophytes listed in Table 1, wherein the microbial endophyte entities present in the contacted seed are incorporated into a bioreactor plant grown or derived from the contacted plant seed, such that a microbial endophyte library is generated within the bioreactor plant. In some embodiments, the seed is a cereal plant seed. In certain embodiments, the contacted seed comprises two, three, four, five, six, seven, eight, nine, or ten microbial endophytes listed in Table 1. In other embodiments, the seed comprises at least 10, 100, 1000, or at least 10,000 CFU/seed of each of the microbial endophytes. In further aspects, disclosed herein is a library of microbial endophytes generated by any of the methods disclosed above. In other aspects, disclosed herein is a library of microbial endophytes comprising in a plant seed one or more microbial endophytes belonging to a family selected from the group consisting of Microbacteriaceae, Chitinophagaceae, Bacillaceae, Planococcaceae, Clostridiaceae, Comamonadaceae, Oxalobacteraceae, Enterobacteriaceae, Pseudomonadaceae, Xanthomonadaceae and one or more microbial endophytes listed in Table 1. In other aspects, disclosed herein is a library of microbial endophytes comprising in a bioreactor plant one or more microbial endophytes belonging to a family selected from the group consisting of Microbacteriaceae, Chitinophagaceae, Bacillaceae, Planococcaceae, Clostridiaceae, Comamonadaceae, Oxalobacteraceae, Enterobacteriaceae, Pseudomonadaceae, Xanthomonadaceae and one or more microbial endophytes listed in Table 1. In other aspects, disclosed herein is a bioreactor plant produced by contacting a plant seed with an inoculum comprising a plurality of microbial endophyte entities, wherein the resulting contacted seed comprises an endophyte from the Enterobacteriaceae family and an endophyte from the Pseudomonadaceae family, and one or more of the microbial endophytes listed in Table 1, and wherein the microbial endophyte entities present in the contacted seed are incorporated into a bioreactor plant grown or derived from the contacted plant seed. In other aspects, disclosed herein is a bioreactor plant comprising one or more microbial endophytes belonging to a family selected from the group consisting of Microbacteriaceae, Chitinophagaceae, Bacillaceae, Planococcaceae, Clostridiaceae, Comamonadaceae, Oxalobacteraceae, Enterobacteriaceae, Pseudomonadaceae, Xanthomonadaceae and one or more microbial endophytes listed in Table 1. In other aspects, disclosed herein is a field comprising at least 1, 10, 100, 1000, 10000 or more bioreactor plants as disclosed above. In other aspects, disclosed herein is a shelf-stable seed-based storage vessel comprising one or more microbial endophytes selected from the group belonging to a family selected from the group consisting of Microbacteriaceae, Chitinophagaceae, Bacillaceae, Planococcaceae, Clostridiaceae, Comamonadaceae, Oxalobacteraceae, Enterobacteriaceae, Pseudomonadaceae, Xanthomonadaceae and one or more microbial endophytes listed in Table 1. In other aspects, disclosed herein is a shelf-stable seed-based storage vessel for microbial endophytes produced by contacting a plant seed with an inoculum comprising a plurality of microbial endophyte entities, wherein the resulting contacted seed comprises comprises an endophyte from the Enterobacteriaceae family and an endophyte from the Pseudomonadaceae family, and one or more of the microbial endophytes listed in Table 1, wherein the microbial endophyte entities present in the contacted seed are incorporated into a bioreactor plant grown or derived from the contacted plant seed, and wherein the bioreactor plant generates shelf-stable seed-based storage vessels comprising the incorporated microbial endophyte entities. In some embodiments of the shelf-stable seed-based storage vessel disclosed above, the at least one of the microbial endophyte produces at least 1 CFU/storage vessel when recovered and cultivated after storage for at least 1 month, 2 months, 3 months, 6 months, or at least 1 year. In other embodiments, the storage vessel further comprises on the outside a control agent, a plant growth regulator, a fertilizer and/or a nutrient. In some aspects, disclosed herein is a storage container comprising the shelf-stable seed-based storage vessel as disclosed above. In some embodiments, the storage container comprises 10, 100, 1000, 10000, 100000 seed-based storage vessels. In other aspects, disclosed herein is a method of producing a substance within a plant, comprising introducing into a bioreactor comprising a cereal plant material at least one bacterial endophyte entity, wherein the bacterial endophyte entity is localized an to an intercellular space of the cereal plant material and is capable of producing the substance, under conditions such that the bacterial endophyte entity proliferates within the intercellular space, thereby producing the substance. In some embodiments, the substance is an enzyme. In some embodiments, the enzyme is selected from the group consisting of a catalase, an oxidase, an ACC-deaminase, an amylase, a cellulose, a chitinase, a lipase, a pectinase, a phosphatase, a protease, and a xylanase. In other embodiments, the substance is an antimicrobial. In other embodiments, the substance is PHB. The term “endophyte” means—in its broadest meaning—the location of an organism, with “endo” means “inside” and “phyte” means “plants”. An “endophyte” or “endophytic microbe” is an organism that lives within a plant or is otherwise associated therewith. Endophytes can occupy the intracellular or extracellular spaces of plant tissue, including the leaves, stems, flowers, fruits, seeds, or roots. An endophyte can be either a bacterial or a fungal organism that can confer a beneficial property to a plant such as an increase in yield, biomass, resistance, or fitness in its host plant. As used herein, the term “microbe” is sometimes used to describe an endophyte. As used herein, the term “microbe” refers to a microorganism of bacterial or fungal origin. Therefore, the terms microbe and microorganism can be used interchangeably. As used herein, in certain embodiments, a microbe may be an endophyte. In other embodiments, a microbe may not be an endophyte. In some embodiments, the invention contemplates the use of microbes that are “exogenous to the seed” of a plant or that are “exogenous to the plant”. As used herein, a microbe is considered exogenous to the seed of a plant or to the plant if the seed or plant that is unmodified (e.g., a seed or plant that is not modified by the methods and compositions descried herein) does not contain the microbe (e.g. is not detectably present in the seed or plant). In some embodiments, an “exogenous” population of microbes includes those microbes present in a seed or plant in concentrations exceeding the native concentration. In contrast, a microbe is considered to be “native” to a plant or a portion of the plant, and is said to be “natively” present in the plant or a portion of plant, if that plant or portion of the plant contains the microbe, for example, in the absence of any contacting with the microbe preparation. In some embodiments, an “endogenous” microbe is natively present in a plant or portion thereof. “Not detectably present” as used herein means that an entity, e.g. a microbial endophyte, is not detected in a sample derived from, e.g. a seed, a plant, or the environment surrounding the plant (e.g. the soil) using standard methods of detection. That means that the entity is below the limit of detection of the apparatus or method used at the time of measurement. As used herein, the term “substantially” or “substantial” refers, e.g., to the presence, level, or concentration of an entity in a particular space, and the effect of one entity on another entity. For example, an activity, level or concentration of an entity is substantially increased if the increase is 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 50-fold, 100-fold, or 1000-fold relative to a baseline. An activity, level or concentration of an entity is also substantially increased if the increase is 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, or 500% relative to a baseline. A “genetically modified plant” refers to a plant that contains genetic material not found in a wild-type plant of the same species, variety or cultivar and where the foreign genetic material has been constructed in the laboratory and been introduced using means other than genetic fertilization by pollen. The inserted genetic material usually comprising transgenes can be any DNA sequence and inserted into the host genome at random, or at specific locations by, for example, homologous recombination. Foreign DNA sequences can also be inserted into cells by transfer from one species into another following by chimeraplasty. As used herein, the term “bioreactor plant” or “plant bioreactor” or “plant-based bioreactor” refers to a plant that is used to co-cultivate, maintain, store, or amplify one or more microbes described herein, such as, e.g. endophytic bacteria and/or fungi. A plant may be inoculated with one or more microbes and a plant tissue, including seeds that comprise the microbes may be harvested from the bioreactor plant. As used herein, the term “variety” refers to a group of plants within a species that share constant characteristics that separate them from the typical form and from other possible varieties within that species. As used herein, an “agricultural seed” is a seed used to grow a plant typically used in agriculture (an “agricultural plant”). The seed may be of a monocot or dicot plant, and may be planted for the production of an agricultural product, for example grain, food, fiber, etc. As used herein, an agricultural seed is a seed that is prepared for planting, for example, in farms for growing. The present invention contemplates the use of “isolated” microbe. As used herein, an isolated microbe is a microbe that is isolated from its native environment, and carries with it an inference that the isolation was carried out by the hand of man. An isolated microbe is one that has been separated from at least some of the components with which it was previously associated (whether in nature or in an experimental setting). A isolated microbe is also separated from at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or greater than 99% of the other components with which the microbe was associated when produced. The term isolated further includes placing entities, such as, e.g. microbes, in a specific environment, e.g. for archiving or storage, such as placing the microbes into seed-based storage vessels. Such microbes are also considered isolated, e.g. if they were separated from, e.g. the leaves, stems, and roots of a bioreactor plant from which they were derived. Use of the term “entity” when describing a microbe, or “endophyte entity” refers to a microbe of a particular OTU, strain or taxa. A “storage vessel”, as used herein is a medium that is suitable for the storage and preservation (e.g. of viability) of plant-associated microbes. In some embodiments, the storage vessel is “seed-based.” Seed-based storage vessels comprise a seed that may be obtained, e.g. from a bioreactor plant, the seed comprising one or more plant-associated microbes. As used herein, a “reference agricultural plant” is an agricultural plant of the same species, strain, or cultivar to which a treatment or endophyte/microbe preparation is not administered/contacted. A reference agricultural plant, therefore, is substantially similar and is in some cases nearly identical or detectably identical to the microbe-associated plant (immediately prior to the association of the endophyte with the agricultural plant) with the exception of the presence of the microbe, and can serve as a control for detecting the effects of the microbe that is conferred to the plant and vice versa. As used herein, the term “non-genomic nucleic acid content” refers to the content of non-chromosomal nucleic acids, and includes viral-encoded, plasmid-borne, episomal-borne nucleic acids, as well as signaling and regulatory RNA molecules, including microRNA, drRNA, and related RNA molecules. Some of the methods described herein allow the colonization of plant seeds by microbes. As used herein, a microbe is said to “colonize” a plant or seed when it can exist in a symbiotic or non-detrimental relationship with the plant in the plant environment, for example on and/or inside a plant, including the seed. As used herein, the “reproductive tissue” of a plant includes the tissues involved with reproduction, and includes any part of a flower including, but not limited to, the stamen, pistil, carpel, petal, ovule, ovary, anther, filament, stigma, sepal, receptacle, locule, peduncle, petal, and tassel. As used herein, a “population of microbes” refers to a population of microbes (including endophyte populations) of common origin. In other words, a population of microbes refers to a population of cells that are genetically identical, or at least substantially identical. The term “propagate”, as used herein, means to grow or cultivate a population of cells. As used herein, a “portion” of a plant refers to any part of the plant, and can include distinct tissues and/or organs, and is used interchangeably with the term “tissue” throughout. As used herein, a plant or portion thereof that is “cured”, or sterilized of an endogenous microbe is one in which substantially all, detectably all, or all of the endogenous microbes that reside within the plant or portion thereof is removed. As used herein, a plant is deemed “intact” if the plant has not been physically compromised in any way, for example, by cutting, puncturing, or otherwise piercing the surface in a way that allows direct access to the internal portions of the plant. As used herein, the term “progeny”, in the context of describing a plant, denotes the offspring of any generation of a parent plant. Progeny of a plant, therefore, refers to generations of a plant, wherein the ancestry of the generation can be traced back to the plant. Likewise, the “progeny” of a microbe refers to the offspring of any generation of the microbe. Microbes are deemed to be of “monoclonal origin” if the microbes are progeny of a common microbe. A “viral entity”, as used herein, refers to the detectable presence of a virus in a plant or portion thereof. As used herein, a “purified” seed population refers to a selected group of seeds from a larger population, based on a given set of criteria. A “population” of plants, as used herein, can refer to a plurality of plants that were subjected to the same inoculation methods described herein, or a plurality of plants that are progeny of a plant or group of plants that were subjected to the inoculation methods. In addition, a population of plants can be a group of plants that are grown from coated seeds The plants within a population will typically be of the same species, and will also typically share a common genetic derivation. As used herein, there is a “reduction” of one or more native microbes when a microbe, for example a microbe that inoculates a plant, partially or completely displaces of one or more species of native populations of endophytes. In other words, the inoculation with one microbe results in the reduction or loss of one or more native microbes in a plant or portion thereof. Consistent with the above, a “reduction of the non-endophytes” refers to a detectable reduction in one or more species of native non-endophyte microorganisms, when compared, for example, with a reference agricultural plant grown and/or treated with the same conditions. As used herein, an “agriculturally acceptable” excipient or carrier is one that is suitable for use in agriculture without undue adverse side effects to the plants, the environment, or to humans or animals who consume the resulting agricultural products derived therefrom commensurate with a reasonable benefit/risk ratio. As used herein, a microbe-associated plant or portion thereof is said to have an “altered chemical composition” when there is a detectable change in the chemical composition of such plant or portion thereof, when compared with a corresponding plant or portion thereof that is not associated with the microbe and grown and/or subjected to the same conditions. In some embodiments, the present invention contemplates the use of a “community” of microbes. As used herein, a community of microbes refers to a plurality of distinct microbes. In some cases, the distinct microbes can be different species. In other cases, the community of microbes can be the same species but with distinct functions. As used herein, a “productivity” of an agricultural plant refers to the production of the plant, or a desirable, or commercial portion thereof. Therefore, an increase in productivity of a plant, for example, can refer to an increase in fruit or grain yield. It can also refer to an overall increase in total biomass, or the portion that is harvested and used in commerce. As used herein, a microbe is “viably incorporated” into a seed if it is located in the seed, and remains viable through desiccation. Likewise, as used herein, a microbe is “stably incorporated” into a seed, if the microbe is capable of persisting in the plant after germination of the seed, and microbe or progeny of the microbe, is capable of colonizing the seeds from the plant. A “microbial library” or “endophyte library” as used herein comprises a plurality of plant-associated microbes such as endophytes that can include bacteria and fungi. Libraries can, for example, be “bacterial endophyte libraries” or “fungal endophyte libraries” and comprise a diverse collection of entities. A microbial library may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 50, 100, 1000, 1×104, 1×105, 1×106, 1×107, 1×108, 1×109, 1×1010, 1×1011, 1×1012, or more microbial isolates. Isolates may be assessed by standard cultivation and characterization methods known on the art, including culturing of the library, single clone generation, nucleic acid (DNA/RNA) extraction and amplification (e.g. of 16S rRNA gene amplification) bacterial identification (through sequencing) and phylogenetic analyses. Microbial libraries may be generated and optionally maintained in any plant tissue or part of a plant, as desired, including whole bioreactor plants, progeny and seeds thereof. In some embodiments, microbial libraries are archived or stored in seed-based storage vessels comprising a seed and the microbes comprised in the library. A “plurality” as used herein means “more than one of” e.g. a plant, a seed, a microbe, etc. and includes 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 50, 100, 1000, 1×104, 1×105, 1×106, 1×107, 1×108, 1×109, 1×1010, 1×1011, 1×1012, 1×1013, 1×1014, 1×1015or more of the given matter. “Surface endophytes” as used herein are endophytes that are substantially located on the surface of, e.g., a seed or other part of a plant as opposed to within the interior, e.g. inside the seed coat or inside the seed. Such endophytes are substantially sensitive to surface sterilization as described herein. “Archiving”, e.g. of a microbial population means the preservation of a plurality of plant-associated microbes such as endophytes that can include bacteria and fungi and includes all forms of storing and storage units, such as, e.g. seed-based storage vessels. Archived microbes may be preserved or stored for a certain period of time, e.g. for at least 1 month, at least 3 months, or at least 6 months, for at least 12 months, for at least 2 years, or for at least 3 years. Archived microbes can be accessed from the storage unit at that later date, if desired, and optionally isolated, propagated, characterized or otherwise utilized. In some embodiments, the archived or stored microbes maintain their viability in that at least one of the archived microbes is capable of generating at least 1 CFU/storage unit if placed under suitable conditions in which microbial growth occurs. In other embodiments, the archived microbes are capable of generating at least 10, 100, 1000, 1×104, 1×105, 1×106, 1×107, 1×108CFUs/storage unit. In some embodiment, the archived microbes, e.g. endophytes, display an enhanced stability relative to an unarchived microbe. “Enhanced stability” means that the archived or stored microbes display greater viability when compared to comparable microbes that are not archived or stored. For example, the archived or stored microbes are capable of generating a higher number of CFUs when placed under suitable conditions compared to unarchived microbes. In another example, the archived microbes are capable of generating at least 1 CFU/storage unit while the unarchived microbe does not generate a single colony after the same amount of storage under the same storage conditions. In some embodiments, enhanced stability means that archived microbes maintain viability under conditions that unarchived microbes would not, e.g. under conditions of high or low temperature, high or low humidity, irradiation (e.g. UV-light), pathogenic invasion, etc. “Shelf-stable” as used herein means that a given archived or stored microbial composition or formulation displays stability (e.g. as measured by viability) of the comprised microbes under certain storage conditions. In some embodiments, the storage conditions do not require special accommodation, such as, e.g. tightly regulated cooling, heating, humidifying, or keeping of antiseptic conditions. In some embodiments, no accommodation is required and the shelf-stable formulations may be stored under any conditions, e.g. high and low temperatures, high and low humidity, atmospheric pressure, normal air, etc. Shelf-stable microbial formulations include seed-based vessels comprising microbes that retain their viability for at least 1 month, at least 3 months, or at least 6 months. In other embodiments, shelf-stable formulations include seed-based vessels comprising microbes that retain their viability for at least 12 months, for example for at least 2 years, or for at least 3 years. An “anhydrous state” as used herein means a state, e.g. of a storage medium surrounding the microbes with low or no detectable amounts of water. A substantially anhydrous state includes states with less than about 30%, 20%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.1%, 0.01%, 0.001%, 0.0001% or less water w/w of the storage medium. In some embodiments, the storage medium is a seed-based storage vessel. An “anaerobic state” as used herein means a state, e.g. of a storage medium surrounding the microbes with low or no detectable amounts of oxygen. A substantially anaerobic state includes states with less than about 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.1%, 0.01%, 0.001%, 0.0001% or less oxygen w/w of the storage medium. In some embodiments, the storage medium is a seed-based storage vessel. An “abiotic stress” as used herein is an environmental stress condition that, e.g. a plant, a part of a plan, a seed or a microbe or population of microbes is subjected to that includes, e.g., drought stress, salt stress, heat stress, cold stress, and low nutrient stress. A “biotic stress” as used herein is an environmental stress condition that, e.g. a plant, a part of a plan, a seed or a microbe or population of microbes is subjected to that includes, e.g. nematode stress, insect herbivory stress, fungal pathogen stress, bacterial pathogen stress, or viral pathogen stress. The stress may be temporary, e.g. several hours, several days, several months, or permanent, e.g. for the life of the plant, seed of microbe. The term “uniformity of the distribution”, as used herein, is a measure of the uniformity of a population, for example, of seeds, with respect to the presence and/or quantity of microbes. Therefore, a population in which 100% of the seeds in a population of seeds contains a microbe has a higher, or increased uniformity of seeds when compared with a population in which 70% of the seeds in a population contains the microbe. Likewise, a population in which 80% of the seeds in a population contains at least 102CFU of a microbe per seed has a higher, or increased uniformity of seeds when compared with a population in which 10%, 20%, 30%, 40%, 50% or greater than 50% of the seeds in a population contains at least 102CFU the microbe. The term “uniformity of endophyte networks”, as used herein, is a measure of the uniformity of a population of a plurality of microbe types in a plant or portion of a plant. A population of plants is considered to have an increased uniformity of endophyte networks than in a reference population when a higher proportion of plants in the population contain a representation of the same microbe types than in the reference population. As used herein, the number of microbes of the same kind in a plant or a portion thereof is sometimes referred to as a “copy number”. Therefore, a seed is considered to have a higher copy number of a first microbe than another microbe when the first microbe is present in higher numbers than the other microbe within the seed. To date, the majority of microbial cultivation methods have relied upon in vitro methods comprising liquid-based, plate-based, solid-state, and other formats. In many such methods, bioreactors are utilized to create an environment within which desired microbes can be cultivated to encourage the scalable expansion of an initial inoculum. Methods for cultivating microbes within bioreactors can suffer from contamination of external microbes and can require the use of antibiotics or other undesirable agents. Further, cultivation of microbes in an artificial environment can select for variants of the microbe that alter or diminish its desired properties. For example, if the desired property of a microbe is not required for its efficient propagation in culture (e.g., production of a pharmaceutically, agriculturally, or industrially useful biomolecule), the microbe's physiology can shift or become altered so as to reduce its performance of that desired function. Such alterations can occur either transiently or as a result of genomic drift or loss of an important plasmid, thereby reducing the value of the resulting microbial population. Bioreactor-based methods have been successfully developed to allow the expansion of gram-negative microbes such as (e.g., Genomic technologies and culture-independent microbial characterization methods illustrate that a significant amount of microbial biodiversity remains to be efficiently cultivated in lab or industrial settings. The GenBank® sequence database, which is an annotated collection of publicly-available nucleotide and amino acid sequences, contains sequences from over 30,000 species of bacteria. While this number may appear impressive, it is instructive to note that a recent estimate suggests that the ocean may support as many as 2 million different species of bacteria, and a ton of soil may support more than double that number (Curtis et al., Proc. Natl. Acad. Sd. USA 99:10494-10499, 2002). Furthermore, only about 13,000 of the bacteria represented in GenBank® have been formally described, and many of these lie within 4 of the 40 bacterial divisions (DeLong, Curr. Oγin. Microbiol. 4:290-295, 2001). The paucity of knowledge regarding other microbial species can be similar or greater. This is at least in part due to the fact a large diversity of microorganisms from the environment resist cultivation in the laboratory and an even greater diversity resists cultivation in methods that could be amenable to large-scale expansion of a desired microbial population or their storage in a shelf-stable format. Some estimates argue that such as-yet uncultivated or difficult-to-cultivate microbes may represent 99-99.99% of all microbial species in nature (see, e.g., Young, ASM News 63:417-421, 1997) and the majority of plant-associated microbes appear to fall in this category. Microbial diversity is typically examined by amplifying 16S rRNA genes from DNA samples isolated from a specific habitat. The sequences are then compared to each other and to the 16S rRNA sequences from known species. If no close match to an existing 16S rRNA gene sequence is found, then the test sequence is thought to represent a new microorganism that is uncultivated or difficult to cultivate in lab settings. 16S rRNA genes, which are critical for translation, are the genes of choice for these experiments because they are thought to be conserved across vast taxonomic distance, yet show some sequence variation between closely related species. Phylogenetic analyses of 16S rRNA sequences obtained from direct sampling of environments suggest that uncultivated or difficult-to-cultivate microorganisms can be found in nearly every taxon within Bacteria and Archaea, and several groups at the division level have been identified without close cultivable representatives (see, e.g., Giovarmoni et al., Nature 345: 60-63, 1990; and Dojka et ah, Appl. Environ. Microbiol. 66:1617-1621, 2000). A principal reason for this disparity is that a limited number of microorganisms from environmental samples grow on nutrient media in Petri dishes, liquid media, and other cultivation methods that have been utilized to date. The discrepancy between the microbial total count and plate count can be several orders of magnitude. Attempts to improve the recovery of microorganisms from environmental samples by manipulating growth media have improved the detectable fraction of cultivable microbes, but often such methods can come with the consequence of increased cost, complexity, and typically are restricted in their ability to allow large-scale expansion of desired microbes. A number of methods have been explored to allow the cultivation of as-yet uncultivated or difficult-to-cultivate microbes within small bioreactor systems that can better mirror environmental and nutritional conditions of a microbe's habitat in nature. While such methods appear to increase the diversity of cultivatable microbes, they are often limited to volumes of a few milliliters or volumes of less than a liter and therefore are limited in the quantity of a desired microbe that can be produced at relatively low cost. In a limited set of instances, living hosts have been utilized to propagate defined combinations of microbes. For example, sterile mammalian hosts have been introduced with microbes that propagate within the host gastrointestinal tract to allow propagation of difficult-to-cultivate microbes including segmented filamentous bacteria, fermicutes, bacteroides, and other microbes. These examples have included mammalian hosts that are inoculated with individual strains as well as hosts that are inoculated with a collection of multiple strains. The resulting hosts can harbor defined microbial communities and can be used to continually produce and excrete compositions that comprise the desired microbe. Such systems are desirable for their capacity to produce relatively large quantities of desired microbes at low costs. Just as mammals serve as host to a complement of microbial symbionts across multiple epithelial habitats, plants serve as host to bacteria and fungi that live both within and around their tissues. Endophytes are fungal or bacterial organisms that live within plants. Bacterial endophytes, such as Firmicutes, Actinobacteria, Proteobacteria, Bacteroidetes, and Verrucomicrobia, appear to inhabit various host plant tissues, often colonizing intercellular spaces of host leaves, stems, flowers, fruits, or roots. Epiphytes are fungal or bacterial organisms that live on plants. The rhizosphere represents an additional habitat for bacterial and fungal microbes that reside in, on, or in close proximity to plant root tissues. A relatively small number of these plant-associated microbes have been cultivated in controlled laboratory settings and an even smaller number have been cultivated under conditions that are amenable to allowing large scale expansion of desired microbes. Thus, large fractions of plant-associated microbial diversity are as-yet-uncultivated or difficult-to-cultivate. Despite the limited number of such microbes that have been scalably cultivated or expanded, a diversity of potential industrial applications have been described for plant-associated microbes, including the production of medicinal bioactive molecules, including antibiotics, antimycotics, immunosuppressants, and anti-cancer agents. Such microbes may have applications across multiple industries including novel chemicals, pharmaceuticals, human or animal supplements, foods, agricultural products, and others. Thus, there is a significant need for novel methods to scalably cultivate plant-associated microbes in formats that allow the scalably expansion of a defined population of microbes. There is an additional need for novel methods to create shelf-stable formulations of useful microbes. Frequently, the viability of microbes can be compromised when they are removed from their native habitat and subjected to the environmental conditions of laboratories, industrial settings, shipping facilities, and other environments in which microbes would desirably be stored. In various ways, harsh environmental conditions with fluctiontions in temperature, humidity, chemical exposure, mechanical stress, light and other electromagnetic radiation, and other stresses can adversely affect the viability of microbes. Often, fragile microbial preparations are stored in frozen conditions (sometimes even under conditions that utilize liquid nitrogen, −80 degree Celcius freezers, or other costly measures) using formulations that can include excipients such as glycerol, solutions that include low concentrations of solvents like dimethyl sulfoxide, preservatives, and others. In some cases, care is taken to dessicate a microbial preparation in an effort to improve its viability. Additional customized methods are used to tailor storage conditions to avoid specific stresses (e.g., anaerobic organisms are generally additionally stored under conditions that can help reduce exposure to oxygen, light-sensitive organisms are stored to avoid exposure to light, etc.). Each of these steps can add complexity and cost to a process and, even under such care, samples of desirable microbial preparations can become compromised, with viability diminishing over time or being lost entirely. The present invention provides a surprisingly generalizable method for introducing defined microbial populations into plants such that the microbes replicate within plant reproductive tissues. The invention additionally provides methods for novel microbes to become packaged within plant seeds, which can then be stored under room-temperature conditions for extended periods of time. This method relies on a novel approach to co-opting the plant's ability to produce seeds in order to create seeds that serve as shelf-stabile vehicles of desired populations of novel microbes. In some embodiments these seeds are planted under indoor or outdoor conditions in order to allow scalable expansion of the desired microbial population. Together, the present invention provides novel methods for propagating and storing plant-associated microbes. These methods involve the introduction of desired microbes to plant host ‘bioreactors’ in such a way that allows their growth in plant tissues and their reproducible entry into plant seeds as vehicles for their long-term shelf-stable storage. The invention particularly describes the use of plant hosts with agricultural precedent as a means of utilizing established agricultural practices as a means of allowing the uniform, scalable, and low-cost expansion of desired microbial preparations. Aspects of the invention relate to methods of obtaining and cultivating plant-associated microbes. In some embodiments, the plant-associated microbes are symbionts. In some embodiments, the plant-associated microbes are endophytes. Plant-associated microbes include fungi and bacteria. In some embodiments, the microbes reside in or on the plant. In some embodiments, the microbes are propagated in the plant bioreactor, or a population of plant bioreactors, to obtain at least 10 times, at least 100 times, at least 103times, at least 104times, at least 105times, at least 106times, at least 107times, at least 108times, at least 109times as many microbes. Aspects of the invention are based at least in part on the realization that plant-associated microbes have a number of agricultural utilities and present a valuable resource for obtaining a number of compounds of interest. The prior art provides many examples in which microbes are described as contaminants and a nuisance and numerous methods utilizing, e.g. antibiotics and fungicides have been described to eliminate microbes from plant cultures to avoid contaminations. Few methods are provided that allow the cultivation of plant-associated microbes. These methods generally utilize in vitro culture assemblies that require sterile conditions and tight controls on the environment, e.g. of temperature, humidity, oxygen content, media content, agitation, substrate, etc. These cultivation methods are expensive and difficult to maintain. Additionally, bacterial microbes and fungal microbes cannot generally be co-cultivated as they require different growth environments in artificial settings. Further, the cultivation methods are often not suitable for co-cultivation of certain groups of microbes, e.g. slow growing and fast growing microbes as they bias the culture that can be obtained to the microbe best adapted to the specific conditions provided in the in vitro culture assembly. These difficulties have led to the proposal that certain microbes are difficult to culture, or even unculturable. Because of the existing limitations many, if not most of the microbes existing in nature are as yet uncultured. The methods and plant bioreactors described herein can overcome the significant limitations of current in vitro microbial cultivation methods. Any plant may be suitable for the co-cultivation of the selected microbes. Particularly suited plants are described herein include spermatophytes. Suitable plants that can be used as bioreactors to cultivate plant-associated microbes include both monocots and dicots (including eudicots) that can be colonized by the microbes according to the methods described herein. In some embodiments, the plant is a flowering plant (angiosperm). Suitable plants for use as a bioreactor to cultivate plant-associated microbes include, but are not limited to, grasses (Graminae), wheat, corn, rye grasses, and bluegrasses. Cultivars of maize, soybean, wheat, barley, and cotton are also suitable to cultivate plant-associated microbes according to the methods described herein. Further, genetically modified plants may be used as bioreactors to cultivate plant-associated microbes in accordance to the methods described herein. In some aspects, methods are provided herein that allow the co-cultivation of selected microbes, e.g. endophytes. For example, two, three, four, five, six, seven, eight, nine, ten or more selected microbes may be co-cultivated. In some embodiments, the selected microbes may be co-cultivated in a plant bioreactor. For example, one or more microbes selected from those listed in Table 2 may be co-cultivated using the plant bioreactors and methods described herein. In some embodiments, a microbe of the family Microbacteriaceae can be co-cultured with a microbe of the family Chitinophagaceae. In some embodiments, a microbe of the family Microbacteriaceae can be co-cultured with a microbe of the family Bacillaceae. In some embodiments, a microbe of the family Microbacteriaceae can be co-cultured with a microbe of the family Planococcaceae. In some embodiments, a microbe of the family Microbacteriaceae can be co-cultured with a microbe of the family Clostridiaceae. In some embodiments, a microbe of the family Microbacteriaceae can be co-cultured with a microbe of the family Comamonadaceae. In some embodiments, a microbe of the family Microbacteriaceae can be co-cultured with a microbe of the family Oxalobacteraceae. In some embodiments, a microbe of the family Microbacteriaceae can be co-cultured with a microbe of the family Enterobacteriaceae. In some embodiments, a microbe of the family Microbacteriaceae can be co-cultured with a microbe of the family Pseudomonadaceae. In some embodiments, a microbe of the family Microbacteriaceae can be co-cultured with a microbe of the family Xanthomonadaceae. In some embodiments, a microbe of the family Chitinophagaceae can be co-cultured with a microbe of the family Bacillaceae. In some embodiments, a microbe of the family Chitinophagaceae can be co-cultured with a microbe of the family Planococcaceae. In some embodiments, a microbe of the family Chitinophagaceae can be co-cultured with a microbe of the family Clostridiaceae. In some embodiments, a microbe of the family Chitinophagaceae can be co-cultured with a microbe of the family Comamonadaceae. In some embodiments, a microbe of the family Chitinophagaceae can be co-cultured with a microbe of the family Oxalobacteraceae. In some embodiments, a microbe of the family Chitinophagaceae can be co-cultured with a microbe of the family Enterobacteriaceae. In some embodiments, a microbe of the family Chitinophagaceae can be co-cultured with a microbe of the family Pseudomonadaceae. In some embodiments, a microbe of the family Chitinophagaceae can be co-cultured with a microbe of the family Xanthomonadaceae. In some embodiments, a microbe of the family Bacillaceae can be co-cultured with a microbe of the family Planococcaceae. In some embodiments, a microbe of the family Bacillaceae can be co-cultured with a microbe of the family Planococcaceae. In some embodiments, a microbe of the family Bacillaceae can be co-cultured with a microbe of the family Clostridiaceae. In some embodiments, a microbe of the family Bacillaceae can be co-cultured with a microbe of the family Comamonadaceae. In some embodiments, a microbe of the family Bacillaceae can be co-cultured with a microbe of the family Oxalobacteraceae. In some embodiments, a microbe of the family Bacillaceae can be co-cultured with a microbe of the family Enterobacteriaceae. In some embodiments, a microbe of the family Bacillaceae can be co-cultured with a microbe of the family Pseudomonadaceae. In some embodiments, a microbe of the family Bacillaceae can be co-cultured with a microbe of the family Xanthomonadaceae. In some embodiments, a microbe of the family Planococcaceae can be co-cultured with a microbe of the family Clostridiaceae. In some embodiments, a microbe of the family Planococcaceae can be co-cultured with a microbe of the family Comamonadaceae. In some embodiments, a microbe of the family Planococcaceae can be co-cultured with a microbe of the family Oxalobacteraceae. In some embodiments, a microbe of the family Planococcaceae can be co-cultured with a microbe of the family Enterobacteriaceae. In some embodiments, a microbe of the family Planococcaceae can be co-cultured with a microbe of the family Pseudomonadaceae. In some embodiments, a microbe of the family Planococcaceae can be co-cultured with a microbe of the family Xanthomonadaceae. In some embodiments, a microbe of the family Clostridiaceae can be co-cultured with a microbe of the family Comamonadaceae. In some embodiments, a microbe of the family Clostridiaceae can be co-cultured with a microbe of the family Oxalobacteraceae. In some embodiments, a microbe of the family Clostridiaceae can be co-cultured with a microbe of the family Enterobacteriaceae. In some embodiments, a microbe of the family Clostridiaceae can be co-cultured with a microbe of the family Pseudomonadaceae. In some embodiments, a microbe of the family Clostridiaceae can be co-cultured with a microbe of the family Xanthomonadaceae. In some embodiments, a microbe of the family Comamonadaceae can be co-cultured with a microbe of the family Oxalobacteraceae. In some embodiments, a microbe of the family Comamonadaceae can be co-cultured with a microbe of the family Enterobacteriaceae. In some embodiments, a microbe of the family Comamonadaceae can be co-cultured with a microbe of the family Pseudomonadaceae. In some embodiments, a microbe of the family Comamonadaceae can be co-cultured with a microbe of the family Xanthomonadaceae. In some embodiments, a microbe of the family Oxalobacteraceae can be co-cultured with a microbe of the family Enterobacteriaceae. In some embodiments, a microbe of the family Oxalobacteraceae can be co-cultured with a microbe of the family Pseudomonadaceae. In some embodiments, a microbe of the family Oxalobacteraceae can be co-cultured with a microbe of the family Xanthomonadaceae. In some embodiments, a microbe of the family Enterobacteriaceae can be co-cultured with a microbe of the family Pseudomonadaceae. In some embodiments, a microbe of the family Enterobacteriaceae can be co-cultured with a microbe of the family Xanthomonadaceae. In some embodiments, a microbe of the family Pseudomonadaceae can be co-cultured with a microbe of the family Xanthomonadaceae. In some embodiments, methods are provided allowing the co-cultivation of two or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25 or greater than 25) different microbes, such as endophytes, e.g., obtained from different families or different genera of microbes, such as bacteria, or from the same genera but different species of microbes. The different microbes can be obtained from the same cultivar of agricultural plant (e.g., the same maize, wheat, rice, or barley plant), different cultivars of the same agricultural plant (e.g., two or more cultivars of maize, two or more cultivars of wheat, two or more cultivars of rice, or two or more cultivars of barley), or different species of the same type of agricultural plant (e.g., two or more different species of maize, two or more different species of wheat, two or more different species of rice, or two or more different species of barley). In some cases, the plant bioreactors are inoculated with microbes that are heterologous to the seed of the inoculated plant bioreactor. In one embodiment, the microbe is derived from a plant of another species. For example, a microbe that is normally found in dicots is applied to a monocot plant bioreactor (e.g., inoculating corn with a soy bean-derived endophyte), or vice versa. In other cases, the microbe to be inoculated onto a plant bioreactor is derived from a related species of the plant bioreactor that is being inoculated. In one embodiment, the microbe is derived from a related taxon, for example, from a related species. The plant of another species can be an agricultural plant. The methods described herein are particularly suitable for co-cultivating multiple selected microbes. In some embodiments, using the plant bioreactors and methods described herein a desired ratio of selected microbes can be achieved. For example, under traditional in vitro culturing conditions fast-growing microbes may be able to outcompete slow growing microbes, making the latter difficult to culture, maintain or amplify. Nutrient-rich artificial media sources often encourage fast growing microbes, whereas nutrient-poor media sources encourage slow growing microbes. Acidification (pH), aerobic or anaerobic conditions, temperature, salt content, etc. can influence the growth rate of specific microbes and their ability to compete with co-cultivated microbes. As a result, many microbes are considered difficult to culture or even unculturable under current conditions. In some instances, microbes may be culturable singly but because of a lack of one or more competitive traits they are lost or their numbers substantially diminished when co-cultivated with other microbes. The plant bioreactors and co-cultivating methods described herein are particularly useful for the co-cultivation of microbes. Unlike artificial bioreactor setups, industrial or laboratory, that require machinery and complicated regulatory elements to control the environment, the plant bioreactors described herein are uniquely capable of providing a suitable environment for the co-cultivated microbes with little or no human intervention. Of course, if desired, the plant bioreactors may be subjected to changes in the environment, such as changes in the soil or water that can be applied to direct or influence the microbial composition comprised in the plant bioreactor. For example, the plant bioreactors may be grown in different types of soil, such as gelisol, histosol, spodosol, andisol, oxisol, vertisol, aridisol, ultisol, mollisol, alfisol, inceptisol, entisol, acrisol, albeluvisol, alisol, andosol, anthrosol, arenosol, calcisol, cambisol, chernozem, cryosol, durisol, ferralsol, fluvisol, gleysol, gypsisol, histosol, kastanozem, leptosol, lixisol, luvisol, nitisol, phaeozem, planosol, plinthosol, podozol, regosol, solonchak, solonetz, and umbrisol, described further herein, to direct or influence the microbial composition comprised in the plant bioreactor. In another example, the plant bioreactors may be grown in soil types of different temperatures, such as pergelic soil (soils at temperatures from −8° C. to −4° C.), subgelic soil (soils at temperatures from −4° C. to 0° C.), frigid soil (soils at temperatures from 0° C. to 8° C.), mesic soil (soils at temperatures from 8° C. to 15° C.), thermic soil (soils at temperatures from 15° C. to 22° C.), and pergelic soil (soils at temperatures from 22° C. or higher), described further herein, to direct or influence the microbial composition comprised in the plant bioreactor. In yet another example, the plant bioreactors may be grown in soil types of different degrees of moisture and/or degrees of oxygenation, such as aquic soil, udic soil, ustic soil, aridic soil, and xeric soil, described further herein, to direct or influence the microbial composition comprised in the plant bioreactor. In yet another example, the plant bioreactors may be grown in soil types of different soil pH, such as an ultra acidic soil (<3.5), an extreme acid soil (3.5-4.4), a very strong acid soil (4.5-5.0), a strong acid soil (5.1-5.5), a moderate acid soil (5.6-6.0), a slight acid soil (6.1-6.5), a neutral soil (6.6-7.3), a slightly alkaline soil (7.4-7.8), a moderately alkaline soil (7.9-8.4), a strongly alkaline soil (8.5-9.0), and a very strongly alkaline soil (>9.0), described further herein, to direct or influence the microbial composition comprised in the plant bioreactor. In yet another example, the plant bioreactors may be grown in soil types of varying degrees of (total) nitrogen, phosphorous, potassium, sulfur, calcium, magnesium, and sodium chloride, described further herein, to direct or influence the microbial composition comprised in the plant bioreactor. Optionally, the plant bioreactor can be inoculated with additional microbes or the existing microbes may be supplemented at different times and in different frequencies, as desired, during the operation of the plant bioreactor (e.g. for the lifetime of the recipient plant before harvesting). Suitable microbes for inoculation of the plant bioreactor include gram-positive bacteria, gram-negative bacterium and fungi. Any plant associated microbe may be used in the microbial cultivation methods described herein, including an endophyte, an epiphyte, or a rhizospheric microbe. Suitable bacteria include Suitable fungi include In some embodiments, the plant bioreactor comprises existing endogenous microbes. In some embodiments, the plant bioreactor is contacted with one or more additional microbes that are not endogenous to the plant. Optionally, one or more endogenous microbes are removed from the bioreactor. For example, removal of endogenous microbes may include depletion, sterilization or reduction of carriage of an endogenous microbe. Chemical agents such as detergents such as, e.g., bleach (sodium hypochlorite), hydrogen peroxide, or ethanol may be used to remove endogenous microbes from the surface of the bioreactor plant. In order to remove some, substantially all, or all of the endogenous microbes, additional treatments are required. For example, in one embodiment, a plant or a part thereof (including a seed) can be treated with an antibacterial and/or antifungal agent that has sufficient permeability to enter the plant tissues and kill or hinder endogenous bacteria. In some embodiments, the bioreactor plants are contacted with the one or more selected microbes. The selected microbes may be prepared for contacting by formulation of the microbes into a synthetic preparation, e.g. by any suitable method known in the art and those described herein. The contacting can be carried out by any suitable means and by the methods described herein. For example, the preparation of microbes can be an aqueous solution, an oil-in-water emulsion or water-in-oil emulsion containing a minimum concentration of a microbe. Microbes may be present as live cells, viable cells, spores, or mycelia. Typically, the concentration may range from at least about 104CFU/ml to at least about 109CFU/mL, or more. The synthetic preparation may contain growth media or constituents required for the growth and propagation of the microbe, e.g. a growth medium selected from the group provided in Table F. The synthetic preparation can be of a defined pH range, typically from about pH 5.5 to about pH 7.5. The synthetic preparation can also comprise a carrier, such as diatomaceous earth, clay, or chitin, which act to complex with chemical agents, such as control agents. The synthetic preparation can also comprise an adherent, reagents that promote internalization of the microbes into the plant, a surfactant, an osmoticum, agents that promote stomatal opening, and other agents. In addition to aqueous suspensions, the microbial preparations of the invention can be applied in a dry formulation using, e.g., talc or some other particulate carrier. In such cases, the microbial preparation can be dried lyophilized in a manner preserving viability of the microbe (for example by using cryopreservants and/or protective sugars). The bioreactor plants may be contacted with the one or more selected microbes, optionally provided as a synthetic preparation described herein by any suitable method, including, but not limited to, spraying on flowering plants, application to the flower by specific instruments, for example, by a spatula, a syringe or an inoculating loop, employing pollen-feeding insects or other pollinators. Additionally, the seeds or tubers can be submerged in the aqueous composition and then planted and allowed to grow into a plant. Furthermore, the soil around the plant or seed can be treated as well. When the plant to be treated is a tree, the composition can be introduced into the vascular system of the tree by conventional methods. In some embodiments, a suspension or paste of microbes is brushed or painted onto the whole plant or particular tissue/organs of the plant. In some embodiments, the entire bioreactor plant is contacted with the microbes, e.g. by spraying or submersion. In other embodiments, only one or more parts of the bioreactor plant are contacted, e.g. roots, shoots, leaves, above-ground tissues, or parts of the plant including the flowers or buds. The bioreactor plants may be contacted with the microbes at any developmental stage of the plant, as desired. In some embodiments, the contacting step of the plant with the microbes is performed more than once at suitable intervals, as desired. In one embodiment, the one or more microbes are placed onto a seed. In some embodiments, the one or more microbes are placed into a seed. In yet other embodiment, the one or more microbes are placed into and onto the seeds. In some embodiments, the one or more microbes are located on the seed coat or in the seed, as described further herein. Methods are provided herein that are useful for encapsulating one or more selected microbes within a seed. In some embodiments, the microbes are intercellularly located. In other embodiments, the microbes are intracellularly located. In some embodiments, the microbes are placed in or on the seed to generate plant bioreactors. In some embodiments, selected microbes are stored in seed-based vessels. In some embodiments, microbial endophyte libraries are generated. Plant seeds may be contacted with an inoculum comprising a plurality of microbial endophytes and the resulting contacted seeds are collected. The microbial endophytes present in the contacted seed are subsequently incorporated into a bioreactor plant grown or derived from the contacted plant seed, such that a microbial endophyte library is generated within the bioreactor plant and/or the resulting seeds from the bioreactor plant. In some embodiments, the resulting contacted seed comprises one or more of the plurality of microbial endophytes of the inocculum. In some embodiments, the library generated in the seed comprises one or more endogenous microbial endophytes and optionally one or more of the plurality of microbial endophytes of the inocculum. In some embodiments, the contacted seed comprises endogenous and exogenous microbial endophytes. In some embodiments, at least on of the plurality of microbial endophytes of the inocculum is exogenous to the contacted seed. In some embodiments, the microbes are amplified in the plant bioreactor. The amplification may suitably occur by planting and culturing the plant bioreactors in a field. For example, a field containing a population of plant bioreactors may range from at least about 100 square feet to at least about 50,000 or more. Other fields containing a population of plant bioreactors may range from at least about 1 acre to at least about 50,000 acres or more. Other fields containing a population of plant bioreactors may range from at least about 1 hectare to at least about 10,000 hectares or more. Some fields may comprise a population of plant bioreactors of 1 to 50 plants. Some fields may comprise a population of plant bioreactors ranging from at least about 50 plants to at least about 1,000,000 plants. The plant bioreactors may be harvested and/or the selected microbes may be harvested. In certain embodiments, the selected microbes are located in or on a seed generated by the plant bioreactor. Optionally, the selected microbes may be stored for a period of time in a seed-based storage vessel. The seed-based storage vessels provide a shelf-stable format in which the microbes may be stored. Further provided herein are methods to generate shelf-stable formulations of microbes comprising generating seed-based storage vessels comprising microbes. For example, shelf-stable formulations include seed-based vessels comprising microbes that retain their viability for at least 1 month, at least 3 months, or at least 6 months. In other embodiments, shelf-stable formulations include seed-based vessels comprising microbes that retain their viability for at least 1 month, at least 2 months, at least 3 months, at least 6 months, 12 months, for example for at least 2 years, or for at least 3 years. In certain embodiments, the seed-based storage vessels are selected for the long-term storage of selected microbes. For example, microbes may be stored in seed-based storage vessels that are resistant to an environmental stress. Environmental stresses include elevated or low temperatures, elevated or low humidity, and pathogen exposure. In vitro propagated and maintained microbes are particularly susceptible to changes in the environment, such as changes in temperature, humidity, pH, etc. and the cultures are susceptible to pathogenic invasion. In certain embodiments, seed-based storage vessels are provided that maintain the viability of the selected microbes for long period of time. Optionally, the seed-based storage vessels may be further functionalized or modified to improve the storage conditions of the stored microbes and/or to prolong their viability in storage. For example, the seed-based storage vessels may be coated with a coating composition as described herein. If desired, the coating composition may comprise a control agent, a plant growth regulator, and/or a fertilizer/nutrient. Suitable control agents for coating the seed-based storage vessels include, but are not limited to, antibacterial agents, fungicides, herbicides, insecticides, rodenticides, nematocides, miticides or bird repellents, a plant growth regulator and a fertilizer/nutrient. If desired, the plant-associated microbes may be further isolated, e.g. isolated from the plant bioreactor or the seed-based storage vessel. The microbes may be isolated by any suitable method known in the art and those described herein, for example in Examples 7 to 14. Isolates may be cultivated by standard in vitro propagation methods. If desired the microbes can be assessed by standard cultivation and characterization methods known on the art, including culturing of the microbes, single clone generation, nucleic acid (DNA/RNA) extraction and amplification (e.g. of 16S rRNA gene amplification) microbial identification (e.g. through sequencing) and phylogenetic analyses. If desired, the isolated microbes may be used for the production of an inoculums as described herein, for example in Examples 7 to 14. Alternatively or in addition, the microbes may by maintained in culture, further isolated, modified (e.g. genetically modified), further characterized (e.g. screened for desired characteristic or capabilities), and/or combined to obtain desired microbial populations or communities. Isolated microbes may be stored in any suitable medium and may, e.g. be frozen. Provided herein are further methods of amplifying plant microbes capable of producing a compound of interest using the plant bioreactors and methods described herein. A compound of interest includes a precursor or intermediate as well as a final compound. The bioreactor plants may be contacted with suitable microbes capable of producing the compound of interest and the microbes may be amplified using the methods described herein, including field application of the plant bioreactors. Optionally, the microbes may be isolated and stored, e.g. in seed-based storage vessels as described herein. Optionally, the compound of interest may be isolated from the microbes. Provided herein are methods for propagating and isolating microbes that produce industrially-useful enzymes and chemicals. Current bioprocesses for producing industrial enzymes such as celluloses, peroxidases, proteases, and glycosidases or for producing biochemical from microbes typically involve monocultures of microbes in metallic bioreactors in a format that can require expensive synthetic media inputs, physical mixing systems, and methods for sensing key parameters for allowing microbial division and production (e.g., pH, osmolyte, and byproduct monitoring). Here, by discovering endophytes with the ability to produce such useful proteins and chemical products, the present invention provides the potential to produce such products or expand a population of microbes as useful inputs to such processes using low-cost plant propagation processes. In characterizing the functional repertoire of microbes with the ability to be expanded within plant-based bioreactors, we identified endophytes with the ability to produce industrially-useful enzymes or industrially-useful chemicals. We discovered endophytes with the capacity to produce industrially useful enzymes such as cellulases, chitinases, and xylanases. Thus, in some embodiments, our invention utilizes plant-based bioreactors to provide for the production of a cellulose, a chitenase, or a xylanase within the tissues of an agricultural plant-based bioreactor. Thus, the invention allows the utilization of standard and novel agricultural methods for the scalable production of microbes with the capacity to produce such industrially-useful enzymes, and for the production of such enzymes within the plant tissues. In some embodiments, our invention applies an isolated endophyte capable of producing an industrially-useful enzyme in a composition that allows it to colonize agricultural seeds, survive archiving on the surface or in the interior of the agricultural seed, and reproduce within agricultural plant-based bioreactors within at least one tissue such that it produces at least 1 CFU, at least 10, at least 100, at least 1,000, at least 104, at least 105, at least 106, or at least 107CFU of the microbe capable of producing an industrially-useful enzyme per gram of the plant bioreactor tissue that the microbe replicates within. In some embodiments, the invention produces detectable quantities of the industrially-useful enzyme in at least one tissue of the plant, including the roots, shoots, leaves, flowers, and other tissues. In some embodiments, by utilizing standard or novel agricultural methods for planting the endophyte-contacted seeds, the invention allows the production of at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 1010, at least 1011, at least 1012, at least 1013, at least 1014, or at least 1015CFU of the microbe capable of producing an industrially-useful enzyme per acre of seeds that are planted. We also discovered endophytes capable of producing chemicals of industrial interest, including an auxin, antimicrobial compounds, siderophores, or acetoin. Thus, in some embodiments, our invention utilizes plant-based bioreactors to provide for the production of an auxin, antimicrobial compounds, siderophores, or acetoin within the tissues of an agricultural plant-based bioreactor. Thus, the invention allows the utilization of standard and novel agricultural methods for the scalable production of microbes with the capacity to produce such industrially-useful chemicals, and for the production of such chemicals within the plant tissues. In some embodiments, our invention applies an isolated endophyte capable of producing an industrially-useful chemical in a composition that allows it to colonize agricultural seeds, survive archiving on the surface or in the interior of the agricultural seed, and reproduce within agricultural plant-based bioreactors within at least one tissue such that it produces at least 1 CFU, at least 10, at least 100, at least 1,000, at least 104, at least 105, at least 106, or at least 107CFU of the microbe capable of producing an industrially-useful enzyme per gram of the plant bioreactor tissue that the microbe replicates within. In some embodiments, the invention produces detectable quantities of the industrially-useful enzyme in at least one tissue of the plant, including the roots, shoots, leaves, flowers, and other tissues. In some embodiments, by utilizing standard or novel agricultural methods for planting the endophyte-contacted seeds, the invention allows the production of at least 104, at least 105, at least 106, at least 107, at least 108, at least 109, at least 1010, at least 1011, at least 1012, at least 1013, at least 1014, or at least 1015of the microbe capable of producing an industrially-useful chemical per acre of seeds that are planted. Plants as Bioreactors and Agricultural Seeds as Vessels for Long-Term Microbial Storage Plants serve as ‘bioreactors’ for diverse microbes in nature and appear to, in some cases, be able to package a very small subset of such microbes into their seeds. Here, we sought to investigate whether plants could serve as novel bioreactors for exogenous microbes and, further, whether this could be accomplished in such a way that their seeds could comprise the novel microbe in a shelf-stable format such that these seeds could allow subsequent scale-up of the desired exogenous microbe via planting under standard agricultural conditions. The prevailing view of plant endophytic communities is that they derive predominantly from the soil communities in which plants are grown [Hallman, J., et al., (1997) Canadian Journal of Microbiology. 43(10): 895-914]. Upon observing taxonomic overlap between the endophytic and soil microbiota in Less attention has been provided to the role of seeds as potential reservoirs for microbes that can efficiently populate the plant endosphere. The concept that seeds may harbor plant pathogens was promoted by Baker and Smith [(1966) Annu Rev Phytopathol 14: 311-334] and a few bacterial and fungal pathogens are known to be able to infect seed. When such pathogens are detected in a seed lot, it can necessitate destruction of vast numbers of agricultural germplasm [Gitaitis, R. and Walcott, R. (2007) Annu Rev. Phytopathol. 45:371-97]. However, even when seed pathogens are detected, their transfer to the growing plant can be highly inefficient. For example, a study of seed-based transmission of the seed pathogen, The potential for agricultural seeds to serve as reservoirs for non-pathogenic microbes remains somewhat controversial [Hallman, J., et al., (1997) Canadian Journal of Microbiology. 43(10): 895-914]. Sato, et al., did not detect any bacteria inside rice seeds [(2003) In. Morishima, H. (ed.) The Natural History of Wild Rice—Evolution Ecology of Crop. p. 91-106] and Mundt and Hinkle only obtained endophytes from seed samples where seed coats had been broken or fractured in 29 kinds of plant seed [Appl Environ Microbiol. (1976) 32(5):694-8.]. Another group detected bacterial populations inside rice seeds ranging in population size from 10{circumflex over ( )}2 to 10{circumflex over ( )}6 CFU/g fresh weight [Okunishi, S., et al., (2005) Microbes and Environment. 20:168-177]. In crop cultivars such as maize, characterization of pooled seeds from within various cultivars from the genus Surprisingly, we discovered a variety of methods for altering the microbiota of seeds produced by crops, including the ability to reliably add novel microbes into the seed microbiota, as a means of stably storing microbes in plant seeds and propagating them in plant-based bioreactors. Provided are methods for introducing novel microbes into plants or seeds such that the seeds produced by them are able to harbor novel microbes or an altered seed microbiota relative to reference seeds. Provided are methods for introducing novel microbes or substantially augmenting a microbial population in seeds. Additionally provided are methods for introducing populations of multiple symbionts to a seed or altering their abundance or spatial distribution relative to reference seeds. Methods for propagating the cultivars resulting from such seeds are provided such that the plants act as bioreactors for the cultivation of desired microbes. Provided are demonstrations that plant hosts with abundant precedence in agricultural practice can be utilized with the present methods, thereby allowing existing cultivation practices to be adapted to utilize the current methods and compostions. The present invention offers advantages relative to the prior art practice of coating seeds with defined microbes or administering microbes to plant tissues. Notably, by generating seeds that natively harbor novel microbes or altered microbial populations, such seeds can be, in some cases, propagated repeatedly to allow scalable production of the resulting compositions using common agricultural practices. In some such embodiments, this compatibility with modern agricultural practices provides improved simplicity, reduced cost, and improved market adoption of the technology relative to current approaches of administering endophytes to plants for cultivation in a single generation. In some embodiments, seeds comprising novel microbes provide improved benefits to plants relative to a native seed that has been coated in a similar number of colony forming units of a novel microbe. In some embodiments, seeds comprising novel microbes that have been introduced by the present methods provide improved shelf-life relative to storage of the microbe on its own under similar conditions. In some embodiments, seeds with novel microbes provide improved compatability with surface-coated chemistries (e.g., biocides, fungicides, antibiotics, etc) relative to a native seed that has been coated in a similar number of colony forming units of a novel microbe and the same surface chemistries. This compatibility with common agricultural chemistries can improve the use invention's ability to be practiced using established agricultural technologies. Provided herein are methods of introducing microbes into the seed microbiota to create novel compositions comprising novel bacteria or fungi present in a monocot or dicot host seeds. Additionally provided are methods and compositions of seeds with altered microbiota, wherein the microbiota is substantially augmented, depleted, altered, or spatially redistributed in one or more strains relative to a reference seed population before alteration. As described herein, novel microbes are introduced into plant seeds by artificial inoculation, application, or other infection of a host plant, such as a plant, plant flower, or host plant tissues, with a bacterial or fungal strain of the present invention. These methods are optionally utilized in combination with methods to substantially alter or remove native symbionts within seeds or plant tissues, in order to prime them for administration of novel symbionts. These host plants are then utilized as a production process to generate seeds that have been pre-packaged with the novel microbial strain, such that the seeds can support the stable storage of the strain and the plants resulting from these seeds can support the scalable expansion of the microbe's population. Microbe Located on and/or in the Seed The present invention contemplates methods of introducing a microbe into the seed of a plant, as well as seed compositions comprising a microbe, wherein the microbe is located on and/or in the seed. A seed is a small embryonic plant enclosed in a covering called the seed coat, usually with some stored food. It is the product of the ripened ovule of gymnosperm and angiosperm plants which occurs after fertilization and some growth within the mother plant. The formation of the seed completes the process of reproduction in seed plants (started with the development of flowers and pollination), with the embryo developed from the zygote and the seed coat from the integuments of the ovule. A typical seed includes three basic parts: (1) an embryo, (2) a supply of nutrients for the embryo, and (3) a seed coat. The embryo is an immature plant from which a new plant will grow under proper conditions. The embryo has one cotyledon or seed leaf in monocotyledons, two cotyledons in almost all dicotyledons and two or more in gymnosperms. The radicle is the embryonic root. The plumule is the embryonic shoot. The embryonic stem above the point of attachment of the cotyledon(s) is the epicotyl. The embryonic stem below the point of attachment is the hypocotyl. Within the seed, there usually is a store of nutrients for the seedling that will grow from the embryo. The form of the stored nutrition varies depending on the kind of plant. In angiosperms, the stored food begins as a tissue called the endosperm, which is derived from the parent plant via double fertilization. The usually triploid endosperm is rich in oil or starch, and protein. In gymnosperms, such as conifers, the food storage tissue (also called endosperm) is part of the female gametophyte, a haploid tissue. In some species, the embryo is embedded in the endosperm or female gametophyte, which the seedling will use upon germination. In others, the endosperm is absorbed by the embryo as the latter grows within the developing seed, and the cotyledons of the embryo become filled with this stored food. At maturity, seeds of these species have no endosperm and are termed exalbuminous seeds. Some exalbuminous seeds are bean, pea, oak, walnut, squash, sunflower, and radish. Seeds with an endosperm at maturity are termed albuminous seeds. Most monocots (e.g. grasses and palms) and many dicots (e.g. Brazil nut and castor bean) have albuminous seeds. All gymnosperm seeds are albuminous. The seed coat (the testa) develops from the tissue, the integument, originally surrounding the ovule. The seed coat in the mature seed can be a paper-thin layer (e.g. peanut) or something more substantial (e.g. thick and hard in honey locust and coconut, or fleshy as in the sarcotesta of pomegranate). The seed coat helps protect the embryo from mechanical injury and from drying out. In addition to the three basic seed parts, some seeds have an appendage on the seed coat such an aril (as in yew and nutmeg) or an elaiosome (as in Corydalis) or hairs (as in cotton). A scar also may remain on the seed coat, called the hilum, where the seed was attached to the ovary wall by the funiculus. There are several ways in which one can determine whether a microbe is located on and/or in the seed. The presence of the microbe can be determined microscopically, using reagents that can detect the microbe (e.g., antibodies that recognize the microbe, or a PCR-based detection system to detect presence of microbe-specific sequences within a seed sample). Alternatively, the location of the microbe within the seed can be determined by sterilizing the surface of the seed using any number of chemical agents (e.g., bleach, detergent, hydrogen peroxide or combinations thereof) to destroy any surface located microbes, and testing for the presence of surviving microbes after homogenizing the surface sterilized seeds under conditions allowing growth of the microbe. Therefore, the loss of microbe viability upon surface sterilization indicates that the microbes are almost exclusively located on the seed surface. In contrast, resistance of the microbe population to such seed sterilization methods indicates an internal localization of the microbes. In one embodiment, the microbe is located on and/or in the seed. In another embodiment, the microbe is located on the seed coat or in the seed (i.e., located within the tissues/compartments contained within the seed coat). In still another embodiment, the microbe is located in the seed. In another embodiment, the microbe is located in the embryo of the seed. In another embodiment, the microbe is located within the endosperm of the seed. The presence of the microbe in the embryo or endosperm, as well as its localization with respect to the plant cells, can be determined using methods known in the art, including immunofluorescence microscopy using microbe specific antibodies, or fluorescence in situ hybridization (see, for example, Amann et al. (2001) Current Opinion in Biotechnology 12:231-236, incorporated herein by reference). The methods described herein are useful for encapsulating a microbe within a seed. In one further embodiment, the microbe is intercellularly located. For example, at least 10% of the microbes in a seed, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more of the microbe within the seed is intercellularly located. In another embodiment, at least 1 CFU of the microbe, for example, at least 10 CFU, at least 30 CFU, at least 100 CFU, at least 300 CFU, at least 1,000 CFU or more of the microbe is intercellularly located. In another embodiment, the microbe is intracellularly located. For example, at least 10% of the microbes in a seed, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more of the microbe within the seed is intracellularly located. In another embodiment, at least 1 CFU of the microbe, for example, at least 10 CFU, at least 30 CFU, at least 100 CFU, at least 300 CFU, at least 1,000 CFU or more of the microbe is intracellularly located. Novel Plant and Agricultural Seed Compositions The present invention provides surprisingly generalizable methods for introducing microbes into plant reproductive tissues such that they are able to be passaged into the interior or onto the surface of seeds. Therefore, in one aspect, the invention provides a novel seed comprising a microbe introduced on its surface or within its interior. The seeds described herein can comprise a unique microbial composition. It is important to note that, none of the methods described in the prior art, particularly the methods disclosed in WO 00/29607 A1, WO 2011/117351 A1, WO 2010/115156 A2, WO 2007/107000 A1, WO 2007/021200 A1, US 2012/144533 A1, U.S. Pat. No. 4,940,834 A, CA 2562175 A1 and WO 2011/082455 A1 (each of which is incorporated by reference in its entirety), disclose methods for providing seeds comprising selected endophytes or novel microbes. The main goal of these prior art methods is the provision of the endophytes to the very plant treated and not—as is described herein—for producing a mother plant with the microbes of interest and to obtain microbe-containing seeds from this mother plant for rising daughter plants already containing the microbes and, optionally, passing the microbes further to their own daughter generation. As described herein, the microbe is viably and stably integrated into the seed. Accordingly, the technology provided with the present invention can provide seeds with completely novel characteristics, for example, having a unique microbial community (for example by having one single microbe species being predominantly present in the seeds or a plant that grows from such seeds (e.g., representing more than 1%, for example more than 10%, more than 20%, more than 30%, 50%, or more than 70% or even more than 80% of the total of microbes in the seed)). In some cases, the present invention also provides seeds obtainable by the methods described herein, wherein the seed has unique characteristics, e.g., with a predominant microbe species as disclosed above. An embodiment of the present invention is therefore drawn to seeds obtainable by a method according to the present invention, wherein the microorganisms are present in a population density of 1 to 105CFU/seed. The localization of the microbe within the seed can be determined by a number of methods. Its location with respect to the seed coat (i.e., whether the microbe is located on the surface of the seed or inside the seed coat, or inside the seed) can be determined rapidly by testing for its resistance to surface sterilization methods described elsewhere. The presence of microbial DNA after such surface sterilization, particularly using agents that cross-link or otherwise destroy DNA, using sensitive detection methods such as PCR, can be used to establish the presence of the microbe within the seed coat. Viability of the microbe can be tested after seed surface sterilization, or after removal of the seed coat, by homogenizing the seed and growing the homogenate under conditions that promote growth of the microbe. In the alternative, the presence of microbes can be detected visually or microscopically if the microbes can form a colony that is visible by such inspection. Reagents are also available for the detection of microbes: the stain aniline blue can be used for detecting hyphae (Clark et al., J. Microbiol Methods (1983) 1: 149-155), other assays are known in the art (reviewed, for example, in Hiatt et al., (1999) Crop Science, 39: 796-799, WAG-conjugated fluorophore used by Lanver et al., (2010) Plant Cell 22: 2085-2101). The methods described herein permit the alteration of the seed with novel or endogenous microbes. The advantage of these methods is that, when desired, the seed can be programmed with microbes that can localize to and propagate in distinct tissues or portions of the plant. As such, in one embodiment, inoculation with the microbes permits the localization of microbes into tissues, portions in which they are normally not associated. In addition, in some cases, the microbe present in the seed is capable, upon germination of the seed into a vegetative state, of localizing to a different tissue of the plant. For example, the microbe can be capable of localizing to any one of the tissues in the plant, including: the root, adventitious root, seminal root, root hair, shoot, leaf, flower, bud, tassel, meristem, pollen, pistil, ovaries, stamen, fruit, stolon, rhizome, nodule, tuber, trichome, guard cells, hydathode, petal, sepal, glume, rachis, vascular cambium, phloem, and xylem. In yet another embodiment, the invention provides seed compositions comprising a microbe, in which the microbe is located on and/or inside the seed. In still another embodiment, the invention provides seed compositions in which the microbe is located predominantly on the surface the seed. In another embodiment, the microbe is located in the seed. For example, the microbe is located in the embryo of the seed. In another embodiment, the microbe is located in the endosperm of the seed. In still another embodiment, the microbe is located intercellularly (i.e., between the cells of the plant). For example, at least 10% of the microbes in a seed, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more of the microbe within the seed is intercellularly located. In another embodiment, at least 1 CFU of the microbe, for example, at least 10 CFU, at least 30 CFU, at least 100 CFU, at least 300 CFU, at least 1,000 CFU or more of the microbe is intercellularly located. Alternatively, in another embodiment, the microbe is located intracellularly (i.e., within the plant cell). For example, at least 10% of the microbes in a seed, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more of the microbe within the seed is intracellularly located. In another embodiment, at least 1 CFU of the microbe, for example, at least 10 CFU, at least 30 CFU, at least 100 CFU, at least 300 CFU, at least 1,000 CFU or more of the microbe is intracellularly located. The presence of the microbe in the embryo or endosperm, as well as its localization with respect to the plant cells, can be determined using methods known in the art, including immunofluorescence microscopy using microbe specific antibodies, or fluorescence in situ hybridization (see, for example, Amann et al. (2001) Current Opinion in Biotechnology 12:231-236, incorporated herein by reference). In another embodiment, the seed can contain a second microbe, which is also exogenous to the seed, and introduced into the seed using the methods described herein. In another embodiment, microbes are present at a defined concentration within the seed. In one embodiment, each seed contains at least 1 CFU for example, 10 CFU for example, at least 100 CFU, at least 300 CFU, at least 1,000 CFU, at least 3,000 CFU or more, of the microbe. In yet another embodiment, the microbe is present in the seed in a detectable level, and represents at least 0.1% of the total microbe population within the seed, for example at least, at least 0.5%, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% of the total microbe population in the seed. The presence and quantity of other microbes can be established by the FISH, immunofluorescence and PCR methods described above. Furthermore, homogenates of the seed can be plated onto various media, and the percentage of the total population represented by the microbe can be determined by counting the microbial colonies (e.g., number represented by the microbe vs. total microbe count). In some cases, the microbes described herein are capable of moving from one tissue type to another in the inoculated plant bioreactor, e.g. from seed exterior into the vegetative tissues of a maturing plant. In one embodiment, a population of microbes, e.g., endophytes is capable of moving from the seed exterior into the vegetative tissues. In one embodiment, the seed microbe which is coated onto the seed of a bioreactor plant is capable, upon germination of the seed into a vegetative state, of localizing to a different tissue of the plant. For example, the microbe is capable of localizing to any one of the tissues in the plant, including: the root, adventitious root, seminal root, root hair, shoot, leaf, flower, bud, tassel, meristem, pollen, pistil, ovaries, stamen, fruit, stolon, rhizome, nodule, tuber, trichome, guard cells, hydathode, petal, sepal, glume, rachis, vascular cambium, phloem, and xylem. In one embodiment, the microbe is capable of localizing to the root and/or the root hair of the plant. In another embodiment, the microbe is capable of localizing to the photosynthetic tissues, for example, leaves and shoots of the plant. In other cases, the microbe is localized to the vascular tissues of the plant, for example, in the xylem and phloem. In still another embodiment, the microbe is capable of localizing to the reproductive tissues (flower, pollen, pistil, ovaries, stamen, fruit) of the plant. In another embodiment, the microbe is capable of localizing to the root, shoots, leaves and reproductive tissues of the plant. In still another embodiment, the microbe colonizes a fruit or seed tissue of the plant. In still another embodiment, the microbe is able to colonize the plant such that it is present in the surface of the plant (i.e., its presence is detectably present on the plant exterior, or the episphere of the plant). In still other embodiments, the microbe is capable of localizing to substantially all, or all, tissues of the plant. In certain embodiments, the microbe is not localized to the root of a plant. In other cases, the microbe is not localized to the photosynthetic tissues of the plant. In some cases, the microbes are capable of replicating within the plant bioreactor and colonizing it. According to one embodiment, provided is a seed preparation containing seeds having more than 1%, for example more than 3%, more than 5%, more than 10%, more than 20%, more than 30%, for example more than 40%, or more than 50%, of the endophytic microorganisms are In some embodiments, the microbes contained within seeds obtained by the present method can be treated like normal seeds. The microbes remain safely packed inside the seed preventing the exposure of hazards from outside (which usually causes damage to cultures exposed to the environment). Accordingly, the seeds may be stored for considerable time without significant loss of their viability or properties. In one embodiment, the plant seed obtained by the present method containing microorganisms from the plant is stored for at least 1 month, for example at least 3 months, or at least 6 months. Also much longer storage times are, of course, possible for the seeds produced according to the present invention. In another embodiment, the plant seed obtained by the present method containing microorganisms from the plant is stored for at least one month, at least 2 months, at least 3 months, at least 6 months, at least 12 months, for example for at least 2 years, or for at least 3 years. The method according to the present invention is suitable for providing virtually any endophyte-containing seed, because the transfer of the microorganisms from the flower to the seed is a way with low hazard exposure (to plant and endophyte). It is specifically suitable for producing seeds with a microbe which is in principle known to naturally proliferate in plants, especially in the given plant, i.e., a “naturally obtainable endophyte”. These endophytes are derivable from natural sources from the same plant type or from other plant types. According to one embodiment, the endophytic microorganism is therefore a naturally obtainable endophyte. Novel Populations of Seeds Also contemplated herein are populations of seeds. There is emerging evidence suggesting tremendous heterogeneity of the microbiome population within a single plant. For example, Rosenblueth et al. (2012) Acta Hort. (ISHS) 938:39-48 documented seed-to-seed variability in bacterial endophyte populations even when the seeds are taken from the same cob. Further, when large numbers of seeds were analyzed together, Johnston-Monje and Raizada (2011) PLoS ONE 6(6): e20396, found that the observed microbes in Therefore, in another aspect, the invention provides a substantially uniform population of isolated seeds. The uniformity of the microbes within the seed population can be measured in several different ways. In one embodiment, a substantial portion of the population of seeds, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in a population, contains a viable microbe. In another embodiment, a substantial portion of the population of seeds, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in a population contain a threshold number of viable microbe is at least 1 CFU per seed, at least 10 CFU per seed, for example, at least 100 CFU, at least 300 CFU, at least 1,000 CFU, at least 3,000 CFU or more, of the microbe per seed. In some cases, a substantial portion of the population of seeds, for example, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in a population, exhibits at least one of the endophyte community attributes listed in herein (e.g., total CFUs, presence of a novel taxa, absence of a common taxa, altered spatial distribution, intercellular colonization, industrially-useful properties of endophytes, presence of monoclonal strain, presence of conserved subset of microbial plasmid repertoire, microbe isolated from habitat that is distinct from the location of seed production, etc.). In other cases, the genetic sequence of the microbe can be used to measure the genetic similarity of the virus within a population. In one embodiment, a substantial proportion of the seeds, for example, at least 10%, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the seeds contain the same species or strain of microbe, for example, as determined by DNA sequence analysis. In one embodiment, a substantial proportion of the seeds, for example, at least 10%, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the seeds contain the microbe of monoclonal origin, for example, as determined by DNA sequence analysis. Increased uniformity of microbes in plants or seeds can also be detected by measuring the presence of non-genomic nucleic acids present in the microbes. For examples, where the microbe that is inoculated into the plant is known to harbor a plasmid or episome, the presence of the plasmid or episome can be detected in individual plants or seeds by using conventional methods of nucleic acid detection. Therefore, in one embodiment, a substantial portion of the population of seeds, for example at least example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in a population, has a detectable presence of the microbial plasmid or episome. Increased uniformity of the microbes' epigenetic status can also be used to detect increased uniformity. For example, where a microbe that has been inoculated by a plant is also present in the plant (for example, in a different tissue or portion of the plant), or where the introduced microbe is sufficiently similar to a microbe that is present in some of the plants (or portion of the plant, including seeds), it is still possible to distinguish between the inoculated microbe and the native microbe, for example, by distinguishing between the two microbe types on the basis of their epigenetic status. Therefore, in one embodiment, the epigenetic status is detected in microbes across individual seeds or the plants that grow from such seeds. The methods described herein enable the creation of completely new seed/microbe combinations. One of the most significant properties of seeds obtainable by the present invention is the possibility to provide predominant endophyte populations in the seeds. Normally, seeds containing endophytes contain a diverse population of many different endophytic microorganisms with usually more than 10 or even more than 20 different identifiable culturable strains, the method according to the present invention enables, in some cases, the production of seeds with a predominant species of endophytic microorganism. Accordingly, in some embodiments, seed preparations which are provided by the present invention contain seeds having an endophytic microorganism population wherein more than 30%, for example more than 40%, or more than 50%, of the endophytic microorganisms represent the inoculant strain. This means that most (more than 50%, for example more than 60%, or more than 70%) of the seeds in the preparation contain more than 30%, for example more than 40%, or more than 50%, endophytic microorganisms comprising the inoculant strain. In still another embodiment, in a substantial portion of the population of seeds, for example example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds in a population, the microbe represents at least 10%, least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% of the total microbe population in the seed. Uniformity of the seed population can also be measured using other means. The uniformity can be measured, for example, on the basis of the absence or exclusion of a microbe (i.e., a microbe that was not inoculated according to the methods of the invention). As such, in one embodiment, the invention provides a population of seeds in which a substantial portion of the seeds, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds, do not contain a reference microbe, wherein the reference microbe may be an endogenous microbe (i.e., not exogenous to the seed). It is also known that certain viruses are associated with endophytic fungi (such as the Curvularia thermal tolerance virus (CThTV) described in Márquez, L. M., et al., (2007). Science 315: 513-515). Therefore, the presence and quantity of a virus can be used to measure uniformity. For example, where the inoculated microbe is known to be associated with a virus, the presence of that virus can be used as a surrogate indicator of uniformity. Therefore, in one embodiment, a substantial portion of the seeds, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds, contain the virus. In other embodiments, where one or more of the endogenous microbes contain associated viruses which are not found in, and not compatible with the inoculated microbe, the loss (i.e., absence) of the virus can be used to measure uniformity of the seed population. As such, in another embodiment, a substantial portion of the seeds, for example example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds, do not contain the virus. In other cases, the genetic sequence of the virus can be used to measure the genetic similarity of the virus within a population. In one embodiment, a substantial proportion of the seeds, for example, at least 10%, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the seeds contain the same virus, for example, as determined by sequence analysis. In another aspect, the seeds according to the present invention provide a marketable seed product containing a predetermined weight or volume of seeds with a uniform endophyte composition. For example, a marketable seed product containing at least 100 g seeds, for example at least 1 kg seeds, at least 5 kg seeds, at least 10 kg seeds, can be provided by the method according to the present invention that contains—as a whole product—more than 1%, for example more than 5%, more than 10%, more than 20%, more than 30%, more than 40%, especially more than 50%, of a single species of an endophytic microorganism, i.e., the inoculant strain. According to a preferred embodiment, the present invention provides a marketable seed product containing at least 100 g seeds, for example, at least 1 kg seeds, for example at least 5 kg seeds, at least 10 kg seeds, wherein—as a whole product—more than 50%, for example, more than 60%, more than 70% of the microbial population is represented by a single species of an endophytic microorganism, i.e., the inoculant strain. According to another embodiment, the present invention provides a marketable seed product containing at least 100 g seeds, for example at least 1 kg seeds, at least 5 kg seeds, at least 10 kg seeds or more, wherein—as a whole product—more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 75%, more than 80%, more than 90%, or more, of the microbial population is represented by a single species (the microorganism of the inoculant strain) are contained. Such uniformity in microbial composition is unique and is advantageous for high-tech and/or industrial agriculture. It allows significant standardization with respect to qualitative endophyte load of seed products. The term “marketable seed product” means any commercially usable product containing plant seeds in a suitable package (e.g., a box, a bag, an envelope or any other container used for storing, shipping or offering plant seeds for sale). Suitable volumes or weights are those that are currently used for plant seeds (e.g., the at least 100 g, at least 1, 5 or 10 kg; but also 25 or more, 40 or more, 50 kg or more, even 100 kg or more, 500 kg or more, 1 t or more, etc.). Suitable containers or packages are those traditionally used in plant seed commercialization: however, also other containers with more sophisticated storage capabilities (e.g., with microbiologically tight wrappings or with gas- or water-proof containments) can be used. The amount of endophytes (qualitatively and quantitatively) contained in the seeds or in the marketable seed product as a whole can be determined by standard techniques in microbiology readily available to any person skilled in the art of plant endophyte analysis. In some cases, a sub-population of agricultural seeds can be further selected on the basis of increased uniformity, for example, on the basis of uniformity of microbial population. For example, individual seeds of pools collected from individual cobs, individual plants, individual plots (representing plants inoculated on the same day) or individual fields can be tested for uniformity of microbial density, and only those pools meeting specifications (e.g., at least 40%, 50%, 60%, 70%, or 80% of tested seeds have minimum density, as determined by quantitative methods described elsewhere) are combined to provide the agricultural seed sub-population. The methods described herein can also comprise a validating step. The validating step can entail, for example, growing some seeds collected from the inoculated plants into mature agricultural plants, and testing those individual plants for uniformity. Such validating step can be performed on individual seeds collected from cobs, individual plants, individual plots (representing plants inoculated on the same day) or individual fields, and tested as described above to identify pools meeting the required specifications. Microbes Useful for the Methods of the Invention The present invention contemplates the use of different microbes to inoculate a plant. The microbe can be fungal in origin. Alternatively, the microbe can be bacterial in origin. In still other cases, the microbe can be a community of microbes. The methods described herein are also useful for culturing microbes. This is particularly useful where the particular microbe is difficult to culture using traditional growth media. Therefore, in another aspect, disclosed herein are methods for growing a microbe, said method comprising the following steps. A preparation of inoculant microbes that is capable of growing and dividing in a plant is provided. A plant is then contacted with the preparation of microbes to produce an inoculated plant. The microbe-inoculated plant is then placed under conditions that permit the microbe to grow and divide in the inoculated plant. In some cases, the microbe can be transmitted to and remain viable in the seed of the inoculated plant. The seed of the plant can provide an environment that allows the microbe to withstand the stresses of desiccation, temperature variation, and be preserved for extended periods of time. Therefore, in another embodiment, disclosed herein are methods of preserving the viability of a microbe by encapsulation within a seed of a plant, by obtaining the seed comprising the microbe from the plant, wherein the microbe is located inside the seed coat, and wherein the microbe remains viable within the seed. Where the microbe remains viable in the seed, the microbe may also be transmitted and propagated once the seed germinates and develops into a plant. Therefore, in still another embodiment, the microbe can be isolated from the progeny of the inoculated plant. In some cases, the present invention contemplates the use of microbes that do not normally associate with the plants. For purposes of the invention, it is only necessary that the microbe be sufficiently compatible with the plant environment such that it is able to eventually be located on and/or in the seed of the plant. The microbe can also be an organism that normally associates with plants, for example, as an endophyte, an epiphyte, a microbe associated with the surface of a plant or seed (an epispheric microbe), or a rhizospheric microbe, or a soil microbe. In one embodiment, the microbe is associated with the plant rhizosphere. In another embodiment, the microbe is normally associated with the surface of a plant or seed. In yet another embodiment, the microbe is an endophytic microbe. In some cases, plants are inoculated with microbes that are exogenous to the seed of the inoculated plant. In one embodiment, the microbe is derived from a plant of another species. For example, a microbe that is normally found in dicots is applied to a monocot plant (e.g., inoculating corn with a soy bean-derived microbe), or vice versa. In other cases, the microbe to be inoculated onto a plant can be derived from a related species of the plant that is being inoculated. In one embodiment, the microbe can be derived from a related taxon, for example, from a related species. The plant of another species can be an agricultural plant. For example, a microbe derived from In some embodiments, two, three, four, five, six, seven, eight, nine, 10, or more microbes may be co-cultivated by the methods described herein. Suitable microbes for co-cultivation in bioreactor plants include families selected from the group consisting of Actinosynnemataceae, Dermabacteraceae, Geodermatophilaceae, Glycomycetaceae, Intrasporangiaceae, Kineosporiaceae, Microbacteriaceae, Micrococcaceae, Micromonosporaceae, Mycobacteriaceae, Nocardioidaceae, Promicromonosporaceae, Pseudonocardiaceae, Streptomycetaceae, Gaiellaceae, Chitinophagaceae, Cytophagaceae, Cryomorphaceae, Flavobacteriaceae, Sphingobacteriaceae, Parachlamydiaceae, A4b, Bacillaceae, Paenibacillaceae, Planococcaceae, Clostridiaceae, Caldicellulosiruptoraceae, Carboxydocellaceae, Caulobacteraceae, Methylobacteriaceae, Phyllobacteriaceae, Rhizobiaceae, Rhodospirillaceae, Erythrobacteraceae, Sphingomonadaceae, Alcaligenaceae, Burkholderiaceae, Comamonadaceae, Oxalobacteraceae, Methylophilaceae, Alteromonadaceae, Enterobacteriaceae, Coxiellaceae, Pasteurellaceae, Moraxellaceae, Pseudomonadaceae, Xanthomonadaceae, Leptospiraceae, Mycoplasmataceae, auto67_4W, Opitutaceae, and Verrucomicrobiaceae. Suitable microbes for co-cultivation in bioreactor plants further include one or more, two, three, four, five, six, seven, eight, nine, or 10 families selected from the group consisting of Microbacteriaceae, Chitinophagaceae, Bacillaceae, Planococcaceae, Clostridiaceae, Comamonadaceae, Oxalobacteraceae, Enterobacteriaceae, Pseudomonadaceae, and Xanthomonadaceae. Suitable microbes for co-cultivation in bioreactor plants further include one or more, two, three, four, five, six, seven, eight, nine, 10, or more of the generas selected from the group consisting of those genera in Table 1. Suitable microbes for co-cultivation in bioreactor plants further include one or more, two, three, four, five, six, seven, eight, nine, 10, or more of a non- In one embodiment, the microbe is an organism that is normally associated with the plant being inoculated. For example, the microbe can be a microorganism that is normally found in the rhizosphere of plants, on the surface of plants (i.e., an epiphyte), or found inside the plant (i.e., an endophyte). In one embodiment, the microbe is normally associated with the rhizosphere of the plant. In still another embodiment, the microbe is an epiphytic microbe (i.e., is associated with the surface of the plant). In yet another embodiment, the microbe can be an endophyte. Where the microbe is an organism that is normally associated with the plant, the method herein provides means of increasing the uniformity of distribution of the microbe in a population of plants or a portion thereof, including the seeds. For example, the method of inoculation results in seeds derived from inoculated plants, or plants derived from such seeds and progeny thereof, wherein the seed population is substantially uniform with respect to the microbial population across individual seeds derived from inoculated plants, or plants derived from such seeds and progeny thereof. Where the microbe is able to produce a beneficial product, the seed population can also be substantially uniform with respect to the beneficial product across individual seeds derived from inoculated plants, or plants derived from such seeds and progeny thereof. In one embodiment, the isolated microbe is present in the isolated agricultural seed, or any agricultural plant derived therefrom, at a higher level in a specific tissue than the isolated microbe is natively present in the specific tissue in an agricultural seed or any agricultural plant derived therefrom. In another embodiment, the isolated microbe is present in the isolated agricultural seed, or any agricultural plant derived therefrom, at a higher level than any other microbe present in the isolated agricultural seed or any agricultural plant derived therefrom. Substantial uniformity can be measured using any of the means known in the art, or as described herein elsewhere. In one embodiment, the microbe is an endophytic microbe that was isolated from a different plant than the inoculated plant. For example, in one embodiment, the microbe can be an endophyte isolated from a different plant of the same species as the inoculated plant. In some cases, the microbe can be isolated from a species related to the inoculated plant. In another embodiment, the microbe is isolated from a different plant that is a stress-adapted plant. In some such embodiments, the plant is adapted to stresses of bacterial, fungal, insect, or other pathogenic stresses and its associated microbes have the capacity to produce bioactive molecules. In some such embodiments, the plant is adapted to stresses of heat, cold, salt, pH, drought, low nitrogen, low phosphate, flood, or other stresses and its associated microbes comprise the ability to produce stress-reducing molecules of agricultural or industrial importance. In still other embodiments, the microbe can be an endophyte that normally resides in a tissue/organ other than the seed of the plant. For example, the microbe can be one that normally resides in the roots of a plant. Alternatively, the microbe can be one that normally resides in the leaves. In some cases, such localization may be exclusive (i.e., the microbe normally resides exclusively in the leaves of the plant). It is to be understood that, upon inoculation and association with the plant, the microbe confers a detectable change to the plant when compared with a control plant that was not inoculated with the microbe. The detectable changes that can be conferred by the microbe either directly, or indirectly through its interactions with the host plant, are described herein elsewhere. In some embodiments, the microbe useful for the present invention does not include any microbe which can alter the sequence of the host plant's chromosomal DNA, for example, by inserting a foreign nucleic acid. Therefore, in a particular embodiment, the microbe is not from the genus In some embodiments, the microbe useful for the present invention does not include at least one of In some embodiments, the microbe useful for the present invention does not include at least one of Selection of Plant Species from Desired Habitats for Isolation of Microbial Endophytes Different environments can contain significantly different populations of microbes. For example, geographically isolated soils from different parts of the Americas have been shown to differ in 96% of the bacterial species they contain [Fulthorpe, R. R, et al., (2008) International Society for Microbial Ecology Journal. 2(9):901-910]. Soils containing different microbial populations can strongly influence the endophytic bacterial population observed inside In one embodiment, the microbe-associated plant is harvested from a soil type different than the normal soil type that the crop plant is grown on, for example from a gelisol (soils with permafrost within 2 m of the surface), for example from a histosol (organic soil), for example from a spodosol (acid forest soils with a subsurface accumulation of metal-humus complexes), for example from an andisol (soils formed in volcanic ash), for example from a oxisol (intensely weathered soils of tropical and subtropical environments), for example from a vertisol (clayey soils with high shrink/swell capacity), for example from an aridisol (CaCO3-containing soils of arid environments with subsurface horizon development), for example from a ultisol (strongly leached soils with a subsurface zone of clay accumulation and <35% base saturation), for example from a mollisol (grassland soils with high base status), for example from an alfisol (moderately leached soils with a subsurface zone of clay accumulation and >35% base saturation), for example from a inceptisol (soils with weakly developed subsurface horizons), for example from a entisol (soils with little or no morphological development). In a related embodiment, the microbe-associated plant is harvested from a soil type different than the normal soil type that the crop plant is grown on, for example from an acrisol, for example from an albeluvisol, for example from an alisol, for example from an andosol, for example from an anthrosol, for example from an arenosol, for example from a calcisol, for example from a cambisol, for example from a chernozem, for example from a cryosol, for example from a durisol, for example from a ferralsol, for example from a fluvisol, for example from a gleysol, for example from a gypsisol, for example from a histosol, for example from a kastanozem, for example from a leptosol, for example from a lixisol, for example from a luvisol, for example from a nitisol ample from a phaeozem, for example from a planosol, for example from a plinthosol, for example from a podozol, for example from a regosol, for example from a solonchak, for example from a solonetz, for example from an umbrisol, for example from a vertisol. In another embodiment, the microbe-associated plant is harvested from an environment with average rainfall lower than the optimal average rainfall received by the crop plant, for example 2-5% less rainfall than average, for example, at least 5-10% less rainfall, at least 10-15% less rainfall, at least 15-20% less rainfall, at least 20-25% less rainfall, at least 25-30% less rainfall, at least 30-35% less rainfall, at least 35-40% less rainfall, at least 40-45% less rainfall, at least 45-50% less rainfall, at least 50-55% less rainfall, at least 55-60% less rainfall, at least 60-65% less rainfall, at least 65-70% less rainfall, at least 70-75% less rainfall, at least 80-85% less rainfall, at least 85-90% less rainfall, at least 90-95% less rainfall, or less, when compared with crop plants grown under normal conditions during an average growing season. In one embodiment, the microbe-associated plant is harvested from an environment with average rainfall lower than the optimal average rainfall of the crop plant, for example 2-95% less rainfall than average, for example, at least 5-90% less rainfall, at least 10-85% less rainfall, at least 15-80% less rainfall, at least 20-75% less rainfall, at least 25-70% less rainfall, at least 30-65% less rainfall, at least 35-60% less rainfall, at least 40-55% less rainfall, at least 45-50% less rainfall, when compared with crop plants grown under normal conditions during an average growing season. In one embodiment, the microbe-associated plant is harvested from an environment with average rainfall higher than the optimal average rainfall of the crop plant, for example 2-5% more rainfall than average, for example, at least 5-10% more rainfall, at least 10-15% more rainfall, at least 15-20% more rainfall, at least 20-25% more rainfall, at least 25-30% more rainfall, at least 30-35% more rainfall, at least 35-40% more rainfall, at least 40-45% more rainfall, at least 45-50% more rainfall, at least 50-55% more rainfall, at least 55-60% more rainfall, at least 60-65% more rainfall, at least 65-70% more rainfall, at least 70-75% more rainfall, at least 80-85% more rainfall, at least 85-90% more rainfall, at least 90-95% more rainfall, at least 95-100% more rainfall, or even greater than 100% more rainfall, or even greater than 200% more rainfall, or even greater than 300% more rainfall, or even greater than 400% more rainfall, or even greater than 500% more rainfall, when compared with crop plants grown under normal conditions during an average growing season. In one embodiment, the microbe-associated plant is harvested from an environment with average rainfall higher than the optimal average rainfall of the crop plant, 2-500% more rainfall than average, 2-400% more rainfall than average, 2-300% more rainfall than average, 2-200% more rainfall than average, 2-95% more rainfall than average, for example, at least 5-90% more rainfall, at least 10-85% more rainfall, at least 15-80% more rainfall, at least 20-75% more rainfall, at least 25-70% more rainfall, at least 30-65% more rainfall, at least 35-60% more rainfall, at least 40-55% more rainfall, at least 45-50% more rainfall, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a soil type with different soil moisture classification than the normal soil type that the recipient crop plant is grown on, for example from an aquic soil (soil is saturated with water and virtually free of gaseous oxygen for sufficient periods of time, such that there is evidence of poor aeration), for example from an udic soil (soil moisture is sufficiently high year-round in most years to meet plant requirement), for example from an ustic soil (soil moisture is intermediate between udic and aridic regimes; generally, plant-available moisture during the growing season, but severe periods of drought may occur), for example from an aridic soil (soil is dry for at least half of the growing season and moist for less than 90 consecutive days), for example from a xeric soil (soil moisture regime is found in Mediterranean-type climates, with cool, moist winters and warm, dry summers). In another embodiment, the microbe-associated plant is harvested from an environment with average rainfall lower than the optimal average rainfall received by the crop plant, for example 2-5% less rainfall than average, for example, at least 5-10% less rainfall, at least 10-15% less rainfall, at least 15-20% less rainfall, at least 20-25% less rainfall, at least 25-30% less rainfall, at least 30-35% less rainfall, at least 35-40% less rainfall, at least 40-45% less rainfall, at least 45-50% less rainfall, at least 50-55% less rainfall, at least 55-60% less rainfall, at least 60-65% less rainfall, at least 65-70% less rainfall, at least 70-75% less rainfall, at least 80-85% less rainfall, at least 85-90% less rainfall, at least 90-95% less rainfall, or less, when compared with crop plants grown under normal conditions during an average growing season. In one embodiment, the microbe-associated plant is harvested from an environment with average rainfall lower than the optimal average rainfall of the crop plant, for example 2-95% less rainfall than average, for example, at least 5-90% less rainfall, at least 10-85% less rainfall, at least 15-80% less rainfall, at least 20-75% less rainfall, at least 25-70% less rainfall, at least 30-65% less rainfall, at least 35-60% less rainfall, at least 40-55% less rainfall, at least 45-50% less rainfall, when compared with crop plants grown under normal conditions during an average growing season. In one embodiment, the microbe-associated plant is harvested from an environment with average rainfall higher than the optimal average rainfall of the crop plant, for example 2-5% more rainfall than average, for example, at least 5-10% more rainfall, at least 10-15% more rainfall, at least 15-20% more rainfall, at least 20-25% more rainfall, at least 25-30% more rainfall, at least 30-35% more rainfall, at least 35-40% more rainfall, at least 40-45% more rainfall, at least 45-50% more rainfall, at least 50-55% more rainfall, at least 55-60% more rainfall, at least 60-65% more rainfall, at least 65-70% more rainfall, at least 70-75% more rainfall, at least 80-85% more rainfall, at least 85-90% more rainfall, at least 90-95% more rainfall, at least 95-100% more rainfall, or even greater than 100% more rainfall, or even greater than 200% more rainfall, or even greater than 300% more rainfall, or even greater than 400% more rainfall, or even greater than 500% more rainfall, when compared with crop plants grown under normal conditions during an average growing season. In one embodiment, the microbe-associated plant is harvested from an environment with average rainfall higher than the optimal average rainfall of the crop plant, 2-500% more rainfall than average, 2-400% more rainfall than average, 2-300% more rainfall than average, 2-200% more rainfall than average, 2-95% more rainfall than average, for example, at least 5-90% more rainfall, at least 10-85% more rainfall, at least 15-80% more rainfall, at least 20-75% more rainfall, at least 25-70% more rainfall, at least 30-65% more rainfall, at least 35-60% more rainfall, at least 40-55% more rainfall, at least 45-50% more rainfall, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a soil with an average pH range that is different from the optimal soil pH range of the crop plant, for example the plant may be harvested from an ultra acidic soil (<3.5), from an extreme acid soil (3.5-4.4), from a very strong acid soil (4.5-5.0), from a strong acid soil (5.1-5.5), from a moderate acid soil (5.6-6.0), from an slight acid soil (6.1-6.5), from an neutral soil (6.6-7.3), from an slightly alkaline soil (7.4-7.8), from an moderately alkaline soil (7.9-8.4), from a strongly alkaline soil (8.5-9.0), or from an very strongly alkaline soil (>9.0). In another embodiment, the microbe-associated plant is harvested from an ecosystem where the agricultural plant is not normally found, for example a tundra ecosystem as opposed to a temperate agricultural farm, for example from tropical and subtropical moist broadleaf forests (tropical and subtropical, humid), for example from tropical and subtropical dry broadleaf forests (tropical and subtropical, semihumid), for example from tropical and subtropical coniferous forests (tropical and subtropical, semihumid), for example from temperate broadleaf and mixed forests (temperate, humid), for example from temperate coniferous forests (temperate, humid to semihumid), from for example from boreal forests/taiga (subarctic, humid), for example from tropical and subtropical grasslands, savannas, and shrublands (tropical and subtropical, semiarid), for example from temperate grasslands, savannas, and shrublands (temperate, semiarid), for example from flooded grasslands and savannas (temperate to tropical, fresh or brackish water inundated), for example from montane grasslands and shrublands (alpine or montane climate), for example from mediterranean forests, woodlands, and scrub or sclerophyll forests (temperate warm, semihumid to semiarid with winter rainfall), for example from mangrove forests, and for example from deserts and xeric shrublands (temperate to tropical, arid). In another embodiment, the microbe-associated plant is harvested from an agricultural environment with a crop yield lower than the average crop yield expected from the crop plant grown under average cultivation practices on normal agricultural land, for example 2-5% lower yield than average, for example, at least 5-10% lower yield, at least 10-15% lower yield, at least 15-20% lower yield, at least 20-25% lower yield, at least 25-30% lower yield, at least 30-35% lower yield, at least 35-40% lower yield, at least 40-45% lower yield, at least 45-50% lower yield, at least 50-55% lower yield, at least 55-60% lower yield, at least 60-65% lower yield, at least 65-70% lower yield, at least 70-75% lower yield, at least 80-85% lower yield, at least 85-90% lower yield, at least 90-95% lower yield, or less, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from an agricultural environment with a crop yield lower than the average crop yield expected from the crop plant grown under average cultivation practices on normal agricultural land, for example 2-95% lower yield than average, for example, at least 5-90% lower yield, at least 10-85% lower yield, at least 15-80% lower yield, at least 20-75% lower yield, at least 25-70% lower yield, at least 30-65% lower yield, at least 35-60% lower yield, at least 40-55% lower yield, at least 45-50% lower yield, when compared with crop plants grown under normal conditions during an average growing season. In one embodiment, the microbe-associated plant is harvested from an environment with average crop yield higher than the optimal average crop yield of the crop plant, for example 2-5% more yield than average, for example, at least 5-10% more yield, at least 10-15% more yield, at least 15-20% more yield, at least 20-25% more yield, at least 25-30% more yield, at least 30-35% more yield, at least 35-40% more yield, at least 40-45% more yield, at least 45-50% more yield, at least 50-55% more yield, at least 55-60% more yield, at least 60-65% more yield, at least 65-70% more yield, at least 70-75% more yield, at least 80-85% more yield, at least 85-90% more yield, at least 90-95% more yield, at least 95-100% more yield, or even greater than 100% more yield, or even greater than 200% more yield, or even greater than 300% more yield, or even greater than 400% more yield, or even greater than 500% more yield, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from an environment with average crop yield higher than the optimal average crop yield of the crop plant, 2-500% more yield than average, 2-400% more yield than average, 2-300% more yield than average, 2-200% more yield than average, 2-95% more yield than average, for example, at least 5-90% more yield, at least 10-85% more yield, at least 15-80% more yield, at least 20-75% more yield, at least 25-70% more yield, at least 30-65% more yield, at least 35-60% more yield, at least 40-55% more yield, at least 45-50% more yield, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total nitrogen than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less nitrogen than average, for example, at least 5-10% less nitrogen, at least 10-15% less nitrogen, at least 15-20% less nitrogen, at least 20-25% less nitrogen, at least 25-30% less nitrogen, at least 30-35% less nitrogen, at least 35-40% less nitrogen, at least 40-45% less nitrogen, at least 45-50% less nitrogen, at least 50-55% less nitrogen, at least 55-60% less nitrogen, at least 60-65% less nitrogen, at least 65-70% less nitrogen, at least 70-75% less nitrogen, at least 80-85% less nitrogen, at least 85-90% less nitrogen, at least 90-95% less nitrogen, or less, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total nitrogen than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-95% less nitrogen than average, for example, at least 5-90% less nitrogen, at least 10-85% less nitrogen, at least 15-80% less nitrogen, at least 20-75% less nitrogen, at least 25-70% less nitrogen, at least 30-65% less nitrogen, at least 35-60% less nitrogen, at least 40-55% less nitrogen, at least 45-50% less nitrogen, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total nitrogen than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more nitrogen than average, for example, at least 5-10% more nitrogen, at least 10-15% more nitrogen, at least 15-20% more nitrogen, at least 20-25% more nitrogen, at least 25-30% more nitrogen, at least 30-35% more nitrogen, at least 35-40% more nitrogen, at least 40-45% more nitrogen, at least 45-50% more nitrogen, at least 50-55% more nitrogen, at least 55-60% more nitrogen, at least 60-65% more nitrogen, at least 65-70% more nitrogen, at least 70-75% more nitrogen, at least 80-85% more nitrogen, at least 85-90% more nitrogen, at least 90-95% more nitrogen, at least 95-100% more nitrogen, or even greater than 100% more nitrogen, or even greater than 200% more nitrogen, or even greater than 300% more nitrogen, or even greater than 400% more nitrogen, or even greater than 500% more nitrogen, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total nitrogen than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, 2-500% more nitrogen than average, 2-400% more nitrogen than average, 2-300% more nitrogen than average, 2-200% more nitrogen than average, 2-95% more nitrogen than average, for example, at least 5-90% more nitrogen, at least 10-85% more nitrogen, at least 15-80% more nitrogen, at least 20-75% more nitrogen, at least 25-70% more nitrogen, at least 30-65% more nitrogen, at least 35-60% more nitrogen, at least 40-55% more nitrogen, at least 45-50% more nitrogen, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total phosphorus than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less phosphorus than average, for example, at least 5-10% less phosphorus, at least 10-15% less phosphorus, at least 15-20% less phosphorus, at least 20-25% less phosphorus, at least 25-30% less phosphorus, at least 30-35% less phosphorus, at least 35-40% less phosphorus, at least 40-45% less phosphorus, at least 45-50% less phosphorus, at least 50-55% less phosphorus, at least 55-60% less phosphorus, at least 60-65% less phosphorus, at least 65-70% less phosphorus, at least 70-75% less phosphorus, at least 80-85% less phosphorus, at least 85-90% less phosphorus, at least 90-95% less phosphorus, or less, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total phosphorus than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-95% less phosphorus than average, for example, at least 5-90% less phosphorus, at least 10-85% less phosphorus, at least 15-80% less phosphorus, at least 20-75% less phosphorus, at least 25-70% less phosphorus, at least 30-65% less phosphorus, at least 35-60% less phosphorus, at least 40-55% less phosphorus, at least 45-50% less phosphorus, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total phosphorus than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more phosphorus than average, for example, at least 5-10% more phosphorus, at least 10-15% more phosphorus, at least 15-20% more phosphorus, at least 20-25% more phosphorus, at least 25-30% more phosphorus, at least 30-35% more phosphorus, at least 35-40% more phosphorus, at least 40-45% more phosphorus, at least 45-50% more phosphorus, at least 50-55% more phosphorus, at least 55-60% more phosphorus, at least 60-65% more phosphorus, at least 65-70% more phosphorus, at least 70-75% more phosphorus, at least 80-85% more phosphorus, at least 85-90% more phosphorus, at least 90-95% more phosphorus, at least 95-100% more phosphorus, or even greater than 100% more phosphorus, or even greater than 200% more phosphorus, or even greater than 300% more phosphorus, or even greater than 400% more phosphorus, or even greater than 500% more phosphorus, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total phosphorus than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, 2-500% more phosphorus than average, 2-400% more phosphorus than average, 2-300% more phosphorus than average, 2-200% more phosphorus than average, 2-95% more phosphorus than average, for example, at least 5-90% more phosphorus, at least 10-85% more phosphorus, at least 15-80% more phosphorus, at least 20-75% more phosphorus, at least 25-70% more phosphorus, at least 30-65% more phosphorus, at least 35-60% more phosphorus, at least 40-55% more phosphorus, at least 45-50% more phosphorus, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total potassium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less potassium than average, for example, at least 5-10% less potassium, at least 10-15% less potassium, at least 15-20% less potassium, at least 20-25% less potassium, at least 25-30% less potassium, at least 30-35% less potassium, at least 35-40% less potassium, at least 40-45% less potassium, at least 45-50% less potassium, at least 50-55% less potassium, at least 55-60% less potassium, at least 60-65% less potassium, at least 65-70% less potassium, at least 70-75% less potassium, at least 80-85% less potassium, at least 85-90% less potassium, at least 90-95% less potassium, or less, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total potassium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-95% less potassium than average, for example, at least 5-90% less potassium, at least 10-85% less potassium, at least 15-80% less potassium, at least 20-75% less potassium, at least 25-70% less potassium, at least 30-65% less potassium, at least 35-60% less potassium, at least 40-55% less potassium, at least 45-50% less potassium, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total potassium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more potassium than average, for example, at least 5-10% more potassium, at least 10-15% more potassium, at least 15-20% more potassium, at least 20-25% more potassium, at least 25-30% more potassium, at least 30-35% more potassium, at least 35-40% more potassium, at least 40-45% more potassium, at least 45-50% more potassium, at least 50-55% more potassium, at least 55-60% more potassium, at least 60-65% more potassium, at least 65-70% more potassium, at least 70-75% more potassium, at least 80-85% more potassium, at least 85-90% more potassium, at least 90-95% more potassium, at least 95-100% more potassium, or even greater than 100% more potassium, or even greater than 200% more potassium, or even greater than 300% more potassium, or even greater than 400% more potassium, or even greater than 500% more potassium, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total potassium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, 2-500% more potassium than average, 2-400% more potassium than average, 2-300% more potassium than average, 2-200% more potassium than average, 2-95% more potassium than average, for example, at least 5-90% more potassium, at least 10-85% more potassium, at least 15-80% more potassium, at least 20-75% more potassium, at least 25-70% more potassium, at least 30-65% more potassium, at least 35-60% more potassium, at least 40-55% more potassium, at least 45-50% more potassium, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total sulfur than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less sulfur than average, for example, at least 5-10% less sulfur, at least 10-15% less sulfur, at least 15-20% less sulfur, at least 20-25% less sulfur, at least 25-30% less sulfur, at least 30-35% less sulfur, at least 35-40% less sulfur, at least 40-45% less sulfur, at least 45-50% less sulfur, at least 50-55% less sulfur, at least 55-60% less sulfur, at least 60-65% less sulfur, at least 65-70% less sulfur, at least 70-75% less sulfur, at least 80-85% less sulfur, at least 85-90% less sulfur, at least 90-95% less sulfur, or less, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total sulfur than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-95% less sulfur than average, for example, at least 5-90% less sulfur, at least 10-85% less sulfur, at least 15-80% less sulfur, at least 20-75% less sulfur, at least 25-70% less sulfur, at least 30-65% less sulfur, at least 35-60% less sulfur, at least 40-55% less sulfur, at least 45-50% less sulfur, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total sulfur than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more sulfur than average, for example, at least 5-10% more sulfur, at least 10-15% more sulfur, at least 15-20% more sulfur, at least 20-25% more sulfur, at least 25-30% more sulfur, at least 30-35% more sulfur, at least 35-40% more sulfur, at least 40-45% more sulfur, at least 45-50% more sulfur, at least 50-55% more sulfur, at least 55-60% more sulfur, at least 60-65% more sulfur, at least 65-70% more sulfur, at least 70-75% more sulfur, at least 80-85% more sulfur, at least 85-90% more sulfur, at least 90-95% more sulfur, at least 95-100% more sulfur, or even greater than 100% more sulfur, or even greater than 200% more sulfur, or even greater than 300% more sulfur, or even greater than 400% more sulfur, or even greater than 500% more sulfur, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total sulfur than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, 2-500% more sulfur than average, 2-400% more sulfur than average, 2-300% more sulfur than average, 2-200% more sulfur than average, 2-95% more sulfur than average, for example, at least 5-90% more sulfur, at least 10-85% more sulfur, at least 15-80% more sulfur, at least 20-75% more sulfur, at least 25-70% more sulfur, at least 30-65% more sulfur, at least 35-60% more sulfur, at least 40-55% more sulfur, at least 45-50% more sulfur, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total calcium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less calcium than average, for example, at least 5-10% less calcium, at least 10-15% less calcium, at least 15-20% less calcium, at least 20-25% less calcium, at least 25-30% less calcium, at least 30-35% less calcium, at least 35-40% less calcium, at least 40-45% less calcium, at least 45-50% less calcium, at least 50-55% less calcium, at least 55-60% less calcium, at least 60-65% less calcium, at least 65-70% less calcium, at least 70-75% less calcium, at least 80-85% less calcium, at least 85-90% less calcium, at least 90-95% less calcium, or less, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total calcium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-95% less calcium than average, for example, at least 5-90% less calcium, at least 10-85% less calcium, at least 15-80% less calcium, at least 20-75% less calcium, at least 25-70% less calcium, at least 30-65% less calcium, at least 35-60% less calcium, at least 40-55% less calcium, at least 45-50% less calcium, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total calcium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more calcium than average, for example, at least 5-10% more calcium, at least 10-15% more calcium, at least 15-20% more calcium, at least 20-25% more calcium, at least 25-30% more calcium, at least 30-35% more calcium, at least 35-40% more calcium, at least 40-45% more calcium, at least 45-50% more calcium, at least 50-55% more calcium, at least 55-60% more calcium, at least 60-65% more calcium, at least 65-70% more calcium, at least 70-75% more calcium, at least 80-85% more calcium, at least 85-90% more calcium, at least 90-95% more calcium, at least 95-100% more calcium, or even greater than 100% more calcium, or even greater than 200% more calcium, or even greater than 300% more calcium, or even greater than 400% more calcium, or even greater than 500% more calcium, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total calcium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, 2-500% more calcium than average, 2-400% more calcium than average, 2-300% more calcium than average, 2-200% more calcium than average, 2-95% more calcium than average, for example, at least 5-90% more calcium, at least 10-85% more calcium, at least 15-80% more calcium, at least 20-75% more calcium, at least 25-70% more calcium, at least 30-65% more calcium, at least 35-60% more calcium, at least 40-55% more calcium, at least 45-50% more calcium, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total magnesium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% less magnesium than average, for example, at least 5-10% less magnesium, at least 10-15% less magnesium, at least 15-20% less magnesium, at least 20-25% less magnesium, at least 25-30% less magnesium, at least 30-35% less magnesium, at least 35-40% less magnesium, at least 40-45% less magnesium, at least 45-50% less magnesium, at least 50-55% less magnesium, at least 55-60% less magnesium, at least 60-65% less magnesium, at least 65-70% less magnesium, at least 70-75% less magnesium, at least 80-85% less magnesium, at least 85-90% less magnesium, at least 90-95% less magnesium, or less, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains lower total magnesium than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-95% less magnesium than average, for example, at least 5-90% less magnesium, at least 10-85% less magnesium, at least 15-80% less magnesium, at least 20-75% less magnesium, at least 25-70% less magnesium, at least 30-65% less magnesium, at least 35-60% less magnesium, at least 40-55% less magnesium, at least 45-50% less magnesium, when compared with crop plants grown under normal conditions during an average growing season. In another embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total sodium chloride (salt) than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, for example 2-5% more salt than average, for example, at least 5-10% more salt, at least 10-15% more salt, at least 15-20% more salt, at least 20-25% more salt, at least 25-30% more salt, at least 30-35% more salt, at least 35-40% more salt, at least 40-45% more salt, at least 45-50% more salt, at least 50-55% more salt, at least 55-60% more salt, at least 60-65% more salt, at least 65-70% more salt, at least 70-75% more salt, at least 80-85% more salt, at least 85-90% more salt, at least 90-95% more salt, at least 95-100% more salt, or even greater than 100% more salt, or even greater than 200% more salt, or even greater than 300% more salt, or even greater than 400% more salt, or even greater than 500% more salt, when compared with crop plants grown under normal conditions during an average growing season. In a related embodiment, the microbe-associated plant is harvested from a environment where soil contains higher total sodium chloride (salt) than the optimum levels recommended in order to achieve average crop yields for a plant grown under average cultivation practices on normal agricultural land, 2-500% more salt than average, 2-400% more salt than average, 2-300% more salt than average, 2-200% more salt than average, 2-95% more salt than average, for example, at least 5-90% more salt, at least 10-85% more salt, at least 15-80% more salt, at least 20-75% more salt, at least 25-70% more salt, at least 30-65% more salt, at least 35-60% more salt, at least 40-55% more salt, at least 45-50% more salt, when compared with crop plants grown under normal conditions during an average growing season. Bacterial Microbes In one embodiment, the microbe can be a bacterium. The bacterium can be any bacterium, so long as the bacterium can remain viably incorporated on and/or in the seed. In some cases, it can be a gram-positive bacterium. In other cases, it can be a gram-negative bacterium. The bacterium can be any bacterium selected from the genera listed in Table 1. In some embodiments, the bacterium can be any bacterium selected from the genera listed in Table A. According to one particular embodiment, the microorganism is an endophytic bacterium, selected from In another embodiment, the bacterium can be a bacterium that is associated with a plant, for example a bacterium that is normally an endophyte, an epiphyte, or a rhizospheric bacterium. In one embodiment, the bacterium is an endophytic bacterium. In another embodiment, the bacterium is an endophytic bacterium selected from the bacteria listed in Table B and Table C. Endophytic bacteria also include those bacteria having a 16S nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-160. In another embodiment, the bacterium is not an endophyte, for example, not among the bacteria listed in Table B and Table C, and not a bacterium having a 16S nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-160. Fungal Microbes In another embodiment, the microbe can be a fungus. According to some embodiments, the endophytic microorganism is an endophytic fungus selected from In another embodiment, the fungus can be a fungus that is associated with a plant, for example a fungus that is normally an endophyte, an epiphyte, or a rhizospheric fungus. In one embodiment, the fungus is selected from the endophytic fungi listed in Table E. In still another embodiment, the fungus is not an endophyte, for example, not among the fungi listed in Table E. It is also possible to use the present method for providing seeds with artificially created or optimized microorganisms, e.g., recombinantly engineered bacteria or fungi; or strains which have been optimized by various culture techniques and/or selection rounds. Another embodiment of the present invention is therefore to use a recombinantly produced (i.e., genetically engineered) microorganism. Preparation of Microbes and Formulations It is recommendable to safeguard conditions which are favourable to the microorganisms used. The microorganisms are usually applied in suspension at a suitable concentration. The preparation of microbes can be an aqueous solution, an oil-in-water emulsion or water-in-oil emulsion containing a minimum concentration of a microbe. Microbes may be present as live cells, viable cells, spores, or mycelia. Typically, the concentration is at least 104CFU/ml, for example at least 3×104CFU/mL, at least 105CFU/mL, at least 3×105CFU/mL, at least 106CFU/mL, at least 3×106CFU/mL, at least 107, at least 3×107CFU/mL, at least 108CFU/mL, 109CFU/mL or more. In one embodiment, the preparation is a solution containing a microbe at a concentration between about 105CFU/mL and about 109CFU/mL. In another embodiment, the preparation contains a microbe at a concentration between about 106CFU/mL and about 108CFU/mL. The synthetic preparation can also contain any number of other components. In one embodiment, the synthetic preparation may contain growth media or constituents required for the growth and propagation of the microbe. Examples of growth media that can be employed include those listed, for example, in: Hurst, Christon J., et al. Manual of environmental microbiology. No. Ed. 3. ASM press, 2007; DIFCO laboratories (Detroit, Mich.). Difco™ & BBL™ Manual: Manual of Microbiological Culture Media, 2nd Ed. Difco laboratories, 2009; Jones, Kenneth L. Journal of bacteriology 57.2 (1949): 141; Liu, Dong, et al. Proceedings of the National Academy of Sciences 91.5 (1994): 1888-1892; and Atlas, Ronald M. Handbook of microbiological media. Vol. 1. CRC press, 2004, each of which is incorporated by reference in its entirety. In one embodiment, the growth medium is selected from the group provided in Table F. The synthetic preparation can be of a defined pH range. In one embodiment, the pH of the preparation can be between pH 5.5-6.0, pH 5.75-6.25, pH 6.0-6.5, pH 6.25-6.75, pH 6.5-7.0, pH 6.75-7.25, and pH 7.0-7.5. The pH of the medium can be adjusted using any biologically compatible buffering agent. The synthetic preparation described herein can be formulated using an agriculturally compatible carrier. The formulation useful for these embodiments generally typically include at least one member selected from the group consisting of a tackifier, a microbial stabilizer, a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, a dessicant, and a nutrient. In some cases, the synthetic preparation is mixed with an agriculturally compatible carrier. The synthetic preparation can also comprise a carrier, such as diatomaceous earth, clay, or chitin, which act to complex with chemical agents, such as control agents. The carrier can be a solid carrier or liquid carrier, and in various forms including microsphres, powders, emulsions and the like. The carrier may be any one or more of a number of carriers that confer a variety of properties, such as increased stability, wettability, or dispersability. Wetting agents such as natural or synthetic surfactants, which can be nonionic or ionic surfactants, or a combination thereof can be included in a composition of the invention. Water-in-oil emulsions can also be used to formulate a composition that includes the purified bacterial population (see, for example, U.S. Pat. No. 7,485,451, which is incorporated herein by reference in its entirety). Suitable formulations that may be prepared include wettable powders, granules, gels, agar strips or pellets, thickeners, and the like, microencapsulated particles, and the like, liquids such as aqueous flowables, aqueous suspensions, water-in-oil emulsions, etc. The formulation may include grain or legume products, for example, ground grain or beans, broth or flour derived from grain or beans, starch, sugar, or oil. In some embodiments, the agricultural carrier may be soil or a plant growth medium. Other agricultural carriers that may be used include water, fertilizers, plant-based oils, humectants, or combinations thereof. Alternatively, the agricultural carrier may be a solid, such as diatomaceous earth, loam, silica, alginate, clay, bentonite, vermiculite, seed cases, other plant and animal products, or combinations, including granules, pellets, or suspensions. Mixtures of any of the aforementioned ingredients are also contemplated as carriers, such as but not limited to, pesta (flour and kaolin clay), agar or flour-based pellets in loam, sand, or clay, etc. Formulations may include food sources for the cultured organisms, such as barley, rice, or other biological materials such as seed, plant parts, sugar cane bagasse, hulls or stalks from grain processing, ground plant material or wood from building site refuse, sawdust or small fibers from recycling of paper, fabric, or wood. Other suitable formulations will be known to those skilled in the art. The synthetic preparation can also comprise an adherent. Such agents are useful for combining the microbes of the invention with carriers that can contain other compounds (e.g., control agents that are not biologic), to yield a coating composition. Such compositions help create coatings around the plant or seed to maintain contact between the microbe and other agents with the plant or plant part. In one embodiment, adherents are selected from the group consisting of: alginate, gums, starches, lecithins, formononetin, polyvinyl alcohol, alkali formononetinate, hesperetin, polyvinyl acetate, cephalins, Gum Arabic, Xantham Gum, Mineral Oil, Polyethylene Glycol (PEG), Polyvinyl pyrrolidone (PVP), Arabino-galactan, Methyl Cellulose, PEG 400, Chitosan, Polyacrylamide, Polyacrylate, Polyacrylonitrile, Glycerol, Triethylene glycol, Vinyl Acetate, Gellan Gum, Polystyrene, Polyvinyl, Carboxymethyl cellulose, Gum Ghatti, and polyoxyethylene-polyoxybutylene block copolymers. Other examples of adherent compositions that can be used in the synthetic preparation include those described in EP 0818135, CA 1229497, WO 2013090628, EP 0192342, WO 2008103422 and CA 1041788, each of which is incorporated by referefence in its entirety. The synthetic preparation can also contain one or more reagents that promote internalization of the microbe into the plant, and can include any one of the following classes of compounds: a surfactant, an abrasive, an agent promoting stomatal opening, an osmoticum, and a plant signaling molecule. The preparation can also contain a surfactant. Non-limiting examples of surfactants include nitrogen-surfactant blends such as Prefer 28 (Cenex), Surf-N(US), Inhance (Brandt), P-28 (Wilfarm) and Patrol (Helena); esterified seed oils include Sun-It II (AmCy), MSO (UAP), Scoil (Agsco), Hasten (Wilfarm) and Mes-100 (Drexel); and organo-silicone surfactants include Silwet L77 (UAP), Silikin (Terra), Dyne-Amic (Helena), Kinetic (Helena), Sylgard 309 (Wilbur-Ellis) and Century (Precision). In one embodiment, the surfactant is present at a concentration of between 0.01% v/v to 10% v/v. In another embodiment, the surfactant is present at a concentration of between 0.1% v/v to 1% v/v. In certain cases, the formulation includes a microbial stabilizer. Such an agent can include a desiccant. As used herein, a “desiccant” can include any compound or mixture of compounds that can be classified as a desiccant regardless of whether the compound or compounds are used in such concentrations that they in fact have a desiccating effect on the liquid inoculant. Examples of suitable desiccants include one or more of trehalose, sucrose, glycerol, and Methylene glycol. Other suitable desiccants include, but are not limited to, non reducing sugars and sugar alcohols (e.g., mannitol or sorbitol). The amount of desiccant introduced into the formulation can range from about 5% to about 50% by weight/volume, for example, between about 10% to about 40%, between about 15% and about 35%, or between about 20% and about 30%. The synthetic preparation of a defined osmolality can also be used. In one embodiment, the synthetic preparation has an osmolality of less than about 100 mOsm, for example less than about 75 mOsm, less than about 50 mOsm, or less than about 25 mOsm. In another embodiment, the synthetic preparation has an osmolality of at least 250 mOsm, for example at least 300 mOsm, at least 400 mOsm, at least 500 mOsm, at least 600 mOsm, at least 700 mOsm, at least 800 mOsm, 900 mOsm or greater. The osmolality of the preparation can be adjusted by addition of an osmoticum: the osmoticum can be any commonly used osmoticum, and can selected from the group consisting of: mannitol, sorbitol, NaCl, KCl, CaCl2, MgSO4, sucrose, or any combination thereof. In some cases, it is advantageous for the formulation to contain agents such as a fungicide, an antibacterial agent, an herbicide, a nematicide, an insecticide, a plant growth regulator, a rodenticide, or a nutrient. Also contemplated herein is the use of an agent and/or condition that promotes stomatal opening, in order to facilitate entry of the microbe into the plant. Agents and conditions known to induce stomatal opening include light, particularly blue light and red light (Reviewed in, for example, Schroeder et al., Annu Rev. Plant Physiol. Plant Mol. Biol. 2001. 52:627-58). In addition, compounds which promote stomatal opening, or inhibit stomatal closing, such as Cyclosporin A, linolenic acid, arachidonic acid, coronatine and cytochalasin D. In the liquid form, for example, solutions or suspensions, the microbes can be mixed or suspended in water or in aqueous solutions. Suitable liquid diluents or carriers include water, aqueous solutions, petroleum distillates, or other liquid carriers. Solid compositions can be prepared by dispersing the microbes in and on an appropriately divided solid carrier, such as peat, wheat, bran, vermiculite, clay, talc, bentonite, diatomaceous earth, fuller's earth, pasteurized soil, and the like. When such formulations are used as wettable powders, biologically compatible dispersing agents such as non-ionic, anionic, amphoteric, or cationic dispersing and emulsifying agents can be used. The solid carriers used upon formulation include, for example, mineral carriers such as kaolin clay, pyrophyllite, bentonite, montmorillonite, diatomaceous earth, acid white soil, vermiculite, and pearlite, and inorganic salts such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, ammonium chloride, and calcium carbonate. Also, organic fine powders such as wheat flour, wheat bran, and rice bran may be used. The liquid carriers include vegetable oils such as soybean oil and cottonseed oil, glycerol, ethylene glycol, polyethylene glycol, propylene glycol, polypropylene glycol, etc. The microbe can be obtained from growth in culture, for example, using synthetic growth medium. In addition, the microbe can becultured on solid media, for example on petri dishes, scraped off and suspended into the preparation. Microbes at different growth phases can be used. For example, microbes at lag phase, early-log phase, mid-log phase, late-log phase, stationary phase, early death phase, or death phase can be used. For certain microbes that exist as mycelia or mycelia-like structures, pre-treatment of the microbes with enzymes (including, but not limited to, driselase, gluculase, cellulase, beta-glucanase, lysozyme, zymolyase) can be used to generate protoplasts in order to provide a suspension of microbes. After generation of protoplasts, the microbes can be allowed to partially regenerate the cell walls by leaving the protoplasts in a growth medium or solution with relatively high osmolarity for a short time (typically less than about 12 hours at room temperature) to prevent bursting of protoplasts. In certain embodiments, a composition described herein may be in the form of a liquid, a slurry, a solid, or a powder (wettable powder or dry powder). In another embodiment, a composition may be in the form of a seed coating. Compositions in liquid, slurry, or powder (e.g., wettable powder) form may be suitable for coating seeds. When used to coat seeds, the composition may be applied to the seeds and allowed to dry. In embodiments wherein the composition is a powder (e.g., a wettable powder), a liquid, such as water, may need to be added to the powder before application to a seed. In still another embodiment, the methods can include introducing into the soil an inoculum of one or more of the microbes described herein. Such methods can include introducing into the soil one or more of the compositions described herein. The inoculum(s) or compositions may be introduced into the soil according to methods known to those skilled in the art. Non-limiting examples include in-furrow introduction, spraying, coating seeds, foliar introduction, etc. In a particular embodiment, the introducing step comprises in-furrow introduction of the inoculum or compositions described herein. In one embodiment, seeds may be treated with composition(s) described herein in several ways but preferably via spraying or dripping. Spray and drip treatment may be conducted by formulating compositions described herein and spraying or dripping the composition(s) onto a seed(s) via a continuous treating system (which is calibrated to apply treatment at a predefined rate in proportion to the continuous flow of seed), such as a drum-type of treater. Batch systems, in which a predetermined batch size of seed and composition(s) as described herein are delivered into a mixer, may also be employed. Systems and apparati for performing these processes are commercially available from numerous suppliers, e.g., Bayer CropScience (Gustafson). In another embodiment, the treatment entails coating seeds. One such process involves coating the inside wall of a round container with the composition(s) described herein, adding seeds, then rotating the container to cause the seeds to contact the wall and the composition(s), a process known in the art as “container coating”. Seeds can be coated by combinations of coating methods. Soaking typically entails using liquid forms of the compositions described. For example, seeds can be soaked for about 1 minute to about 24 hours (e.g., for at least 1 min, 5 min, 10 min, 20 min, 40 min, 80 min, 3 hr, 6 hr, 12 hr, 24 hr). Contacting the Plant with the Preparation of Microbes In general terms, provided herein are methods of producing an agricultural seed that contains a novel population of microbes. The seed generated according to the present invention contains the microbe on and/or in the seed, and is generated by the following steps. First, a preparation of an isolated microbe, which is exogenous to the seed of the plant, is provided. The microbial preparation is then contacted with the plant. The plants are then provided with conditions such that the plant generates an agricultural seed, and the agricultural seed, which contain the microbes on and/or in the seed, are collected. The microbes contained within the seed are viably incorporated on and/or in the seed. The microorganisms are e.g., sprayed on the parent flowering plants, enter the plants and colonize the emerging seeds. The microorganisms may also be applied by specific instruments to the flower, for example, by a spatula, a syringe or an inoculating loop. Another embodiment for administering the microbes to the flower of a plant is performed by employing pollen-feeding insects, for example bumblebees, that carry the endophytic microorganisms. Such insects (besides humble-bees also honey-bees, butterflies, some wasp and fly species or other “pollinators” may be used) can even be provided from commercial sources and contacted with the endophytes before they are released to contact the flowering plants. The microorganisms can be provided at a body part of these insects that has the highest probability to contact the flower of the plant (e.g., the legs or the ventral part of the body). In addition to aqueous suspensions, the microbial preparations of the invention can be applied in a dry formulation using talc or some other particulate carrier. In such cases, the microbial preparation can be dried lyophilized in a manner preserving viability of the microbe (for example by using cryopreservants and/or protective sugars), and be present at a level of from about at least 102CFU per gram of dry formulation, for example, at least 103CFU per gram, at least 104CFU per gram, at least 105CFU per gram, at least 106CFU per gram, at least 107CFU per gram, at least 108CFU per gram, or more. Such dry compositions can be applied by dusting, or coating a plant, a plant field, or seed. In use, plants or seeds are treated with the compositions described herein by simply contacting one or more portions of the plant or seed. Additionally, the seeds or tubers can be submerged in the aqueous composition and then planted and allowed to grow into a protected plant. Furthermore, the soil around the plant or seed can be treated as well. When the plant to be treated is a tree, the composition can be introduced into the vascular system of the tree by conventional methods. Also contemplated herein are methods of inoculating a plant with a plurality of microbes. The method can be performed in a manner similar to those described above for single microbe inoculation. Multiple microbes can be prepared in a single preparation which is contacted with the plant. Alternatively, a plant can be contacted sequentially with a first preparation containing the first microbe, then a second preparation containing the second microbe. In some other cases, the plant may be contacted with a first preparation of first microbes. The seeds of the plant are then collected, and allowed to germinate. The resulting progeny is then inoculated with a second preparation of second microbes, or a preparation containing the multiple microbes (e.g., the first and second microbes). The seeds of the inoculated progeny are then collected and tested for the presence of multiple microbes on and/or in the seed. Where multiple microbes are inoculated onto a single plant, any or all of the microbes may be capable of producing a desired biomolecule or product within the host plant. In some cases, all of the microbes are capable of propagating within the host plant. In some cases, all of the microbes are able to enter into the host seeds for storage. As described herein, a plant is contacted with a preparation of microbes. The preparation of microbes can be applied to the plant using several different means. For example, the preparation can be sprayed to the entire plant, or part of the plant (e.g., roots, shoots, leaves, above-ground tissues, or parts of the plant including the flowers or buds). In one embodiment, the above-ground tissues of the plant are sprayed with the suspension. In another embodiment, the areas around the bud and flowers of a plant are sprayed with the microbial suspension. In still another embodiment, the meristem tissues and surrounding areas of a plant are sprayed with the microbial suspension. A suspension or paste of microbes can be brushed or painted onto the whole plant or particular tissue/organs of the plant. In one embodiment, a suspension or paste of microbes is brushed onto any one of the tissues/organs and surrounding parts selected from the group consisting of the flower, bud, and meristematic tissue. A plant can also be submerged into a preparation containing the microbes (e.g., a microbial suspension). For example, the entire plant, or part of the plant (e.g., roots, shoots, leaves, above-ground tissues, or parts of the plant including the flowers or buds) can be submerged into a microbial suspension for a defined period of time. In one embodiment, a plant or a portion thereof is submerged for a period of at least 5 minutes, for example at least 10 minutes, at least 15 minutes, at least 30 minutes, at least 1 hour, at least 2 hours, at least 5 hours or more. In another embodiment, the plant, or a portion thereof, is submerged in the microbial suspension for no longer than 48 hours, for example, no longer than 24 hours, no longer than 12 hours, or no longer than 6 hours. As described herein, a plant can be contacted with the microbial preparation at defined developmental stages. For example, the microbial preparation can be contacted with the plant at any one of the stages selected from the group consisting of the imbibition, germination stage, emergence stage, vegetative stage, and reproductive stages. In one embodiment, the plant is contacted with the preparation of microbes at the stage selected from the post-imbibition, post-germination stage, post-emergence stage, vegetative stage, reproductive stage and post-reproductive stage. In one particular embodiment, the plant is contacted with the microbial preparation at the vegetative and reproductive stages. In still another embodiment, a post-germination, pre-reproductive plant (i.e., before the first flower is open) is contacted with the microbial preparation. In yet another embodiment, a plant at the inflorescence emergence stage and flowering stage are contacted with the microbial preparation. In an alternative description, the plant is contacted with the microbial preparation at various stages defined by the BBCH scale (see, for example, Zadoks, J. C et al., (1974). Weed Research 14 (6): 415-421, which is incorporated herein in its entirety). While the scale differs by plant species, there are some general growth phases: 0: Germination; 1: Leaf development; 2: Tillering/Development of side shoots; 3: Stem elongation; 4: Booting; 5: Inflorescence emergence, heading; 6: Flowering, anthesis; 7: Development of fruit; 8: Ripening; 9: Senescence. Therefore, in one embodiment, a plant that is between growth phase 0 and growth phase 9 is contacted with the microbial preparation. In another embodiment, a plant that is between growth phase 1 and growth phase 8 is contacted with the microbial preparation. In still another embodiment, a plant that is between growth phase 2 and growth phase 7 is contacted with the microbial preparation. In a particular embodiment, a plant that is between growth phase 5 and growth phase 7 is contacted with the microbial preparation. In still another embodiment, a plant that is between growth phase 1 and growth phase 5 can be contacted with a microbial preparation. In a final embodiment, a plant that is in growth phases 0-5, 7-9 can be contacted with a microbial preparation. In still another embodiment, a plant is contacted at a time between about 2 weeks prior to flowering and during flowering. In other words, plants at growth stage between 5 and 6 are contacted with the preparation of microbes. In one embodiment, contacting the flower of a plant with a preparation of microorganisms is performed via spraying the microorganisms at the time of flowering. Spraying is specifically useful as an industrial production method and can be easily automated, e.g., in glasshouse cultures. Other methods include the inoculation by using a brush, or an inoculating loop, or by applying droplets, powders, gels, solids, or other materials containing the microbe. In some cases, the plant is contacted with the preparation of microbes more than once. For example, the plant can be contacted with the preparation of microbes at least twice, for example, three times, four times, five times, six times, or more. Thus, in one embodiment, the plant that is between growth phase 0 and growth phase 9 is contacted with the microbial preparation more than once. In another embodiment, a plant that is between growth phase 1 and growth phase 8 is contacted more than once with the microbial preparation. In still another embodiment, a plant that is between growth phase 2 and growth phase 7 is contacted more than once with the microbial preparation. In a particular embodiment, a plant that is between growth phase 5 and growth phase 7 is contacted more than once with the microbial preparation. In still another embodiment, a plant that is between growth phase 1 and growth phase 5 can be contacted more than once with a microbial preparation. In a final embodiment, a plant that is in growth phases 0-5, 7-9 can be contacted more than once with a microbial preparation. The interval between contacting can be between about 1 day and 21 days, for example between about 1 day and 2 days, between about 1 day and 3 days, between about 2 days and 4 days, between about 3 days and 6 days, between about 4 days and 7 days, between about 5 days and 10 days, between about 7 days and 14 days, or between about 10 days and 20 days. There are some suggestions that pathogens may escape the plant's immune system at lower temperatures (see, for example, Szittya et al., (2003) EMBO J. 22: 633-640). Therefore, in some cases, the plants can be incubated at low temperature, for example at temperatures at or below 18° C., for example, at or below 15° C., at or below 12° C., at or below 10° C., at or below 8° C., for any period from the contacting step until maturation of seeds. In one embodiment, the plant is incubated at a low temperature for 1 day after contacting with the preparation of microbes. In another embodiment, the plant is incubated at a low temperature for 2 days after contacting the plant with the preparation of microbes. In still another embodiment, a plant is contacted at least twice with the preparation of microbes, and the plant is subjected to low temperature incubation for two days following each of the contacting steps. Growing Plants from Seeds to Scale Up Preserved Microbial Populations The establishment of a stably integrated microbe population within the plant can be detected by a number of methods. The presence of the viable microbe within the seed and the plants and progeny derived from those seeds can be determined using the methods described herein. In one embodiment, the resulting seeds, or the plant that is grown from such seeds, have a detectably altered chemical composition or metabolomic profile where the altered composition is due only to the presence of the microbe. In another embodiment, the resulting seeds, or the plant that is grown from such seeds, have a detectably altered gene expression profile that is linked to the presence of the microbe. Plants can be grown individually to propagate the desired microbes in indoor or outdoor settings. An advantage of the present invention is that allows multiple plants to be grown under agricultural methods as a means of further increasing the quantity of a desired microbe that is produced. Provided herein are indoor arrangements of populations of plants generated from the methods of the present invention. Such arrangements can include at least a defined number of plants of the present invention, such as at least 1, 2, 3, 5, 10, 15, 20, 30, 50, 100, 200, 500, 1000, 5000, or 10000 plants. Also provided herein are agricultural fields that contain population of plants generated from the methods of the present invention. Agricultural fields can occupy as little as 100 square feet or less, or can occupy hundreds or thousands of acres. Area of field containing a population of microbe-associated plants can be measured in square feet, such as at least 100, 500, 1000, 5000, 10,000, 50,000 or greater than 50,000 square feet, or can be measured in acres, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 25, 50, 100, 250, 500, 750, 1000, 5000, 10000, 50000 or greater than 50000 acres. The field can also be measured in hectares, for example at least 1, 5, 10, 20, 100, 300, 500, 1,000, 10,000 hectares or more. Additionally, a field containing a population of microbe-associated plants can be characterized by the number of plants in the population, generally a field is at least two, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 25, 50, 100, 250, 500, 750, 1000, 5000, 10000, 50000, 100000, 250000, 500000, 750000, 1000000 or greater than 1000000 plants. A field is generally a contiguous area but may be separated by geographical features such as roads, waterways, buildings, fences, and the like known to those skilled in the art. Because the microbe-associated plants described herein benefit from an increased level of uniformity of germination and other characteristics, it is desirable to maximize the percentage of plants containing microbes. For example, at least 50% (e.g., 50%, 60%, 70%, 80%, 90%, 95%, 99% or greater than 99%) of the plants contain the microbes. Plants Useful for the Methods of the Invention The methods described herein are useful for producing a seed containing a microbe that is exogenous to the seed. The seed can be from any plant species that produces a seed (i.e., any spermatophyte). Suitable plants include both monocots and dicots (including eudicots) that can be colonized by the microorganisms according to the present invention. Preferably, the plant is a flowering plant (angiosperm) in order to most efficiently transfer the microorganisms to the seed. The resulting seeds contain the inoculated microbes at a detectable level. Plants grown from such seeds contain the microbes in part or all of their tissues, and the microbe may confer beneficial properties (e.g., enhanced growth, increased stress resilience, etc.) of the microbe can develop in the seeds or plants. Accordingly, the plants arising from such seeds—wherein the microbe can confer its beneficial function to the plant—may be at any stage of growth, including seeds, seedlings, or full plants. The present invention is therefore not limited to the application of microorganisms to a given plant (or seed) in order to provide the beneficial microbial effect only to this plant, but it provides a method which encapsulates and safeguards the presence of microbes in the seeds generated from this plant and therefore provides the microbes to the subsequent generations of the plant. This differs significantly from all other inoculation strategies attempted to date (seed impregnation, spraying the microorganisms to the seeds, germs or the whole plants), in that the present method deals with the production of seeds which contain a reproducible and heritable microbialmicrobial population. The plant can be monocotyledonous. The plant can be dicotyledonous. In one embodiment, the plant is an agricultural plant. As used herein, an “agricultural plant” is a plant that is normally cultivated for agriculture to provide food, animal feed, fiber, or any other useful commodity product. In still another embodiment, the agricultural plant is a cereal plant. In one embodiment, the target plant is a plant of the family Graminae (grasses). The grass plants into which these endophytes are introduced may be any of the useful grasses belonging to the genuses In another embodiment, the target plant is selected from the wheats, including, In another embodiment, the target plant is a corn of the genus Other useful grasses which may be used on an industrial basis are rye grasses and bluegrasses. Bluegrasses known in the art include Kentucky bluegrass, Canada bluegrass, rough meadow grass, bulbous meadow grass, alpine meadow grass, wavy meadow grass, wood meadow grass, Balforth meadow grass, swamp meadow grass, broad leaf meadow grass, narrow leaf meadow grass, smooth meadow grass, spreading meadow grass and flattened meadow grass. In another embodiment, the plants for which seeds are produced by the method according to the present invention are dicots, including eudicots such as tomato, watermelon, squash, cucumber, strawberry, pepper, soybean, peanut, Brassicaceae, especially rape, sunflower, sugar beet, cotton, alfalfa and Accordingly, in one embodiment, the plant is selected from the group of Graminae (grasses), including grasses of the genuses Cultivars The present invention contemplates the use of commercial cultivars of agricultural plants. The microbes described herein can be inoculated with such commercial cultivars using the methods provided herein. Non-limiting examples of commercial cultivars are provided below. Maize Exemplary Exemplary Exemplary Exemplary Soybean Exemplary soybean cultivars provided herein include 900Y71, 90Y42, P05T24R, 90Y80, 91M01, 91Y01, P10T91R, 91M10, 91Y20, 91Y61, 91Y90, P19T01R, 92Y12, 92Y21, 92Y31, 92Y32, P24T19R, 92Y51, 92Y91, 93M11, and 93Y22 from Pioneer Hi-Bred, which are grown in geographical entities including Iowa. Exemplary soybean cultivars provided herein include 92Y51, 92Y53, P25T51R, P26T76R, 92M72, 92Y75, 92Y80, P28T33R, 93Y05, 93Y15, 93Y20, 93Y21, 93Y25, 93M42, 93Y40, 93Y41, 93Y43, P34T35L, P35T58R, 93Y60, 93Y72, 93B82, 93Y82, 93Y84, 93L71, P39T67R, 94Y01, 94Y21, 94Y23, 94Y50, 94Y70, and 95Y10 from Pioneer Hi-Bred, which are grown in geographical entities including Illinois. Exemplary soybean cultivars provided herein include 91Y90, 92Y22, P24T19R, 92Y53, 92Y62, 92M72, 92Y70, 92Y73, 92Y83, 93M11, 93Y13, 93Y15, 93M43, 93Y41, 93Y52, P35T58R, 93M61, 93Y70, 93Y72, 93B82, 93Y84, 93Y92, P39T67R, 94Y01, and 94Y02 from Pioneer Hi-Bred, which are grown in geographical entities including Nebraska. Exemplary soybean cultivars provided herein include 90Y51, 90Y90, 92Y51, 92Y75, 92Y80, P28T33R, 93Y05, 93Y11, 93Y20, 93Y21, 93Y22, 93Y23, P33T89R, 93M42, 93Y40, 93Y41, 93Y43, P34T35L, 93Y51, 93Y53, P35T58R, 93Y60, 93Y72, 93B82, 93Y82, 93Y84, 93L71, 93Y91, 93Y92, P39T67R, 94Y01, 94Y02, 94L21, 94Y21, 94Y22, 94Y23, 94L51, P43T14L, P44T82SR, 94Y50, P46T21R, 94Y70, P47T36R, 94Y80, and P48T53R from Pioneer Hi-Bred, which are grown in geographical entities including Indiana. Exemplary soybean cultivars provided herein include AG 0231 GENRR2Y, AG 0333 GENRR2Y, AG 0430 GENRR2Y, AG 0532 GENRR2Y, AG 0732 GENRR2Y, AG 0832 GENRR2Y, AG 0833 GENRR2Y, AG 1031 GENRR2Y, AG 1132 GENRR2Y, AG 1230 GENRR2Y, AG 1233 GENRR2Y, and AG 1431 GENRR2Y from Asgrow, which are grown in geographical entities including the United States. Exemplary soybean cultivars provided herein include S06-H5, S08-G1, S10-G7, S10-P9, S12-L5, S14-J7, S17-B3, S17-G8, S18-C2, S20-T6, S20-Y2, S22-F8, S22-S1, S23-P8, S24-K2, S25-E5, S27-H6, S28-A2, S28-K1, S28-U7, S29-V2, S30-E9, S34-N3, S34-Z1, S35-C3, S36-M8, S17-B3, S18-C2, S20-T6, S20-Y2, S22-F8, S22-S1, S24-K2, S25-E5, S27-H6, S28-A2, S28-U7, S29-V2, S30-E9, S31-L7, S34-N3, S34-Z1, S35-C3, S36-M8, S37-B1, S38-S4, S38-W4, S39-U2, S41-J6, S42-W9, S43-K1, and S44-K7 from Syngenta, which are grown in geographical entities including the United States. Wheat Exemplary Exemplary Exemplary Exemplary Exemplary Exemplary Barley Exemplary barley cultivars provided herein include Azure, Beacon, Bere, Betzes, Bowman, Celebration, Centennial, Compana, Conlon, Diamant, Dickson, Drummond, Excel, Foster, Glenn, Golden Promise, Hazen, Highland barley, Kindred, Kindred L, Larker, Logan, Lux, Manchurian, Manscheuri, Mansury, Maris Otter, Morex, Nordal, Nordic, Optic, Park, Plumage Archer, Pearl, Pinnacle, Proctor, Pioneer, Rawson, Robust, Sioux, Stark, Tradition, Traill, Tregal, Trophy, Windich, and Yagan, which are grown throughout the world. Exemplary barley cultivars provided herein include Tradition, Lacey, Robust, Celebration, Conlon, Pinnacle, Haybet, Legacy, Stellar-D, Innovation, Hays, Quest, Bowman, and Logan, which are grown in geographical entities including North Dakota. Exemplary barley cultivars provided herein include AC METCALFE, HARRINGTON, CONRAD (B5057), LEGACY (B2978), MORAVIAN 69 (C69), MERIT (B4947), TRADITION (B2482), MORAVIAN 83 (C83), and CHARLES, which are grown in geographical entities including Idaho. Exemplary barley cultivars provided herein include Harrington, Haybet, B 1202, Moravian, Baronesse, Hector, Bowman, Westford, B Merit, Gallatin, Horsford, Lewis, Stark, Piroline, Valier, B 2601, Legacy, Menuet, Robust, Chinook, and Clark, which are grown in geographical entities including Montana. Exemplary barley cultivars provided herein include Champion, Bob, Baronesse, Radiant, Haybet, Belford, Camelot, BG, Camas, Gallatin, Copeland, AC Metcalfe, and Harrington, which are grown in geographical entities including Washington state. Exemplary barley cultivars provided herein include Moravian 69, C-115, C-128, Scarlett, Baronesse, Hays, and Steptoe, which are grown in geographical entities including Colorado. Cotton Exemplary Exemplary Exemplary Genetically Modified Plants The methods described herein can also be used with genetically modified plants, for example, to allow the use of current commercial cultivars of crops where the use of genetically modified plants is common. For example, a genetically modified plant which is, by means of the transgene, optimized with respect to a certain trait, can be used as a bioreactor to propagate the newly introduced microbe and its seeds can be used as storage vehicles for the microbe. Therefore, in one embodiment, a genetically modified plant is contacted with a microbe. The genetically modified plant can be any one of the plants described in Table H. Pre-Treating Plants to Reduce Carriage of Endogenous Microbes In some cases, it may be beneficial or preferable to use plants that are modulated to reduce their carriage of endogenous microbes. As used herein, a plant that is depleted, sterilized, or reduced in its carriage of an endogenous microbe is one in which some, substantially all, or all of the endogenous microbiota that reside within the plant are removed. Microbes within a plant are typically resistant to surface sterilization by chemical agents such as detergents, bleach (sodium hypochloritehypochlorite), hydrogen peroxide, or ethanol, which do not penetrate the surface of the plant in sufficient amounts. Surface sterilization of seeds, for example, is a convenient means to distinguish between surface-residing microbes (which are sensitive to surface sterilization), and endogenous microbes (which are resistant to such methods of surface sterilization). In order to remove (i.e., kill) some, substantially all, or all of the endogenous microbes, additional treatments are required. For example, in one embodiment, a plant or a part thereof (including a seed) can be treated with an antibacterial agent that has sufficient permeability to enter the plant tissues and kill or hinder endogenous bacteria. One of ordinary skill in the art will appreciate that such agents should ideally be agents that do not compromise the viability of the plant, at least at the concentration used. The agent should also have a broad spectrum to target as many bacteria as possible. In the alternative, a combination of antibacterial agents can be used. A non-limiting list of antibiotics is found in Table G. In one embodiment, the plant or part thereof is contacted with an antibacterial agent selected from the group consisting of: Amikacin, Gentamicin, Kanamycin, Neomycin, Netilmicin, Tobramycin, Paromomycin, Spectinomycin, Ansamycins, Geldanamycin, Herbimycin, Rifaximin, streptomycin, Carbacephem, Loracarbef, Carbapenems, Ertapenem, Doripenem, Imipenem/Cilastatin, Meropenem, Cefadroxil, Cefazolin, Cefalotin or Cefalothin, Cefalexin, Cefaclor, Cefamandole, Cefoxitin, Cefprozil, Cefuroxime, Cefixime, Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Ceftriaxone, Cefepime, Ceftaroline fosamil, Ceftobiprole, Glycopeptides, Teicoplanin, Vancomycin, Telavancin, Lincosamides, Clindamycin, Lincomycin, Lipopeptide, Daptomycin, Azithromycin, Clarithromycin, Dirithromycin, Erythromycin, Roxithromycin, Troleandomycin, Telithromycin, Spiramycin, Monobactams, Aztreonam, Nitrofurans, Furazolidone, Nitrofurantoin, Linezolid, Posizolid, Radezolid, Torezolid, Amoxicillin, Ampicillin, Azlocillin, Carbenicillin, Cloxacillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Methicillin, Nafcillin, Oxacillin, Penicillin G, Penicillin V, Piperacillin, Penicillin G, Temocillin, Ticarcillin, Penicillin combinations, Amoxicillin/clavulanate, Ampicillin/sulbactam, Piperacillin/tazobactam, Ticarcillin/clavulanate, Polypeptides, Bacitracin, Colistin, Polymyxin B, Ciprofloxacin, Enoxacin, Gatifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Nalidixic acid, Norfloxacin, Ofloxacin, Trovafloxacin, Grepafloxacin, Sparfloxacin, Temafloxacin, Mafenide, Sulfacetamide, Sulfadiazine, Silver sulfadiazine, Sulfadimethoxine, Sulfamethizole, Sulfamethoxazole, Sulfanilimide (archaic), Sulfasalazine, Sulfisoxazole, Trimethoprim-Sulfamethoxazole (Co-trimoxazole) (TMP-SMX), Sulfonamidochrysoidine (archaic), Demeclocycline, Doxycycline, Minocycline, Oxytetracycline, Tetracycline Clofazimine, Dapsone, Capreomycin, Cycloserine, Ethambutol, Ethionamide, Isoniazid, Pyrazinamide, Rifampicin (Rifampin in US), Rifabutin, Rifapentine, Streptomycin, Arsphenamine, Chloramphenicol, Fosfomycin, Fusidic acid, Metronidazole, Mupirocin, Platensimycin, Quinupristin/Dalfopristin, Thiamphenicol, Tigecycline, Tinidazole, and Trimethoprim. In another embodiment, a plant or a part thereof (including a seed) is treated with an antifungal agent. In one embodiment the plant or part thereof is cured of some, substantially all, or all of the endogenous fungal microbes by contacting with an antifungal agent. In one embodiment, the antifungal agent is selected from the group consisting of: Polyene antifungals (Amphotericin B, Candicidin, Filipin, Hamycin, Natamycin, Nystatin, Rimocidin); Imidazole, triazole, and thiazole antifungals (Canesten (clotrimazole), Bifonazole, Butoconazole, Clotrimazole, Econazole, Fenticonazole, Isoconazole, Ketoconazole, Miconazole, Omoconazole, Oxiconazole, Sertaconazole, Sulconazole, Tioconazole, Albaconazole, Fluconazole, Isavuconazole, Itraconazole, Posaconazole, Ravuconazole, Terconazole, Voriconazole, Abafungin), Allylamines (Amorolfin, Butenafine, Naftifine, Terbinafine), Echinocandins (Anidulafungin, Caspofungin, Micafungin), Benzoic acid, Ciclopirox, Flucytosine or 5-fluorocytosine, Griseofulvin, Haloprogin, Polygodial, Tolnaftate, Undecylenic acid and Crystal violet. It will be appreciated by one of skill in the art that some plants may contain both bacterial and fungal endogenous microbes. As such, in one embodiment, a plant or part thereof is contacted with a combination of an antibacterial agent and an antifungal agent. As described herein, the antimicrobial agents (whether antibacterial or antifungal) are contacted with the plant or part thereof at a dosage, and for a time, sufficient to kill the endogenous microbes. The elimination of endogenous microbes can be monitored by removing a portion of the plant at various times, homogenizing the tissue, and plating the homogenate on media that support bacterial and/or fungal growth. Alternatively, after contacting the plant or part thereof with the antimicrobial agent, the plant can be allowed to grow in a sterile environment for a certain time before removing a portion of the plant. The tissue is then tested for the presence of microbial DNA by, for example, PCR using primers specific for bacteria or fungi. Seed Coating Compositions The seeds generated using the methods described herein can be further treated. Many commercial seeds are treated on the surface to contain a seed coating composition order to reduce yield losses during cultivation and to enhance the agronomic and nutritional value of the produce. As such, in one embodiment, the seeds are coated with a seed coating composition; the agent can be selected from the group consisting of a control agent, a plant growth regulator, and a fertilizer/nutrient. As used herein, agents used for eliminating or reducing the damage caused by a pathogen or pest on the plant or seed are referred to as a “control agent”. A control agent includes such agents that can be used to kill or repel a pest or pathogen, including a fungus, bacterium, insect, nematode, or bird. In one embodiment, the seed is treated with a control agent, which is selected from the group consisting of fungicides, insecticides, rodenticides, nematocides, miticides or bird repellents, a plant growth regulator and a fertilizer/nutrient. Fungicide In one embodiment, the control agent is a fungicide. As used herein, a fungicide is any compound or agent (whether chemical or biological) that can either inhibit the growth of a fungus or kill a fungus. In that sense, a “fungicide”, as used herein, encompasses compounds that may be fungistatic or fungicidal. As used herein, the fungicide can be a protectant, or agents that are effective predominantly on the seed surface, providing protection against seed surface-borne pathogens and providing some level of control of soil-borne pathogens. Non-limiting examples of protectant fungicides include captan, maneb, thiram, or fludioxonil. The fungicide can be a systemic fungicide, which can be absorbed into the emerging seedling and inhibit or kill the fungus inside host plant tissues. Systemic fungicides used for seed treatment include, but are not limited to the following: azoxystrobin, carboxin, mefenoxam, metalaxyl, thiabendazole, trifloxystrobin, and various triazole fungicides, including difenoconazole, ipconazole, tebuconazole, and triticonazole. Mefenoxam and metalaxyl are primarily used to target the water mold fungi A fungicide can be a biological control agent, such as a bacterium or fungus. Such organisms may be parasitic to the pathogenic fungi, or secrete toxins or other substances which can kill or otherwise prevent the growth of fungi. Any type of fungicide, particularly ones that are commonly used on plants, can be used as a control agent in a seed composition. Non-limiting examples of chemical fungicides that can be used are shown in Table I. In another embodiment, the fungicide is selected from the group listed on Table J. Antibacterial Compositions In some cases, the seed coating composition comprises a control agent which has antibacterial properties. In one embodiment, the control agent with antibacterial properties is selected from the compounds listed in Table G. In another embodiment, the compound is Streptomycin, oxytetracycline, oxolinic acid, or gentamicin. Herbicide In some cases, an herbicide can be included in the seed coating composition. Non-limiting examples of herbicides which can be used as a control agent of the seed coating application are listed in Table K. Plant Growth Regulators In still other embodiments, the seed coat composition comprises a plant growth regulator. The plant growth regulator can be selected from the group provided in Table L. In another embodiment, the plant growth regulator is selected from the group consisting of: Abscisic acid, amidochlor, ancymidol, 6-benzylaminopurine, brassinolide, butralin, chlormequat (chlormequat chloride), choline chloride, cyclanilide, daminozide, dikegulac, dimethipin, 2,6-dimethylpuridine, ethephon, flumetralin, flurprimidol, fluthiacet, forchlorfenuron, gibberellic acid, inabenfide, indole-3-acetic acid, maleic hydrazide, mefluidide, mepiquat (mepiquat chloride), naphthaleneacetic acid, N-6-benzyladenine, paclobutrazol, prohexadione (prohexadione-calcium), prohydrojasmon, thidiazuron, triapenthenol, tributyl phosphorotrithioate, 2,3,5-tri-iodobenzoic acid, trinexapac-ethyl and uniconazole. Other examples of antibacterial compounds which can be used as part of a seed coating composition include those based on dichlorophene and benzylalcohol hemi formal (Proxel® from ICI or Acticide® RS from Thor Chemie and Kathon® MK from Rohm & Haas) and isothiazolinone derivatives such as alkylisothiazolinones and benzisothiazolinones (Acticide® MBS from Thor Chemie). Other plant growth regulators that can be incorporated seed coating compositions are described in US 2012/0108431, which is incorporated by reference in its entirety. Insecticide In some cases, the seed coating composition can comprise an insecticide as a control agent. Any insecticide commonly used in agriculture can be used as a control agent. In one embodiment, the insecticide is selected from the group listed in Table M. Nematicide Preferred nematode-antagonistic biocontrol agents include ARF18 Particularly preferred nematode-antagonistic biocontrol agents include ARF18 Nutrients/Fertilizers In another embodiment, the seed coating composition can comprise a nutrient. The nutrient can be selected from the group consisting of a nitrogen fertilizer including, but not limited to Urea, Ammonium nitrate, Ammonium sulfate, Non-pressure nitrogen solutions, Aqua ammonia, Anhydrous ammonia, Ammonium thiosulfate, Sulfur-coated urea, Urea-formadehydes, IBDU, Polymer-coated urea, Calcium nitrate, Ureaform, and Methylene urea, phosphorous fertilizers such as Diammonium phosphate, Monoammonium phosphate, Ammonium polyphosphate, Concentrated superphosphate and Triple superphosphate, and potassium fertilizers such as Potassium chloride, Potassium sulfate, Potassium-magnesium sulfate, Potassium nitrate. Such compositions can exist as free salts or ions within the seed coat composition. Alternatively, nutrients/fertilizers can be complexed or chelated to provide sustained release over time. Rodenticide Rodents such as mice and rats cause considerable economical damage by eating and soiling planted or stored seeds. Moreover, mice and rats transmit a large number of infectious diseases such as plague, typhoid, leptospirosis, trichinosis and salmonellosis. Anticoagulants such as coumarin and indandione derivatives play an important role in the control of rodents. These active ingredients are simple to handle, relatively harmless to humans and have the advantage that, as the result of the delayed onset of the activity, the animals being controlled identify no connection with the bait that they have ingested, therefore do not avoid it. This is an important aspect in particular in social animals such as rats, where individuals act as tasters. In one embodiment, the seed coating composition comprises a rodenticide selected from the group of substances consisting of 2-isovalerylindan-1,3-dione, 4-(quinoxalin-2-ylamino)benzenesulfonamide, alpha-chlorohydrin, aluminium phosphide, antu, arsenous oxide, barium carbonate, bisthiosemi, brodifacoum, bromadiolone, bromethalin, calcium cyanide, chloralose, chlorophacinone, cholecalciferol, coumachlor, coumafuryl, coumatetralyl, crimidine, difenacoum, difethialone, diphacinone, ergocalciferol, flocoumafen, fluoroacetamide, flupropadine, flupropadine hydrochloride, hydrogen cyanide, iodomethane, lindane, magnesium phosphide, methyl bromide, norbormide, phosacetim, phosphine, phosphorus, pindone, potassium arsenite, pyrinuron, scilliroside, sodium arsenite, sodium cyanide, sodium fluoroacetate, strychnine, thallium sulfate, warfarin and zinc phosphide. It is, of course, also possible to provide a coating with additional microorganisms (either the same or different as the microbe that was inoculated). Therefore, according to another embodiment of the present invention, the obtained plant seed containing microorganisms is therefore subjected to a further seed impregnation step. Preparation of Commercial Seeds In another aspect, methods for the production of a uniform population of the seeds at a commercial scale are provided. The method comprises planting a plurality of parental seeds containing the microbe using the methods described herein, germinating the seeds and growing the resulting plants to maturity, and collecting commercial seeds from the plants. In one embodiment, the microbe population in at least 70%, for example, at least 75%, at least 80%, at least 90%, at least 95% or more of the commercial seeds is substantially the same. In some cases, the seeds are considered substantially the same when at least 70% of the seeds, for example, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds contains the microbe. In another embodiment, the commercial seeds are considered substantially the same when at least at least 70% of the seeds, for example, at least 75%, at least 80%, at least 90%, at least 95% or more of the seeds contains at least 10 CFU, for example, at least 100 CFU, at least 300 CFU, at least 1,000 CFU, at least 3,000 CFU or more, of the microbe. Optionally, the method can also include an additional step of contacting the resulting plants with a synthetic preparation of the microbes. The above cycle of planting seeds containing the desired microbe can be performed multiple times in succession in order to produce enough seeds for large-scale production of the microbe within agricultural settings. In these circumstances, samples of seeds can be checked at each generation to ensure uniformity of seeds as described above. Additional steps can be taken to enhance the probability that the seeds contain the desired microbes. In one embodiment, plants can be further contacted with microbes at each generation using the methods described herein. In another embodiment, the soil on which plants are grown can be enriched with the desired microbes. In still another embodiment, the seeds are coated with the desired microbes before replanting to produce the next generation of seeds. Where the final plant ‘bioreactor’ is an F1 hybrid, such as is the case with maize, the two parental inbred strains are grown in the field in adjacent rows and the female line has its tassels removed before pollination time and so its stigmas are necessarily pollinated by pollen from the male-designated line. The hybrid seeds are then harvested from the female line and so carry the microbes possessed by the female line, assuming that no microbes are transmitted via the pollen from the male parent. In this way the plant genes from the male line are brought into the genetic complement of the microbes of the female line. The methods for the production of a uniform population of the seeds at a large scale can further comprise additional steps. For example, collected seeds can be further treated by any of the steps selected from hulling, cleaning, sorting, grading, and certifying. In one embodiment the commercial seeds are further processed to eliminate other crop seeds to less than 5% of total seeds, for example, no more than 4%, no more than 3%, no more than 2%, no more than 1%, no more than 0.5%, no more than 0.3%, or less of total seeds. In other cases, the commercial seed preparation is cleaned so that the preparation contains no more than 5% of inert matter, for example, no more than 4%, no more than 3%, no more than 2%, no more than 1%, no more than 0.5%, no more than 0.3%, or less of inert matter. In still another embodiment, the commercial seeds are tested to ensure that the seeds have a germination rate of at least 70%, for example, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or more. The commercial seeds can be further treated. In one embodiment, the commercial seeds can be coated with a seed coating composition as described elsewhere. Commodity Plant Product In addition to scaling up the desired microbial preparation, the present invention provides an ability to harvest the plant ‘bioreactors’ to generate commodity plant products for commercial sale. This provides an additional means by which to reduce the total cost associated with the present invention's use of agricultural plants as bioreactors for microbial scale-up. As used herein, a “commodity plant product” refers to any composition or product that is comprised of material derived from a plant, seed, plant cell, or plant part of the present invention. Commodity plant products may be sold to consumers and can be viable or nonviable. Nonviable commodity products include but are not limited to nonviable seeds and grains; processed seeds, seed parts, and plant parts; dehydrated plant tissue, frozen plant tissue, and processed plant tissue; seeds and plant parts processed for animal feed for terrestrial and/or aquatic animal consumption, oil, meal, flour, flakes, bran, fiber, and any other food for human or animal consumption; and biomasses and fuel products. Any such commodity plant product that is derived from the plants of the present invention may contain at least a detectable amount of the specific and unique DNA corresponding to the microbes described herein. Any standard method of detection for polynucleotide molecules may be used, including methods of detection disclosed herein. Utilizing Microbes Compatible with Agrichemicals In certain embodiments, the microbe is selected on the basis of its compatibility with commonly used agrichemicals. As mentioned earlier, plants, particularly agricultural plants, can be treated with a vast array of agrichemicals, including fungicides, biocides (anti-bacterial agents), herbicides, insecticides, nematicides, rodenticides, fertilizers, and other agents. In some cases, it can be important for the microbe to be compatible with agrichemicals, particularly those with fungicidal or antibacterial properties, in order to persist in the plant although, as mentioned earlier, there are many such fungicidal or antibacterial agents that do not penetrate the plant, at least at a concentration sufficient to interfere with the microbe. Therefore, where a systemic fungicide or antibacterial agent is used in the plant, compatibility of the microbe to be inoculated with such agents will be an important criterion. In one embodiment, natural isolates of microbes which are compatible with agrichemicals can be used to inoculate the plants according to the methods described herein. For example, fungal microbes which are compatible with agriculturally employed fungicides can be isolated by plating a culture of the microbes on a petri dish containing an effective concentration of the fungicide, and isolating colonies of the microbe that are compatible with the fungicide. In another embodiment, a microbe that is compatible with a fungicide is used for the methods described herein. For example, the microbe is compatible with at least one of the fungicides listed on Table I. In another embodiment, the microbe is compatible with at least one of the fungicides listed on Table J. In still another embodiment, a microbe that is compatible with an antibacterial compound is used for the methods described herein. For example, the microbe is compatible with at least one of the antibiotics listed on Table G. Fungicide compatible microbes can also be isolated by selection on liquid medium. The culture of microbes can be plated on petri dishes without any forms of mutagenesis; alternatively, the microbes can be mutagenized using any means known in the art. For example, microbial cultures can be exposed to UV light, gamma-irradiation, or chemical mutagens such as ethylmethylsulfonate (EMS) prior to selection on fungicide containing media. Finally, where the mechanism of action of a particular fungicide is known, the target gene can be specifically mutated (either by gene deletion, gene replacement, site-directed mutagenesis, etc.) to generate a microbe that is resilient against that particular fungicide. It is noted that the above-described methods can be used to isolate fungi that are compatible with both fungistatic and fungicidal compounds. It will also be appreciated by one skilled in the art that a plant may be exposed to multiple types of fungicides or antibacterial compounds, either simultaneously or in succession, for example at different stages of plant growth. Where the target plant is likely to be exposed to multiple fungicidal and/or antibacterial agents, a microbe that is compatible with many or all of these agrichemicals can be used to inoculate the plant. A microbe that is compatible with several fungicidal agents can be isolated, for example, by serial selection. A microbe that is compatible with the first fungicidal agent is isolated as described above (with or without prior mutagenesis). A culture of the resulting microbe can then be selected for the ability to grow on liquid or solid media containing the second antifungal compound (again, with or without prior mutagenesis). Colonies isolated from the second selection are then tested to confirm its compatibility to both antifungal compounds. Likewise, bacterial microbes that are compatible to biocides (including herbicides such as glyphosate or antibacterial compounds, whether bacteriostatic or bactericidal) that are agriculturally employed can be isolated using methods similar to those described for isolating fungicide compatible microbes. In one embodiment, mutagenesis of the microbial population can be performed prior to selection with an antibacterial agent. In another embodiment, selection is performed on the microbial population without prior mutagenesis. In still another embodiment, serial selection is performed on a microbe: the microbe is first selected for compatibility to a first antibacterial agent. The isolated compatible microbe is then cultured and selected for compatibility to the second antibacterial agent. Any colony thus isolated is tested for compatibility to each, or both antibacterial agents to confirm compatibility with these two agents. The selection process described above can be repeated to identify isolates of the microbe that are compatible with a multitude of antifungal or antibacterial agents. Candidate isolates can be tested to ensure that the selection for agrichemical compatibility did not result in loss of a desired microbial bioactivity. Isolates of the microbe that are compatible with commonly employed fungicides can be selected as described above. The resulting compatible microbe can be compared with the parental microbe on plants in its ability to promote germination. Throughout the specification, the word “comprise,” or variations such as “comprises” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. Although the present invention has been described in detail with reference to examples below, it is understood that various modifications can be made without departing from the spirit of the invention. Therefore, it will be appreciated that the scope of this invention is encompassed by the embodiments of the inventions recited herein and the specification rather than the specific examples that are exemplified below. All cited patents and publications referred to in this application are herein incorporated by reference in their entirety. Microbial taxa core to agriculturally relevant communities were identified using high throughput marker gene sequencing across several crops and numerous varieties of seeds. These microbes may be propagated or stored in a plant bioreactor. To identify core (i.e. ubiquitous) microbial taxa across seeds, high-throughput sequencing of marker genes for bacteria, archaea, and fungi was used. 50 commercial, 22 wild, and 33 landrace corn seeds, 40 commercial, 13 wild, and 23 landrace wheat seeds, 13 cotton seeds, and 24 soybean seeds were obtained. Non-commercial varieties were obtained from USDA GRIN through their National Plant Germplasm system (http://www.ars-grin.gov/npgs/). Accessions were categorized into landrace, wild, and inbred varieties based on the their assessment of improvement status. In order to extract microbial DNA, the seeds were first soaked in sterile, DNA-free water for 48 h to soften them, and they were surface sterilized using 95% ethanol to reduce superficial contaminant microbes. The seeds were then ground using a mortar and pestle treated with 95% ethanol and RNAse Away (Life Technologies, Inc., Grand Island, N.Y.) to remove contaminant DNA. DNA was extracted from the ground seeds using the PowerPlant Pro DNA extraction kit (Mo Bio Laboratories, Inc., Carlsbad, Calif.) according to the manufacturer's instructions. Marker genes were amplified and sequenced from the extracted DNA using a high-throughput protocol similar to (Fierer et al. 2012, McGuire et al. 2013). For the bacterial and archaeal analyses, the V4 hypervariable region of the 16S rRNA gene was targeted (primers 515f/806r), and for fungi, the first internal transcribed spacer (ITS1) region of the rRNA operon (primers ITS1f/ITS2r) was targeted. The two marker genes were PCR amplified separately using 35 cycles, and error-correcting 12-bp barcoded primers specific to each sample were used to facilitate combining of samples. To reduce the amplification of chloroplast and mitochondrial DNA, we used PNA clamps specific to the rRNA genes in these organelles (Lundberg et al. 2013). PCR reactions to amplify 16S rRNA genes followed the protocol of (Lundberg et al. 2013), and those to amplify ITS regions followed the protocol of (Fierer et al. 2012). PCR products were quantified using the PicoGreen assay (Life Technologies, Inc., Grand Island, N.Y.), pooled in equimolar concentrations, and cleaned using the UltraClean kit (Mo Bio Laboratories, Inc., Carlsbad, Calif.). Cleaned DNA pools were sequenced on an Illumina MiSeq instrument at the University of Colorado Next Generation Sequencing Facility. The raw sequence data were reassigned to distinct samples using a custom Python script, and quality filtering and OTU (operational taxonomic unit) clustering was conducted using the UPARSE pipeline (Edgar 2013). Briefly, a de novo sequence database with representative sequences for each OTU was created using a 97% similarity threshold, and raw reads were mapped to this database to calculate sequence counts per OTU per sample. Prior to creating the database, sequences were quality filtered using an expected error frequency threshold of 0.5 errors per sequence. In addition, sequences were dereplicated and singletons were removed prior to creating the database. OTUs were provided taxonomic classifications using the RDP classifier (Wang et al. 2007) trained with the Greengenes (McDonald et al. 2012) or UNITE (Abarenkov et al. 2010) databases for 16S rRNA and ITS sequences, respectively. To account for differences in the number of sequences per sample, each sample was rarefied to 1,000 and 6,500 sequences per sample for 16S rRNA and ITS datasets. This resulted in samples with fewer sequences than the rarefaction depth to be discarded from downstream analyses. OTUs classified as chloroplasts or mitochondria were discarded prior to rarefaction. OTUs were determined to be core taxa based on detection across a variety of seed types. For example, taxa core across crops were those detected in >5% of seeds from each of the crops that were assessed. Similarly, taxa core to an individual crop were those detected in >5% of seeds from each of the cultivar categories (i.e. wild, landrace, inbred, or modern) within that crop. As additional quality control measures, OTUs where at least class level taxonomy could not be resolved and OTUs characteristic of soil or human skin (Dunn et al. 2013) were discarded. OTU counts from replicate samples of identical seed types were averaged prior to analysis. Among all of the OTUs we identified in this experiment, 192 were found to be core in corn, wheat, or across crops (Table 1). Among these, the 23 in Table 2 were found to be core across crops (Table 2). Additional endophytic microbes that may be stored or propagated in the bioreactors of the present disclosure were isolated from seeds of commercially significant plants. Diverse types of maize, wheat, rice, and other seeds were acquired and screened for cultivatable microbes. 49 distinct cultivars of maize and teosinte accessions were sourced from the USDA via GRIN (National Genetic Resources Program at http://www.ars-grin.gov/) or purchased from the Sustainable Seed Company (Covelo, Calif.). Similarly, 5 distinct wheat cultivars and wheat relatives were sourced from the USDA via GRIN (National Genetic Resources Program at http://www.ars-grin.gov/) or purchased from a Whole Foods in Cambridge, Mass. Seeds of rice and rice relatives (23 in total) were sourced from the USDA via GRIN (National Genetic Resources Program at http://www.ars-grin.gov/) or purchased from a Whole Foods in Cambridge, Mass. Seeds of several other species of plants, including sorghum, millet, oat, rye, teff, etc., were sourced from the USDA via GRIN (National Genetic Resources Program at the world wide web at ars-grin.gov/), the Sustainable Seed Company or purchased from a Whole Foods in Cambridge, Mass. Pools of 5 seeds were soaked in 10 mL of sterile water contained in sterile 15 mL conical tubes for 24 hours. Some maize and rice accessions were sampled for seed surface microbes. In these cases, after 24 hours of soaking, 50 μL aliquots of undiluted, 100× dilute and 10000× dilute soaking water was plated onto R2A agar [Proteose peptone (0.5 g/L), Casamino acids (0.5 g/L), Yeast extract (0.5 g/L), Dextrose (0.5 g/L) Soluble starch (0.5 g/L), Dipotassium phosphate (0.3 g/L), Magnesium sulfate 7H2O (0.05 g/L), Sodium pyruvate (0.3 g/L), Agar (15 g/L), Final pH 7±0.2 @ 25° C.] to culture oligotrophic bacteria, while the same volumes and dilutions were also plated onto potato dextrose agar (PDA) [Potato Infusion from 200 g/L, Dextrose 20 g/L, Agar 15 g/L, Final pH: 5.6±0.2 at 25° C.] to culture copiotrophic bacteria and fungi. All seeds in the study were sampled for endophytes by surface sterilization, trituration, and culturing of the mash. Seeds were surface sterilized by washing with 70% EtOH, rinsing with water, then washing with a 3% solution of sodium hypochlorite followed by 3 rinses in sterile water. All wash and rinse steps were 5 minutes with constant shaking at 130 rpm. Seeds were then blotted on R2A agar which was incubated at 30° C. for 7 days in order to confirm successful surface sterilization. Following the sterilization process, batches of seeds were ground with a sterile mortar and pestle in sterile R2A broth, while seeds of maize, rice and soy were also grown in sterile conditions and the roots or shoots of seedlings (without further sterilization) were crushed by bead beating in a Fastprep24 machine with 3 carbide beads, 1 ml, of R2A broth in a 15 mL Falcon tube shaking at 6M/s for 60 seconds. Extracts of surface washes, crushed seed, or macerated seedling tissue were serially diluted by factors of 1 to 10−3and spread onto quadrants on R2A, PDA, LGI or V8 juice agar in order to isolate cultivable seed-borne microorganisms. Plates were incubated at 28° C. for 7 days, monitoring for the appearance of colonies daily. After a week, plates were photographed and different morphotypes of colonies were identified and labeled. These were then selected for identification by sequencing, backing up by freezing at −80 C as glycerol stock, and assaying for beneficial functions as described herein. Plating and Scoring of Microbes After 7 days of growth, most bacterial colonies had grown large and distinct enough to allow differentiation based on colony size, shape, color and texture. Photographs of each plate were taken, and on the basis of color and morphotype, different colonies were identified by number for later reference. These strains were also streaked out onto either R2A or PDA to check for purity, and clean cultures were then scraped with a loop off the plate, resuspended in a mixture of R2A and glycerol, and frozen away in quadruplicate at −80° C. for later. To accurately characterize the bacterial endophytes isolated in Example 2, colonies were submitted for marker gene sequencing, and the sequences were analyzed to provide taxonomic classifications. Colonies were subjected to 16S rRNA gene PCR amplification using a 27f/1492r primer set, and Sanger sequencing of paired ends was performed at Genewiz (South Plainfield, N.J.). Raw chromatograms were converted to sequences, and corresponding quality scores were assigned using TraceTuner v3.0.6beta (U.S. Pat. No. 6,681,186, incorporated herein by reference). These sequences were quality filtered using PRINSEQ v0.20.3 [Schmieder and Edwards (2011) Bioinformatics. 2011; 27:863-864, incorporated herein by reference] with left and right trim quality score thresholds of 30 and a quality window of 20 bp. Sequences without paired reads were discarded from further processing. Paired end quality filtered sequences were merged using USEARCH v7.0 [Edgar (2010) Nature methods 10:996-8]. Taxonomic classifications were assigned to the sequences using the RDP classifier [Wang et al., (2007) Applied and environmental microbiology 73:5261-7, incorporated herein by reference] trained on the Greengenes database [McDonald et al. (2012), ISME journal 6:610-8, incorporated herein by reference]. The resulting 473 microbes, representing 44 distinct OTUs (using a 97% similarity threshold) are provided in Table 3. A total of 242 seed-origin bacterial endophytes representing 44 distinct OTUs as described in Example 3 were seeded onto 96 well plates and tested for various activities and/or production of compounds, as described below. Determining an endophyte's capacity to produce industrially-useful substances such as enzymes and antibiotics is useful to select which endophytes may be used in a plant bioreactor. In addition, detection of certain compounds made by the endophytes may be used as surrogate assay instead of testing directly for the presence of the endophyte by qPCR or sequencing. The results of these in vitro assays are summarized in Table 4A. Colonies or wells with no detectable activity were scored as “-”, low activity as “1,” moderate activity as “2” and strong activity as “3.” Production of Auxin (SD) To allow isolates to grow and accumulate auxin, bacterial strains were inoculated into 250 μL of R2A broth supplemented with with L-tryptophan (5 mM) in 350 μL deep, transparent flat bottom, 96 well culture plates. The plates were sealed with a breathable membrane and incubated at 28 C under static conditions for 3 days. After 3 days the OD600 and OD530 nm were measured on a plate reader to check for bacterial growth. After measuring these ODs, 50 μL of yellowish Salkowski reagent (0.01 M FeCl3 in 35% HClO4 (perchloric acid, #311421, Sigma) were added to each well and incubated in the dark for 30 minutes before measuring the OD530 nm measured to detect pink/red color. A very large number of bacteria showed a detectable level of pink or red colour development (the diagnostic feature of the assay suggesting auxin or indolic compound production)—169 out of 247. 89 strains had particularly strong production of auxin or indole compounds. Another important group of auxin producing seed-origin bacteria were Mineral Phosphate Solubilization Microbes were plated on tricalcium phosphate media as described in Rodriguez et al., (2001) J Biotechnol 84: 155-161 (incorporated herein by reference). This was prepared as follows: 10 g/L glucose, 0.373 g/L NH4NO3, 0.41 g/L MgSO4, 0.295 g/L NaCl, 0.003 FeCl3, 0.7 g/L Ca3HPO4, 100 mM Tris and 20 g/L Agar, pH 7, then autoclaved and poured into square Petri plates. After 3 days of growth at 28° C. in darkness, clear halos were measured around colonies able to solubilize the tricalcium phosphate. This was an agar based assay looking for halos around colonies which signify the solubilization of opaque tri-calcium phosphate, which resulted in a large number (95) of isolates having detectable levels of phosphate solubilization (Table 4A). Of these, at least 36 had moderate to high levels of phosphate solubilization, including several Growth on Nitrogen Free LGI Media All glassware was cleaned with 6 M HCl before media preparation. A new 96 well plate (300 ul well volume) was filled with 250 ul/well of sterile LGI broth [per L, 50 g Sucrose, 0.01 g FeCl3-6H2O, 0.8 g K3PO4, 0.2 g CaCl2, 0.2 g MgSO4-7H2O, 0.002 g Na2MoO4-2H2O, pH 7.5]. Bacteria were inoculated into the 96 wells simultaneously with a flame-sterilized 96 pin replicator. The plate was sealed with a breathable membrane, incubated at 28° C. without shaking for 5 days, and OD600readings taken with a 96 well plate reader. In total, of the 247 isolates there were 34 (14%) that had detectable growth under nitrogen limiting conditions (Table 4B). All of these groups are known to have representatives with the potential to fix atmospheric nitrogen; however chief among these were Microbes were assayed for growth with ACC as their sole source of nitrogen. Prior to media preparation all glassware was cleaned with 6 M HCl. A 2 M filter sterilized solution of ACC (#1373A, Research Organics, USA) was prepared in water. 2 μl/mL of this was added to autoclaved LGI broth (see above), and 250 μL aliquots were placed in a brand new (clean) 96 well plate. The plate was inoculated with a 96 pin library replicator, sealed with a breathable membrane, incubated at 28° C. without shaking for 5 days, and OD600 readings taken. Only wells that were significantly more turbid than their corresponding nitrogen free LGI wells were considered to display ACC deaminase activity. In total, of the 247 isolates there were 68 (28%) which had greater growth on nitrogen free LGI media supplemented with ACC, than in nitrogen free LGI. Of these, only 11% had very high ACC deaminase activity and these were mostly strains of The method was adapted from Phalip et al., (1994) J Basic Microbiol 34: 277-280. (incorporated herein by reference). 250 ml of autoclaved R2A broth supplemented with 0.5% glucose was aliquoted into a 96 well plate (#07-200-700, Fisher). The bacterial endophytes from a glycerol stock plate were inoculated into the plate using a flame-sterilized 96 pin replicator, sealed with a breathable membrane, then incubated for 3 days without shaking at 28° C. At day 5, 50 μl/well was added of freshly blended Barritt's Reagents A and B [5 g/L creatine mixed 3:1 (v/v) with freshly prepared α-naphthol (75 g/L in 2.5 M sodium hydroxide)]. After 15 minutes, plates were scored for red or pink coloration relative to a copper colored negative control (measured as 525 nm absorption on a plate reader). A large number of seed-origin bacteria showed a detectable level of pink or red color development (126 out of 247; See Table 4A). 70 of 247 isolates had strong production of acetoin or butanediol as detected by this assay. Siderophore Production To ensure no contaminating iron was carried over from previous experiments, all glassware was deferrated with 6 M HCl and water prior to media preparation [Cox (1994) Methods Enzymol 235: 315-329, incorporated herein by reference]. In this cleaned glassware, R2A broth media, which is iron limited, was prepared and poured (250 ul/well) into 96 well plates and the plate then inoculated with bacteria using a 96 pin plate replicator. After 3 days of incubation at 28° C. without shaking, to each well was added 100 ul of O-CAS preparation without gelling agent [Perez-Miranda et al. (2007), J Microbiol Methods 70: 127-131, incorporated herein by reference]. One liter of O-CAS reagent was prepared using the cleaned glassware by mixing 60.5 mg of chrome azurol S (CAS), 72.9 mg of hexadecyltrimethyl ammonium bromide (HDTMA), 30.24 g of finely crushed Piperazine-1,4-bis-2-ethanesulfonic acid (PIPES) with 10 ml of 1 mM FeCl3.6H2O in 10 mM HCl solvent. The PIPES had to be finely powdered and mixed gently with stirring (not shaking) to avoid producing bubbles, until a deep blue color was achieved. 15 minutes after adding the reagent to each well, color change was scored by looking for purple halos (catechol type siderophores) or orange colonies (hydroxamate siderophores) relative to the deep blue of the O-CAS. Siderophore production by bacteria on a plant surface or inside a plant may show that a microbe is equipped to grow in a nutrient limited environment. We searched for two types of siderophore that result in purple color change (catechol type siderophores) or orange color change (hydroxamate siderophores) after addition of the blue O-Cas reagent to 96 well plates. A large number of bacteria showed a detectable level of color change relative to the deep blue of the O-CAS; 80 out of 247. Notably, 32 of 247 strains had strong production of siderophores (see Table 5). Interestingly, strong siderophore producers included a large number (14) of the 16 Iodine reacts with pectin to form a dark blue-colored complex, leaving clear halos as evidence of extracellular enzyme activity. Adapting a previous protocol [Soares et al. (1999) Rev de Microbiol 30: 299-303, incorporated herein by reference] 0.2% (w/v) of citrus pectin (#76280, Sigma) and 0.1% triton X-100 were added to R2A media, autoclaved and poured into 150 mm plates. Bacteria were inoculated using a 96 pin plate replicator. After 3 days of culturing in the darkness at 25 C, pectinase activity was visualized by flooding the plate with Gram's iodine. Positive colonies were surrounded by clear halos. In our study, a large number, roughly 83 of the 247 isolates, had detectable pectinase activity, and 21 of these isolates had moderate to strong results visualized as medium to large halos—caused by copious diffusion of enzyme away from the bacteria. Cellulase Activity Iodine reacts with cellulose to form a dark brown/blue-colored complex, leaving clear halos as evidence of extracellular enzyme activity. Adapting a previous protocol [Kasana et al. (2008), Curr Microbiol 57: 503-507, incorporated herein by reference] 0.2% carboxymethylcellulose (CMC) sodium salt (#C5678, Sigma) and 0.1% triton X-100 were added to a starch free variant of R2A media, autoclaved and poured into 150 mm plates. Bacteria were inoculated using a 96 pin plate replicator. After 3 days of culturing in the darkness at 25 C, cellulose activity was visualized by flooding the plate with Gram's iodine. Positive colonies were surrounded by clear halos. In our study, a large number, roughly 83 of the 247 isolates, had detectable cellulose activity, and 21 of these isolates had moderate to strong results visualized as medium to large halos—caused by copious diffusion of enzyme away from the bacteria. Antibiosis Briefly, colonies of either A total of 59 and 72 isolates showed antibiosis activity against either The following bacterial endophytes were characterized: Bacterial strains from overnight grown cultures in TSA broth were streaked on TSA agar plates and incubated at 30° C. After 24 h, the color and shape of colonies were noted. Cell motility and shape of single colony was observed under light microscope (Nikon, Japan). The pH limits for bacterial growth was determined adjusted to pH values between 5 and 12 in triplicate. The dependence of bacterial growth on different salt concentrations was determined in the same medium containing 1-6% NaCl. Furthermore, the ability to grow in methanol/ethanol as sole carbon source was analyzed. Bacterial capacity to aggregate formation may positively affect their dispersal and survival in the plant environment and adsorption to plant roots. The extent of aggregation formation was measured in six replicates following the method of Madi and Henis (1989) with some modifications. Aliquots of liquid culture containing aggregates were transferred to glass tubes and allowed to stand for 30 min. Aggregates settled down to the bottom of each tubes, and the suspension was mostly composed free of cells. The turbidity of each suspension was measured at 540 nm (ODs) with a microplate reader (Synergy 5; BioTek Instrument Inc., Winooski, USA). Cultures were then dispersed with a tissue homogenizer for 1 min and the total turbidity (OD) was measured. The percentage of aggregation was estimated as follows:
Motility assays (swimming, swarming and twitching) were performed following the methods of Rashid and Kornberg (2000). Swim plates (LB media contained 0.3% agarose) were inoculated in triplicates with bacteria from an overnight culture on TSA agar plates grown at 30° C. with a sterile toothpick. For swarming, plates (NB media contained 0.5% agar and glucose) were inoculated with a sterile toothpick. Twitch plates (LB broth containing 1% Difco granular agar) were stab inoculated with a sharp toothpick to the bottom of petri dish from an overnight grown culture in TSA agar plates. Biofilm formation was analyzed using overnight grown bacterial culture in 96 well microtiter plates by staining with 1% crystal violet (CV) for 45 min. To quantify the amount of biofilm, CV was destained with 200 μl of 100% ethanol. The absorbance of 150 μl of the destained CV, which was transferred into a new microtiter plate was measured at 595 nm (modified from Djordjevic et al. 2002). Biochemical tests such as oxidase, catalase, gelatin hydrolysis and casein hydrolysis of the selected strains were performed. Oxidase and catalase activities were tested with 1% (w/v) tetramethyl-p-phenylene diamine and 3% (v/v) hydrogen peroxide solution, respectively. Gelatin and casein hydrolysis was performed by streaking bacterial strains onto a TSA plates from the stock culture. After incubation, trichloroacetic acid (TCA) was applied to the plates and made observation immediately for a period of at least 4 min (Medina and Baresi 2007). ACC-deaminase activity of the bacterial strains was tested on Brown & Dilworth (BD) minimal medium containing 0.7 g l−1ACC as a sole nitrogen source. BD plates containing 0.7 g l−1NH4Cl served as positive control and plates without nitrogen were used as negative control. ACC deaminase activity was recorded after 7 days of incubation at 28° C. Auxin production by bacterial isolates both in the presence and absence of L-tryptophan (L-TRP) was determined colorimetrically and expressed as IAA equivalent (Sarwar et al. 1992). Two days old bacterial cells grown (28° C. at 180 rpm) in TSA broth supplemented with 1% L-TRP solution were harvested by centrifugation (10,000 g for 10 min). Three mL of the supernatants were mixed with 2 mL Salkowski's reagent (12 g L−1FeCl3in 429 ml L−1H2SO4). The mixture was incubated at room temperature for 30 min for color development and absorbance at 535 nm was measured using spectrophotometer. Auxin concentration produced by bacterial isolates was determined using standard curves for IAA prepared from serial dilutions of 10-100 μg mL−1. Bacterial strains were evaluated for their ability to solubilize phosphates (organic/inorganic P). Aliquots (10 μL) of overnight bacterial growth culture in TSA medium were spot inoculated onto NBRI-PBP (Mehta and Nautiyal 2001) and calcium/sodium phytate agar medium (Rosado et al. 1998). Solubilization of organic/inorganic phosphates was detected by the formation of a clear zone around the bacterial growth spot. Phosphate solubilization activity may also determined by development of clear zone around bacterial growth on Pikovskaya agar medium (Pikovskaya 1948). Bacterial isolates were assayed for siderophores production on the Chrome azurol S (CAS) agar medium described by Schwyn and Neilands (1987). Chrome azurol S agar plates were prepared and divided into half (other half filled with Minimal medium) and spot inoculated at the border of both media with bacterial isolates and incubated at 28° C. for 5 days. The CAS agar colour changed from blue to orange or purple was considered as positive for siderophore production. For exopolysaccharide (EPS) activity (qualitative), strains were grown on Weaver mineral media enriched with glucose and production of EPS was assessed visually (modified from Weaver et al. 1975). The EPS production was monitored as floc formation (fluffy material) on the plates after 48 h of incubation at 28° C. Strains were tested for the production of ammonia (NH3) in peptone water as described by Cappuccino and Sherman (1992). The bacterial isolates were screened for the production of hydrogen cyanide (HCN) by inoculating King's B agar plates amended with 4.4 g L−1glycine (Lorck 1948). Filter paper (Whatman no. 1) saturated with picrate solution (2% Na2CO3in 0.5% picric acid) was placed in the lid of a petri plate inoculated with bacterial isolates. The plates were incubated at 28±2° C. for 5 days. HCN production was assessed by the color change of yellow filter paper to reddish brown. The bacterial isolates were tested for PHB production (qualitative) following the viable colony staining methods using Nile red and Sudan black B (Liu et al. 1998; Spiekermann et al. 1999). The LB plates with overnight bacterial growth were flooded with 0.02% Sudan black B for 30 min and then washed with ethanol (96%) to remove excess strains from the colonies. The dark blue colored colonies were taken as positive for PHB production. Similarly, LB plates amended with Nile red (0.5 μL mL−1) were exposed to UV light (312 nm) after appropriate bacterial growth to detect PHB production. Colonies of PHA-accumulating strains showed fluoresce under ultraviolet light. The bacterial strains were tested for AHL production following the method modified from Cha et al. (1998). The LB plates containing 40 μg ml−1X-Gal were plated with reporter strains ( Bacterial hydrolyzing activities due to amylase, cellulase, chitinase, lipase, pectinase, protease and xylanase were screened on diagnostic plates after incubation at 28° C. Amylase activity was determined on agar plates following the protocol Männistö and Häggblom (2006). Formation of an opaque halo around colonies indicated lipase activity. Cellulase and xylanase activities were assayed on plates containing (per liter) 5 g of carboxymethyl cellulose or birch wood xylan, 1 g of peptone and 1 g of yeast extract. After 10 days of incubation, the plates were flooded with gram's iodine staining and washing with 1M NaCl to visualize the halo zone around the bacterial growth (modified from Teather and Wood 1982). Chitinase activity of the isolates was determined as zones of clearing around colonies following the method of Chernin et al. (1998). Protease activity was determined using 1% skimmed milk agar plates, while lipase activity was determined on peptone agar medium. Formation of halo zone around colonies was used as indication of activity (Smibert and Krieg 1994). Pectinase activity was determined on nutrient agar supplemented with 5 g L−1pectin. After 1 week of incubation, plates were flooded with 2% hexadecyl trimethyl ammonium bromide solution for 30 min. The plates were washed with 1M NaCl to visualize the halo zone around the bacterial growth (Mateos et al. 1992). The antagonistic activities of bacterial isolates were screened against plant pathogenic bacteria ( Antagonistic activity of the bacterial isolates against fungi and oomycetes was tasted by the dual culture technique on potato dextrose agar (PDA) and yeast malt agar (YMA) media (Dennis and Webster 1971). A small disk (5 mm) of target fungus/oomycetes was placed in the center of petri dishes of both media. Aliquots of 10 μL of overnight bacterial cultures grown in TSA were spotted 2 cm away from the center. Plates were incubated for 14 days at 24° C. and zones of inhibition were scored. Strains were tested for tolerance towards selected heavy metals using TSA agar plates with the addition of 110 mg L-1 Cd (Cd NO3), 320 mg L-1 Cu (Cu SO4), 250 mg L-1 Cr (Cr NO3), 660 mg L-1 Pb (Pb (NO3)2), 110 mg L-1 Ni (Ni SO4) or 320 mg L-1 (Zn SO4). The plates were incubated at 28° C. for 5 days and metals tolerance was observed in terms of bacterial growth. RNAse Activity Assay 1.5 g of torula yeast RNA (#R6625, Sigma) is dissolved in 1 mL of 0.1 M Na2HPO4at pH 8, filter sterilized and added to 250 mL of autoclaved R2A agar media which is poured into 150 mm plates. The bacteria from a glycerol stock plate are inoculated using a flame-sterilized 96 pin replicator, and incubated at 25° C. for 3 days. On day three, plates are flooded with 70% perchloric acid (#311421, Sigma) for 15 minutes and scored for clear halo production around colonies. A range of bacterial characteristics known to contribute to plant growth promotion, stress tolerance or biocontrol was tested. The results of characterization are summarized in Tables 6 and 7. All F-strains showed IAA production (ranging from 1.63 to 10.33 μg mL−1IAA-equivalent) but with variable degrees of efficacy. Several of the strains, including FA13, FF34, FC42, FB12, FD17, S4 and S10 were found to produce significant levels of siderophore when tested in agar medium containing Chrom azurol S (CAS). Three strains (FB12, S6 and S10) were found to produce AHL. Aggregation and biofilm formation were common traits in all tested strains. In the case of motility, six strains (FA13, FF34, FB12, FD17, S6 and S10) were positive for swimming, while FD17, S6 and S10 also showed swarming. Bacteria were tested for production of exopolysaccharide (EPS) and poly-hydroxybutyrate (PHB). Five strains (FF34, FB12, FD17, S2 and S6) showed PHB production, while FA13, FC42, FD17 and S10 were found to produce EPS. Production of ammonia was commonly detected in all selected isolates but S4 and S10. In contrast, only ACC deaminase activity was found in FD17, FF34, FB12, S2, S4, S6, S9 and S10. FD17, FF34, FB12, S6 and S10 showed P-solubilization, whereas only FD17 showed production. Only FB12 was able to produce HCN. Strain S2 was the only strain not to show lipase activity. S10 was positive for amylase activity, S2 and S4 showed protease activity, and pectinase activity was observed with strains S6, S10, FF34, FB12 and FD17. All strains but FF34 and S9 were positive for cellulase and xylanase activity. Chitinase was produced by strains FB12, FD17 and S4. All strains showed antagonistic activity against one or more bacterial pathogens. All strains showed antagonism against different fungal pathogens and oomycetes but with FD17 and FB12 having higher degrees of efficacy. Strain FD17 showed highest antagonism against Seed endophytes colonize plant tissues and as part of their life cycle they can establish inside roots and disperse systemically throughout the plant vascular system and colonize stems, leaves, flowers and seeds. In order to track the fate of individual strains they are labeled with a marker such as Green Fluorescent Proteins (GFP) encoded in a multi copy plasmid. A strain is transformed with the plasmid encoding the expression of GFP that can be detected by flow cytometry with excitation with a blue laser at 488 nm and light emission at 530 nm or fluorescent microscopy. The transformed strain will fluoresce green and thus can be readily discriminated from the native microbial community as indigenous green fluorescence does not occur in seed endophytes or microbial species associated with the rhizosphere or soils. Seeds are inoculated with such bacteria which colonize the germinating seed allowing the establishment, detection and enumeration of the GFP-labeled strain in specific tissues such as roots, stems and flowers as the plants develop and mature. Through the plant's life cycle and reproductive stages the tissues can be analyzed for the presence of the GFP labeled seed-origin endophyte. This demonstrates that bacteria's ability to colonize and persist in vegetative plant tissues, in addition to seed surfaces and interiors where it was originally inoculated. Seed endophytes will be capable of propagation outside the seed and to be re-established on seeds to colonize new plant generations. Endophytes may also be stored protectively inside of seeds. In addition, endophytes will also be capable of propagation inside the plant, which may be useful to amplify itself or to produce useful industrial enzymes and microbes. A strain of Based on colony counting of serial dilutions, OTU#7-GFP inoculum was at a level of 2.74×109CFU/mL (approximately 5.08×107CFU/seed) when applied to seeds, and after 7 days at room temperature each seed still had about 4.44×105CFUs per seed. After 7 days of growth in a greenhouse exposed to fluctuations in light, heat, moisture and atmosphere, OTU#7-GFP inoculated seeds developed into a seedling with an average of 1.24×106CFU/g of root tissue and 7.93×105CFU/g of shoot tissue. Thus after planting seeds with approximately 4.44×105CFU of OTU#7-GFP each, seedlings germinated and grew into plantlets containing an average of 1.02×106CFU GFP labeled bacteria. This represents an almost three fold increase of bacterial numbers and suggests active growth and colonization of these bacteria in the plant, rather than passive survival for a week until the time of harvest. OTU#56-GFP inoculum was at a level of 1.69×109CFU/mL (approximately 3.13×107CFU/seed) when applied to seeds, and 7 days later each seed still had about 2.21×106CFUs living on its surface. After 7 days of growth in a greenhouse exposed to fluctuations in light, heat, moisture and atmosphere, OTU#56-GFP inoculated seeds developed into seedlings with an average of 4.71×106CFU/g of root tissue and 2.03×104CFU/g of shoot tissue. Thus after planting seeds with approximately 2.21×106CFU of OTU#7-GFP each, seedlings germinated and grew into plantlets containing an average of 6.06×105CFU GFP labelled bacteria. Taken together, these two experiments successfully showed that seed derived endophytes are able to survive on a maize seed surface in large numbers under non-sterile greenhouse conditions for at least a week and are able to colonize and persist on the developing plant over time where they will have ongoing opportunities to influence and improve plant growth, health and productivity. Even longer-term storage of endophytes represent an opportunity to use the seed as a vault for these microbes. The establishment of plant-microbe interactions is contingent on close proximity. The microbiome of the host plant consists of microorganisms inside tissues as well as those living on the surface and surrounding rhizosphere. The present invention describes, among other methods, the colonization of the plant by application of endophytic microbes of the seed surface. The experiments described in this section are aimed at confirming successful colonization of plants by endophytic bacteria by direct recovery of viable colonies from various tissues of the inoculated plant. The experiments were designed to reduce background microbes by the use of surface-sterilized seeds, and planting and growing the seeds in a sterile environment, to improve the observable colonization of the plant with the inoculated bacterium. Corn seeds of cultivar 58PM36 (Blue River Hybrid) were surface-sterilized by exposing them to chlorine gas overnight, using the methods described elsewhere. Sterile seeds were then inoculated with submerged in 0.5 OD overnight cultures [Tryptic Soy Broth] of strains SYM00254 (a Successful inoculation of corn plants by the endophytic bacteria allowed the recovery of viable, culturable cells as identified on TSA agar plates. Controls experiments using uninoculated, surface sterilized seeds were conducted and showed few, if any, bacterial cells were cultivatable from the inside suggesting inoculation with extra microbes would be easily detectable by culturing. Non surface sterilized seeds meanwhile showed a large diversity of colony types including both bacteria and fungi which drowned out the detection by culturing of inoculated bacteria, whereas the plants grown from surface-sterilized seeds showed a dominance of the inoculated strains readily identified by the colony morphology. Finally, significant quantities of viable colonies were recovered from roots, shoots or seeds of corn plants inoculated with SYM00254, SYM00284, SYM00290, or SYM00292 (Table 8, A single colony was picked from a plate containing The seeds were planted in a field in Tulln, Austria. Maize seedlings (height: 10-15 cm) grown at a field in Tulln, Austria were harvested by carefully pulling the whole plant including the roots out of the field soil. Three replicates were collected per hybrid, each replicate was taken from a different plot. In total 24 plants were harvested—three plants of four different hybrids either treated with Surface-disinfected above ground plant material of seedlings were cut in small pieces and crushed using a sterile mortar. The plant material was transferred to Matrix E (MPbio DNA isolation kit from soil) homogenized by 30 sec beat beating using in a bead beater (FastPrep FP 120, Bio101, Savant Instruments, Inc., Holbrook, N.Y.). DNA was extracted with the MPbio DNA isolation kit from soil (MP Biomedicals, Solon, Ohio, USA) according to protocol provided by the manufacturer. Single seeds were used for DNA isolation. For detection and quantification of Chromosomal DNA of For absolute quantification of PsJN-DNA in the maize samples, a calibration curve was generated from the real-time qPCR results of 3 respective replicates of a 10-fold serial dilution of the chromosomal DNA extracted from Samples were considered to be positively colonized by PsJN when at least two of three technical replicates in the qPCR gave a SQ value higher than 10 and/or the Cq value was smaller than cycle 40. The localization within the plant and its environment was determined for seed endophytes from corn and wheat seeds. To determine bacterial taxa inhabiting different plant compartments, seeds were germinated in soil in sterile tubes, and plant tissue was harvested. 12 corn seeds (Blue River hybrids, 40R73) and 12 wheat seeds (Briggs, developed by South Dakota University) were planted in separate culture tubes containing 12.5 ml of a 1:1 soil (type, supplier) to sand (v/v) mixture. 2.5 ml autoclaved deionized water was added to each tube, and they were fitted with caps. Tubes were placed in a growth chamber where plants were allowed to grow for 14 d Rhizosphere, root, and aerial tissue was harvested using a technique similar to (Lundberg et al. 2012). Briefly, aerial tissue was removed using sterilized forceps and scissors, placed in a sterile conical tube, and rinsed with 70% ethanol and sterile deionized water to remove superficial microbial cells Rhizosphere samples were taken by removing loose soil from roots, adding the roots with remaining soil to a 50 ml conical tube containing 10 ml sterile deionized water, vortexing the tube for 10 s, and removing the roots. Soil particles in the tubes were allowed to settle and the supernatant was decanted. Root samples were cleaned of remaining superficial soil and associated microbial cells using sterile water and forceps and a 70% ethanol rinse. Microbial composition was assessed in each sample using high-throughput sequencing of the V4 hypervariable region of the 16S rRNA gene (Fierer et al. 2012). DNA was extracted from the samples using the PowerPlant Pro DNA extraction kit (Mo Bio Laboratories, Inc., Carlsbad, Calif.) according to the manufacturer's instructions. The DNA was subjected to 35-cycle PCR amplification with the 515f/806r primer pair containing error-correcting 12-bp barcoded primers specific to each sample in order to facilitate combining the samples prior to sequencing. To reduce the amplification of chloroplast and mitochondrial DNA, we used PNA clamps specific to the rRNA genes in these organelles (Lundberg et al. 2013). PCR products were quantified using the PicoGreen assay (Life Technologies, Inc., Grand Island, N.Y.), pooled in equimolar concentrations, and cleaned using the UltraClean kit (Mo Bio Laboratories, Inc., Carlsbad, Calif.). Cleaned DNA pools were sequenced on an Illumina MiSeq instrument at the University of Colorado Next Generation Sequencing Facility. The raw sequence data were reassigned to distinct samples using a custom Python script, and quality filtering and OTU (i.e. operational taxonomic unit) clustering was conducted using the UPARSE pipeline (Edgar 2013). Briefly, a de novo sequence database with representative sequences for each OTU was created using a 97% similarity threshold, and raw reads were mapped to this database to calculate sequence counts per OTU per sample. Prior to creating the database, sequences were quality filtered using an expected error frequency threshold of 0.5 errors per sequence. In addition, sequences were dereplicated and singletons were removed prior to creating the database. OTUs were provided taxonomic classifications using the RDP classifier (Wang et al. 2007) trained with the Greengenes database (McDonald et al. 2012). To account for differences in the variable number of sequences per sample, each sample was rarefied to 200 sequences per sample. OTUs classified as chloroplasts or mitochondria were discarded prior to rarefaction. Overall differences in bacterial community composition between the control and inoculated plants were evaluated using non-metric multidimensional scaling based on Bray-Curtis dissimilarities in order to visualize pairwise differences between sample communities. Permutational analysis of variance (PERMANOVA) was used to statistically test the significance of these differences. Analyses were conducted using the vegan package in R (R Core Team 2013). To determine the OTUs contributing to overall differences between treatments and control groups, mean relative abundances were calculated for each OTU within each group. Only OTUs with a mean relative abundance of 0.25% in either group were included in this analysis. The bacterial taxa that are found in the root, aerial, seed tissue and/or rhizhosphere of the germinated corn and wheat seeds are shown in Tables 10, 11, 12, and 13 respectively. The results shown above demonstrate that many of the endophytic bacteria described herein possess activities that may be useful to help in their propagation and storage within plants and plant parts. Many of the bacteria described here are capable of producing compounds that could be industrially useful, as detected using the in vitro assays described above. In addition, several representative bacteria were tested and found to successfully colonize corn plants as demonstrated in the example above. However, determining colonization by the methods described above or others is not always the fastest and easiest way to determine whether the endophyte is successfully stored and/or propagating within the plant. The experiments in this section can be surrogate assays to determine the presence of an endophyte within a plant by assessing beneficial traits in the bioreactor plant. Several surrogate assays methods can be used. First, plants inoculated with bacteria were tested under conditions without any stress. If the microbe is present within the plant, the plant may show an increase in vigor. Second, endophyte-inoculated plants were tested under specific stress conditions (e.g., salt stress, heat stress, drought stress, and combinations thereof). These conditions may better reveal the presence of certain endophytes. These growth tests were performed using three different means: using growth assays on water-agar plates; using growth assays on sterile filter papers; and growth assays on magenta boxes. Surface sterilization of seeds—Un-treated organic maize seeds (Blue River hybrids, 40R73) and wheat seeds (Briggs, developed by South Dakota University) were sterilized overnight with chlorine gas as follows: 200 g of seeds were weighed and placed in a 250 mL glass bottle. The opened bottle and its cap were placed in a dessicator jar in a fume hood. A beaker containing 100 mL of commercial bleach (8.25% sodium hypochlorite) was placed in the dessicator jar. Immediately prior to sealing the jar, 3 mL of concentrated hydrochloric acid (34-37.5%) was carefully added to the bleach. The sterilization was left to proceed for 18-24 h. After sterilization, the bottle was closed with its sterilized cap, and reopened in a sterile flow hood. The opened bottle was left in the sterile hood for a couple hours to air out the seeds and remove chlorine gas leftover. The bottle was then closed and the seeds stored at room temperature in the dark until use. Seedling Vigor Assessment in Normal and Stressed Conditions on Water Agar Bacterial endophytes isolated from seeds as described herein were inoculated onto maize and wheat seeds and the plant was grown under normal and stressed conditions on water agar. For each bacterial endophyte tested, 5 mL of liquid R2A medium was inoculated with a single colony and the culture grown at room temperature on a shaker to an OD (600 nm) of between 0.8 and 1.2. Sterilized maize and wheat seeds were placed on water agar plates (1.3% bacto agar) in a laminar flow hood, using forceps previously flamed. A drop of inoculum with an OD comprised between 0.8 and 1.2 (corresponding to about 108CFU/mL) was placed on each seed (50 uL for maize, 30 uL for wheat, representing approximately 5·106and 3·106CFUs for maize and wheat, respectively). For each treatment, 3 plates were prepared with 12 seeds each, arranged as show in on Seedling Vigor Assays Under Normal and Stressed Conditions on Filter Paper Filter papers were autoclaved and placed into Petri dishes, and then presoaked with treatment solutions. To simulate normal conditions, 3-4 mL sterile water was added to the filters. Drought and saline stresses were induced by adding 3-4 mL 8% PEG 6000 solution or 50 or 100 mM NaCl to the filter papers. Surface sterilized seeds were incubated in bacterial inocula for at least one hour prior to plating. Nine seeds were plated in triplicate for each condition tested, including room temperature and heat stress (40° C.) for both normal and saline conditions. During initial stages of the experiment, plates were sealed with parafilm to inhibit evaporative water loss and premature drying of the filter papers. Plates were incubated in the dark at room temperature for two days following which heat treatment plates were shifted to 40° C. for 4-6 days. Parafilm was removed from all plates after 3-5 days. After 5-8 days, seedlings were scored by manually measuring root length for corn and shoot length for wheat and recording the mass of pooled seedlings from individual replicates. Plant vigor and improved stress resilience can be surrogates for determining the presence of endophytes within the plant. These can be measured in germination assays to determine whether this particular plant phenotype can be used as a surrogate assay. The collection of seed-origin endophytes produced a measurable response in corn (Tables 14a and 14b), and wheat (Table 15a and Table 15b) when inoculated as compared to non-inoculated controls. For example, from 48 bacterial strains, representing 44 OTUs tested in these germination assays, only 2 did not produce a phenotype in any of the measured multiple parameters such as root length, weight, or shoot length in wheat. Germination assays can therefore be used as a surrogate assay for determining the presence of many endophytes that have been inoculated into the plant. For drought responses in corn it was found that 73% of the strains were showing a positive response in the filter paper assay as measured by root length and weight. In some cases it was possible to see additive effects for stress responses comparing heat, salt and the combination of heat and salt in the same assay, however not always in a cumulative positive response. For vigor in corn 81% of the strains showed a positive effect when tested in filter paper or water agar assays. The plant phenotypes indicating the presence of the endophyte within the plant are visible by comparing for example the root length, shoot length and weight of the seedling with non-inoculated controls as illustrated by Individual tests for stress response for corn showed in average 57% of the strains an increase in weight over control in heat and salt, 51% for heat-salt and 40% for drought on weight gain. For wheat under salt conditions 54% of the strains produced an effect on root length, 77% of the strains a shoot length effect and 50% a weight gain. Drought tests were scored for shoot length and weight with a 59% of the strains showing increase in shoot length and 43% weight increase. Table 14. Systematic assessment of effects of seed-origin microbes on corn seed vigor under normal and stressed conditions. Legend: “-” indicates no significant increase relative to uninoculated control; “1”=0-5% increase relative to uninoculated control; “2”=5-10% increase relative to uninoculated control; “3”=>10% increase relative to uninoculated control Representative endophytes isolated from seeds as described herein were tested for their ability to promote plant growth under normal and stressed conditions by inoculating maize seeds with those endophytes and growing them inside Conviron Growth chambers (Conviron Corp., Asheville, N.C.) on double-decker Magenta boxes essentially as described in Rodriguez et al. (2008), which is incorporated herein by reference in its entirety. Briefly, the double-deckers were made by drilling a hole 8 mm in diameter in the center of a GA-7 plant culture vessel (Magenta boxes, Sigma, St. Louis), top-knotting and weaving through a 14 cm length of cotton rope to the bottom chamber to act as a wick and adding a defined amount of playground sand in the upper chamber. Peter's 20:20:20 plant nutrient solution (Peters Fertilizer Co., Fogelsville, Pa.) is added to the bottom chamber and a tight-fitting lid is added to the top and the whole system autoclaved and sterilized prior to planting with not-inoculated or endophyte-treated seeds. Maize seeds were surface sterilized with chlorine gas as described herein. Sterilized maize seeds were soaked for one hour on the appropriate bacterial culture before planting. Each bacterial culture was grown on a shaking incubator 20% Tryptic soy broth (TSB) until reaching ˜0.5 optical density, measured at 600 nm wavelength. Non-inoculated controls were soaked on sterile 20% TSB. Three seeds were planted on each double-decker Magenta box and three boxes were used per treatment (endophytic bacteria×environmental condition). The double-deckers were placed inside a Conviron Growth chamber with a setting of 60% humidity and kept in the dark for four days, until they started germinating. Upon germination, plants were grown in a cycle of light (˜400 mE×m{circumflex over ( )}−2×s{circumflex over ( )}−1) for 14 hrs. and dark for 10 hrs. When the leaves were fully expanded, approximately 8 days after seeding, the plants were assigned to one of 3 chambers were conditions were as follows: for Control conditions, plants were kept at 22° C.; for cold, plants were subjected to 5° C. during the light part of the daily cycle and near zero degrees during the dark part; for drought, the plants were maintained in the control chamber, but the liquid from the lower part of the double decker was emptied and the soil was allowed to dry; for heat conditions, the light intensity was set to a maximum of ˜600 mE×m{circumflex over ( )}−2×s{circumflex over ( )}−1, while the temperature was set to 40° C. for 12 hrs. out of the 14 hrs. of light and 45 degrees during the two hrs. around noon, during the dark cycle the temperature was set to 30° C. The air humidity was maintained at 60% in all chambers. The conditions were maintained for one week at the end of which conductance was measured using an SC-1 Leaf Porometer (Decagon Devices Inc., Pullman, Wash.) in the plants maintained under control and drought conditions and all the plants were harvested, photographed and dried in a convention oven at 45° C. to estimate dried biomass. Shoot and root lengths were measured digitally using the software ImageJ version 1.48u4 (Rasband http://imagej.nih.gov). Average measurements were compared against those for uninoculated controls for each treatment. The results obtained with the water agar assay are summarized in Table 16. The presence of certain bacterial endophytes was indicated by the plant showing significant growth improvement under normal and/or stressed conditions in maize. Notably, growth improvement was seen when strain SYM90 was present in the plant, under normal, drought and cold conditions, mainly in the form of increased root length. Strains SYM00183, SYM00015, SYM00167 and SYM00168 also increased root length under drought conditions relative to non-inoculated controls. Testing for biomass under cold conditions also appears to be a good surrogate assay for determining the presence of an endophyte in a plant, as almost all the endophytic bacteria tested provided increase gain in biomass under cold conditions. The magnitude of the difference in the conductance between normal conditions and drought conditions was significantly larger in the plants inoculated with SYM231 relative to the non-inoculated controls. The initial experiments described above were allowed us to determine whether a particular assay was a good surrogate for determining whether the microbe was present in the plant, by looking at certain traits in the colonized plant. We next sought to determine the amount of the microbe that is necessary to treat a plant in order to have a useful bioreactor. In this example, selected microbial cultures were diluted to OD600of 1.0, 0.1 and 0.01 (approximately 108, 107, 106CFUs/mL respectively) and applied onto wheat seeds (Briggs) using the water agar assay previously described. SYM00011, SYM00033 and SYM00057B cultures were grown from a single colony in 5 mL of liquid R2A medium at room temperature on a shaker to stationary phase. The absorbance at 600 nm was measured and adjusted to an OD600of 1.0 (˜108CFUs/mL) in R2A media. Two additional dilutions at OD 0.1 and 0.01 (˜107and 106CFUs/mL respectively) were prepared by diluting the initial inoculum 10 and 100 times, again in R2A media. Wheat seeds (Briggs) were sterilized overnight with chlorine gas and placed on water agar plates as described above. A 30 μL drop of inoculum was placed on each seed, representing approximately 3.0×106, 3.0×105and 3.0×104CFUs per seed for OD1, OD0.1 and OD0.01 inoculums, respectively. For each treatment, 3 plates were prepared with 12 seeds each. Plates were sealed with surgical tape, randomized to avoid position effects and placed in a growth chamber set at 22° C., 60% relative humidity, in the dark for four days. After four days, a picture of each plate was taken and the root length of each seedling was measured using the imaging software ImageJ (NIH). The percentage difference between the treated plants and the mock-treated (R2A control) was then calculated. All doses of the microbes at different concentration provided an increase in root length over the mock-treated controls as shown in As shown in some of the earlier examples, plant traits may be used as surrogate markers of the presence of endophytic microbes. Changes in the levels of proteins within the plant may also be used as a surrogate to determine the presense of endophytic microbes within a plant bioreactor. In order to explore the pathways augmented or otherwise altered in a plant bioreactor, we performed proteomic analysis on extracts of wheat and corn plants grown on water agar. Sterilized wheat and corn seeds were either mock-inoculated with R2A medium, or inoculated with selected endophytes SYM00011, SYM00016, SYM00057B, SYM00218, using conditions previously described. The seeds were subjected to the growth parameters as summarized below. After 4 days of growth, 12 whole seedlings (including roots, seeds and hypocotyls) per treatment were collected in a 50 mL falcon tube using sterile forceps and immediately snap-frozen in liquid nitrogen to minimize protein degradation and proteomic changes during sample collection (such as wound responses from using the forceps). The frozen samples were then homogenized using a pestle and mortar previously cooled in liquid nitrogen and transferred to a 15 mL falcon tube on dry ice. The homogenized samples were stored at −80° C. until further processing. Sample Preparation 1 mL of 5% SDS 1 mM DTT was added to 1 mL of homogenized tissue and the samples were boiled for 5 mins. The samples were cooled on ice and 2 mL of 8M urea solution was added. The samples were spun for 20 mins. at 14,000 rpm and the soluble phase recovered. A 25% volume of 100% TCA solution was added to the soluble phase, left on ice for 20 mins. and centrifuged for 10 mins. at 14,000 rpm. The protein pellet was washed twice with ice-cold acetone and solubilized in 125 μL 0.2M NaOH and neutralized with 125 μL of 1M Tris-Cl pH 8.0. Protein solutions were diluted in THE (50 mM Tris-Cl pH8.0, 100 mM NaCl, 1 mM EDTA) buffer. RapiGest SF reagent (Waters Corp., Milford, Mass.) was added to the mix to a final concentration of 0.1% and samples were boiled for 5 min. TCEP (Tris (2-carboxyethyl) phosphine) was added to 1 mM (final concentration) and the samples were incubated at 37° C. for 30 min. Subsequently, the samples were carboxymethylated with 0.5 mg/ml of iodoacetamide for 30 min at 37° C. followed by neutralization with 2 mM TCEP (final concentration). Proteins samples prepared as above were digested with trypsin (trypsin:protein ratio—1:50) overnight at 37° C. RapiGest was degraded and removed by treating the samples with 250 mM HCl at 37° C. for 1 h followed by centrifugation at 14,000 rpm for 30 min at 4° C. The soluble fraction was then added to a new tube and the peptides were extracted and desalted using Aspire RP30 desalting columns (Thermo Scientific). The trypsinized samples were labeled with isobaric tags (iTRAQ, ABSCIEX, Ross et al 2004), where each sample was labeled with a specific tag to its peptides. Mass Spectrometry Analysis Each set of experiments (samples 1 to 6; samples 7 and 8) was then pooled and fractionated using high pH reverse phase chromatography (HPRP-Xterra C18 reverse phase, 4.6 mm×10 mm 5 μm particle (Waters)). The chromatography conditions were as follows: the column was heated to 37° C. and a linear gradient from 5-35% B (Buffer A-20 mM ammonium formate pH10 aqueous, Buffer B-20 mM ammonium formate pH10 in 80% ACN-water) was applied for 80 min at 0.5 ml/min flow rate. A total of 30 fractions of 0.5 ml volume where collected for LC-MS/MS analysis. Each of these fractions was analyzed by high-pressure liquid chromatography (HPLC) coupled with tandem mass spectroscopy (LC-MS/MS) using nano-spray ionization. The nanospray ionization experiments were performed using a TripleTof 5600 hybrid mass spectrometer (AB SCIEX Concord, Ontario, Canada)) interfaced with nano-scale reversed-phase HPLC (Tempo, Applied Biosystems (Life Technologies), CA, USA) using a 10 cm-180 micron ID glass capillary packed with 5 μm C18 Zorbax™ beads (Agilent Technologies, Santa Clara, Calif.). Peptides were eluted from the C18 column into the mass spectrometer using a linear gradient (5-30%) of ACN (Acetonitrile) at a flow rate of 550 μl/min for 100 min. The buffers used to create the ACN gradient were: Buffer A (98% H2O, 2% ACN, 0.2% formic acid, and 0.005% TFA) and Buffer B (100% ACN, 0.2% formic acid, and 0.005% TFA). MS/MS data were acquired in a data-dependent manner in which the MS1 data was acquired for 250 ms at m/z of 400 to 1250 Da and the MS/MS data was acquired from m/z of 50 to 2,000 Da. For Independent data acquisition (IDA) parameters MS1-TOF 250 ms, followed by 50 MS2 events of 25 ms each. The IDA criteria, over 200 counts threshold, charge state +2-4 with 4 s exclusion. Finally, the collected data were analyzed using Protein Pilot 4.0 (AB SCIEX) for peptide identifications and quantification. Results: The proteomics analysis of wheat inoculated with endophytic bacteria (SYM11, SYM16B and SYM57B) grown under heat stress and maize inoculated with SYM57B grown under normal conditions revealed three major pathways augmented or otherwise modified within the plant bioreactor: growth promotion, resistance against oxidative stress and mechanisms involved in symbiosis enhancement (Table 17 and Table 18). Determining the levels of any of the proteins in Table 17 and Table 18 within a plant is another surrogate method of determining the presence of an endophyte. As shown in some of the earlier examples, plant traits and protein levels may be used as surrogate markers of the presence of endophytic microbes. In order to explore the possibility that hormone levels may also be used as surrogate markers of the presence of endophytic microbes within a plant bioreactor, a metabolomic analysis was performed of 12 phytohormones (indole-3-carboxylic acid, trans-zeatin, abscisic acid, phaseic acid, indole-3-acetic acid, indole-3-butyric acid, indole-3-acrylic acid, jasmonic acid, jasmonic acid methyl ester, dihydrophaseic acid, gibberellin A3, salicylic acid) in wheat and corn plants grown on water agar under normal condition and inoculated by SYM57B or a mix of selected endophytes (see below). The mixes of endophytes inoculums were obtained by mixing equal volume of the different bacterial cultures. 4-day old whole wheat and corn seedlings (including roots, seed and hypocotyl) were finely ground in liquid nitrogen by mortar and pestle then aliquoted into 1.5 mL microcentrifuge tubes and weighed. Phytohormones were extracted from ground sprouts using a protein precipitation protocol where cold extraction solvent (80% aqueous methanol with 1% acetic acid) containing internal standards was added to the finely ground plant material (400 μL solvent for every 100 mg ground plant tissue). Samples were kept on ice during the addition of extraction solvent. Samples were then vortexed for 60 min at medium-high speed at 4° C., then centrifuged for 15 min at 13,000 g at 4° C. The resultant supernatant was removed and analyzed by LC-MS/MS. LC-MS/MS Phytohormones were chromatographically separated using a Waters nanoAcquity UPLC system on a Waters Atlantis dC18 column (3 μM, 300 μM×150 mm) held at 40° C. Samples were held at 4° C. in the auto-sampler. Water (buffer A) and acetonitrile (buffer B), both with 0.1% formic acid, were used as buffers. The flow rate was 11.5 μL/min and injection volume 1 μL. Each sample was injected twice and hormone levels averaged. Phytohormones were analyzed by selected reaction monitoring (SRM) on a Waters Xevo TQ-S mass spectrometer in both negative and positive ion modes. The UPLC gradient was as follows: time (t)=0 min, 10% B; t=0.5 min, 10% B; t=5.5 min, 95% B; t=7.5 min, 95% B; t=8 min, 10% B. The column was equilibrated for three minutes before each injection. Results Several plant hormones, including indole-3-carboxylic acid, trans-zeatin, abscisic acid, phaseic acid and indole-3-acetic acid, can be assayed to determine the presence of an endophytes that has been inoculated into a plant bioreactor. In addition, inoculating multiple endophytes into a plant bioreactor can further modify the plant hormone profiling of inoculated plants. In particular, the level of abscisic acid and indole-3-carboxylic acid, the decarboxylated form of auxin, was augmented by 63% and 98% respectively in corn inoculated with the mixed endophytes. Planting and Setup of Populations of Bioreactors in a Field In addition to the assays described above, determining the phenotype of the plant bioreactor in the field may serve as additional surrogate assays for the presence of an endophyte. The field assay involved testing individual microbial strains and combinations of strains by treating and planting the seeds of a variety of plants (including, but not limited to maize, wheat, cotton, and barley), with one or two varieties or cultivars of each plant tested. The field assay was laid out as a randomized complete block design, with each combination microbial treatment and plant variety replicated six times in the assay. Field assays were conducted across various geographies including field sites in major producing regions of South Dakota, Nebraska, Saskatchewan and Austria, on both dry and irrigated land to test responses in both well-watered and drought-stressed conditions. Field assays may also be conducted in geographies with hotter growing seasons, where temperatures can reach up to 95° F. for five or more consecutive days, in order to assess responses under heat stress. Field assays may also be conducted in geographies prone to higher levels of microbial, nematode or insect pathogens in order to assess responses under pathogen stress Fertilizer and herbicides are applied according to soil test results and locally recommended practice. Fertilizer may be applied at 25%, 50% or 75% of recommended levels to assess responses under nutrient stress. For maize, typical field plots were 10′×′40′ with 4 evenly spaced rows, seeded at a rate of approximately 34,000 seeds per acre. Each randomized complete block trial included an untreated control and a mock-formulation control, as well as additional untreated border plots on the 40′ ends. For wheat, typical field plots were 5′×50′ with 7 evenly spaced rows, seeded at a rate of approximately 90 lbs per acre. Each randomized complete block trial included an untreated control and a mock-formulation control. Measurement of Biomass Biomass of field plots is assessed by selecting 10 plants per plot for maize or 20 plants per plot for wheat at random from the middle two rows at harvest, removing the plants from the soil and cleaning off any residual soil. Plants are then divided into aerial and root sections and weighed to obtain fresh weight. Plants are then dried in a vacuum oven overnight and weighed again to obtain dry weight. Measurement of Yield, Grain Moisture, Test Weight Yield of field plots is measured at the end of the growing season by harvesting the plots with an appropriate harvester. For maize, only the middle two rows are harvested. For wheat, all 7 rows may be harvested, or only the middle 5 may be used. Test weight and moisture of the grain may be recorded by the harvester, or subsamples of the harvested grain may be used for manual test weight assessment and moisture analysis in a DICKEY-John® grain moisture analyzer (Dickey-John Corp., Chatham, Ill.), using parameters recommended by the manufacturer. Measurement of Emergence & Plant Height Emergence in the field plots was assessed for wheat by counting the number of emerged plants in the middle 10′ section of the middle two rows and reporting the total number plants emerged. Emergence counts were done every four days starting with the day of emergence of the first plants and ending when 50% or more of the plants in the plot had reached Feekes scale 2. Emergence in the field was assessed for maize by doing a full count of all emerged plants in the plot and reporting the number of emerged plants as a percentage of the number of seeds planted in that plot. Two emergence counts were done, one at the emergence of the first plants and a second count five days later. Emergence of wheat in a field trial on four different days is shown in the top panel of Emergence of corn in a field trial is shown in the middle panel of Measurement of Flowering Time The day of flowering for a particular plot is recorded when 50% or more of the plants in the plot have reached the flowering stage. SPAD Measurement Chlorophyll values, for example, SPAD readings are conducted on wheat by measuring 10 plants per plot at random from the middle two rows. The first measurement is done at flowering, with a second measurement done two weeks later on the same 10 plants in each plot. The SPAD reading is taken on the flag leaf on each plant, for example, as measured with SPAD502 supplied by Minolta Co., Ltd., at approximately three quarters of the leaf length from the leaf base and avoiding the midrib of the leaf. SPAD readings are conducted on maize by measuring 10 plants per plot at random from the middle two rows. The first measurement is done at flowering (VT stage), with a second measurement done two weeks later on the same 10 plants in each plot. The SPAD reading is taken on the topmost leaf under the tassel, approximately 0.5 inch from the edge of the leaf and three quarters of the leaf length from the leaf base. Stand Count & Lodging Assessment Stand count and percent lodging are assessed in wheat by counting the total number of tillers and the number of broken stalks in the middle two rows on the day of harvest. Stand count and percent lodging are assessed in maize by counting the number of standing plants and the number of stalks broken below the ear in the middle two rows on the day of harvest. All of the previous examples showed the possibility of introducing an endophyte into a plant bioreactor by coating the seed of the plant. The following examples look at the possibility of introducing the endophyte by spraying the flower of a plant to obtain internal seed colonization, also called an endoseed. Similarly to plant bioreactors creased by seed treatment, the presence of the endophyte in an endoseed can be determined by looking at the changes in the plant phenotype. The concept of internal seed colonization with microorganisms according to the present invention was tested with the endophytic bacterium This experiment shows that seeds having microorganisms (especially bacteria) inside them can be produced, and the presence of the endophyte can be determined by assessing changes in plant biomass over controls. A variant of the bacterium Growth of PsJN Strain as Bacterial Inoculum The bacterial strain was grown by loop-inoculating one single colony in LB broth amended with spectinomycin (100 μg mL−1) in 100 mL flasks. The bacterial culture was incubated at 28° C. for 2 days at 180 rpm in a shaking incubator. The bacterial inoculum was applied in two different ways i.e., seed soaking and spraying inoculum at flowering stage. Maize seeds were surface sterilized by dipping for 5 and 3 min in 70% ethanol and NaOCl following 3 washings with sterilized water. There were three treatments, 1) seed inoculation 2) specific spraying of flowers and 3) seed inoculation combined with flower inoculation. Plants grown from seeds treated with sterile culture broth only served as control. For inoculation, seeds of two maize cultivars were dipped for 3-4 hours in bacterial inoculum (108-109CFU mL−1). Likewise, bacterial inoculum was specifically sprayed to the female flower when the crop reached flowering stage. Seeds were sown in plastic trays filled with soil and 12 day-old seedlings were transferred into 50 kg soil container (2 plants in each container) under wirehouse conditions. Endophytic Colonization by PsJN Strain (Particularly Grain Colonization) The rhizosphere and endophytic colonization of root, stem and leaves by the gusA-labeled variant of Follow-up experiments were performed in the 2ndyear to evaluate the (1) viability, activation and colonization ability of strain PsJN colonizing maize seeds; (2) effect of strain PsJN colonized seed on germination and seedling vigor compared to untreated control (plastic tray assay); and (3) effect of strain PsJN colonized seed on plant biomass compared to untreated control (pot trials). Prior to the plant experiments, PsJN colonized seeds of both cultivars were tested to see whether PsJN cells are present and viable inside. For this purpose, 20 seeds were imbibed in saline buffer for 2-3 days and subsequently crushed in 0.9% saline buffer, shaken for 45 second with a pulsifier and spread in dilutions on LB plates amended with X-glcA, IPTG and spectinomycin. Bacterial inoculum was prepared as described above and three experiments were performed with four treatments i.e., control, seed inoculation with strain PsJN (exogenously), PsJN colonized seeds (produced in 1styear by spraying), PsJN colonized seed+inoculation. Seeds (45) were surface sterilized and inoculated as described earlier, and were sown in a plastic tray (30 cm diameter) with three replicates. Data on time to start germination, mean germination time, time to 50% and final germination, germination index and energy, coefficient of uniform germination, and skewness were recorded of PsJN colonized over control. Two pot experiments were performed to evaluate the performance of PsJN colonized seeds concerning plant biomass production as compared to control. Surface sterilized seeds were directly sown in pots with soil (first pot trial) or alternatively sown in plastic trays, and after 10 days seedlings were transferred to 5 kg pots (2ndpot trial). All plants were harvested after 60 days and data of plant height, number of leaves per plant and root-shoot biomass were recorded. The data were subjected to analyses of variance using SPSS software package version 19 (SPSS Ink, Chicago, Ill.). The ability of strain PsJN to colonize maize cobs (cob sheath, cob interior and grains) was analyzed in plants treated by specific flower inoculation (by spraying) only or by seed inoculation ( PsJN colonized seeds, recovered from the first year experiment were tested to see whether PsJN cells survive inside dormant seed and have the ability to colonize the plants emerging from the seeds. This is very important as it would enable the storage of endophytes within seeds for several months. 102viable cells were detected in two months old dormant seeds ( The data summarized in Table 19 and Table 22 revealed that PsJN colonized seeds showed significant improved germination ability. PsJN colonized seeds of both cultivars started to germinate 36-48 hours earlier than the control. PsJN colonized seed showed almost 100% final germination and required less mean germination time as compared to the control seeds. Consequently, the colonized seeds have better germination index as compared to control, indicating the utility of the germination assay as a surrogate assay for determining the presence of the endophyte within the bioreactor plant. Moreover PsJN colonized seeds of both cultivars showed significantly higher maize seedling biomass as compared to untreated control seeds (Tables 20 and 23; The data of the pot trials (Table 21 and Table 24) revealed that PsJN colonized maize seeds had a positive effect on plant biomass production comparable to seeds externally coated with PsJN cells with cv Morignon being more responsive than cv Peso in both treatments (Table 21 and Table 24). The PsJN colonized seeds showed 38% increase in plant biomass production and a significant increase in root biomass as compared to the control. Moreover, the number of leaves per plant was higher in plants of PsJN colonized seed as compared to the control. Seeds of wheat ( Endophytic Colonization of Wheat and Barley Seeds Plants were harvested at ripening stage and seeds were collected. Seed colonization by the inoculant stains was determined by GUS-staining Therefore, seeds were cut in two pieces and incubated in GUS-staining solution (1 mM EDTA, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 100 mM sodium phosphate, pH 7.0, 1% Triton-X-100, 0.1 mg/mL X-Gluc predissolved in 5 μL/mg N,N-dimethylformamide, 0.1% IPTG) directly after harvesting at 37° C. for 20 hours. Afterwards, samples were rinsed with 70% ethanol. The ethanol was then discarded and samples were fixed in paraformaldehyde solution (4% paraformaldehyde dissolved in PBS at 60° C. with constant stirring until clarifying of the solution) overnight at 4° C. Finally, the fixed samples were rinsed 3 times in PBS and stored in the last rinse at 4° C. until further processing. In parallel, seeds were manually crushed under sterile conditions and used for bacterial community DNA isolation employing standard procedures. The presence of the inoculant strains was confirmed by sequence analysis of the 16S-23S rRNA intergenic spacer region (IGS) of single clones and subsequent comparison with those from the inoculants strains. Both seeds of wheat and barley were found to be internally colonized by the inoculants strains. Sequence analysis of the IGS-region confirmed the presence of The colonization behavior of The ability of PsJN to survive in the seed and proliferate with the emerging seedling was studied in a subsequent germination experiment. The harvested seeds from the previously treated plants were sown and grown for a certain period. Afterwards the seedlings were examined regarding their presence of PsJN by GUS-staining and quantitative PCR of PsJN-specific genes. The bacterial strains were grown by loop-inoculating one single colony in LB broth containing 0.1% of the antibiotic spectinomycin in case of Specific inoculation of tomato and pepper flowers was conducted when the plants reached growth stage 61-63 on the BBCH scale (for tomato: first inflorescence: first flower open—third inflorescence: first flower open; for pepper: first flower open—third flower open) (Feller et al., 2001). The bacterial inoculants and the buffer only for control were added to a 50 mL glass pump spray bottle previously sterilized with 70% ethanol. The plants to be inoculated were spatially separated from the others to avoid contamination by drift. One single flower or 2 to 3 immediately adjacent flowers were sprayed with 675 μL of the inoculum. A filter paper was used to shield the surrounding plant parts such as leaves and stem from drift and take up surplus inoculum to avoid dripping on the soil. The treated inflorescences/flowers were marked with a twist tie to enable later identification ( Six replicates of the inoculated plants were analyzed at 3 different developmental stages. Pepper samples were taken 3 days and 15 days after spraying as well as at full ripeness. The plant material (buds, flowers, fertilized flowers, developing fruits, immature fruits, ripe fruits and seeds) was cut with a sterile scalpel and subsequently incubated in GUS-staining solution (1 mM EDTA, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 100 mM sodium phosphate, pH 7.0, 1% Triton-X-100, 0.1 mg/mL X-Gluc predissolved in 5 μL/mg N,N-dimethylformamide, 0.1% IPTG) directly after harvesting at 37° C. for 20 hours. Afterwards, destaining was done by rinsing the samples with 70% ethanol. The ethanol was then discarded and the samples fixed in paraformaldehyde solution (4% paraformaldehyde dissolved in PBS at 60° C. with constant stirring until clarifying of the solution) overnight at 4° C. Finally, the fixed samples were rinsed 3 times in PBS and stored in the last rinse at 4° C. until further processing. Material of plants inoculated with PsJN wild-type and control samples were immediately after harvest frozen in liquid nitrogen and transferred for storage at −80° C. Afterwards, DNA was isolated using standard procedures and used as described above for Example 13. Upon flower spraying DNA was extracted from pepper plant material, which had been obtained at various time-points after inoculation with PsJN wild type and control inoculants or stored at −80° C. Pepper plant material was spooled in mortars separated by treatments and finely ground while constantly replenishing liquid nitrogen in order to avoid thawing. Approximately 100 mg of the pulverized samples were transferred to three 2 mL plastic tubes (free of detectable DNase, RNase and human DNA, by Greiner Bio One, Frickenhausen, Germany) and stored on liquid nitrogen until further treatment. The same was done with 6 replicate seedlings having emerged from seeds obtained from the parental generation inoculated with PsJN wild type and control. 15 seeds from the pooled replicates, which had been stored for 2 months were put in a 2 mL Eppendorf tube containing a metal ball and homogenized by help of a ball mill (Ball Mill MM31 by Retsch, Haan, Germany) at 30 Hz for 90 seconds. DNA was extracted using the CTAB method essentially as described by Stralis-Pavese, Nancy, et al., For absolute quantification of PsJN DNA in pepper samples, a TaqMan-PCR assay was performed. A primer set (2615) specific for Additionally, a specific probe labeled with FAM-5′ and 3′-BHQ had been developed previously, which bound to the inner part of the amplicon at a distance of 59 nucleotides from the forward primer. The sequence of this probe was TTGTCGACTTTCGTTTCACC (5′→3′) (SEQ ID 1220). For a final volume of 204, (including 1 μL template) for each reaction tube, a master mix was prepared as follows: 10 μL SsoFast Probes Supermix (2× solution, by Bio-Rad) 1 μL forward primer [100 μM] 1 μL reverse primer [100 μM] 1 μL probe [50 μM] 6 μL Milli-Q H2O 19 μL of the previously prepared master mix were pipetted into the wells of a 96-well PCR plate and 1 μL of the respective sample was added. The well plate was then tightly sealed with self-adhesive film and the reaction mix spun down in a centrifuge at 4° C. for 20 seconds (2000 rpm). The qPCR was run on a Bio-Rad real-time detection system CFX96 (Bio-Rad, Hercules, Calif., USA) at the following settings: Hot start at 95° C. for 2 minutes, 69 cycle denaturation at 95° C. for 5 seconds and hybridization and elongation for 20 seconds. Additionally, for absolute quantification of DNA in the pepper samples, a calibration curve was generated from the real-time qPCR results of 3 respective replicates of a 10-fold serial dilution of purified DNA (344.2 ng/μL) extracted from The results of qPCR analysis show that 3 days after the treatment ( Gel analysis showed a clear band at the expected fragment size of 84 bp in samples treated with the PsJN wild type inoculum in all stages examined. The fragment was absent in control samples, PsJN inoculated seed samples and in the negative control. The intensity of the band was consistent with the quantification of PsJN in the sample by qPCR: Samples harvested 3 days p.i. showed the highest intensity, which declined with an increasing time interval after inoculation. However, the signal appearing in qPCR may not have derived from the amplified 84 bp fragment alone. A second band of lower fragment size appears on the gel in all samples including the negative control (therefore likely primer-dimers). Concerning analysis of seed samples, which had been separated from the ripe fruits, PsJN could not be detected by qPCR due to the extreme sensitivity of this method to disturbance by impurities. It was presumably the large amount of starch stored in the seed, which impeded the PCR reaction. Purification of the extracted DNA came at the expense of DNA quantity which could not sufficiently be counteracted by re-precipitation and concentration. Therefore, DNA extracted from seedlings was amplified instead. In this case, an extremely low signal could be obtained for two of the three replicates by PCR and gel analysis ( Following the recommendations of Moter and Gael (2000), Journal of Microbiological Methods 41: 85-112, probes were designed targeting the 16S rRNA and 23S rRNA of Yellow fluorescent bacteria PsJN were found inside the embryo along with a very large amount of other unknown bacteria (green fluorescent), which also colonized the seed coat ( During the sample harvesting of the fully ripe fruits, seed material for a subsequent germination experiment was gathered. In the case of tomato, seeds were collected in a fine sieve and rinsed with tap water while gently rubbing off the mucilaginous seed coat containing germination inhibiting substances. Seeds were stored for drying at room temperature (in the dark) in Petri dishes containing a filter paper to remove residual moisture. 3-4 weeks later, the seed material was transferred to 4° C. for cool treatment to break seed dormancy for germination. The germination assay was carried out with seeds of tomato cv. Micro Tom 3 weeks after harvesting and a 24 hour period at 4° C. and with seeds of pepper 7 weeks after harvesting and a 3 week period at 4° C. In both cases, seeds were surface sterilized prior to spreading them on the growth substrate. For this, seeds of all 6 replicates of the different treatments (PsJN wild type, PsJN::gusA110, control) were pooled put in a sieve and soaked in 70% ethanol for 1 minute followed by a bath in 3.5% NaClO for 15 minutes. Afterwards, they were rinsed 6 times with dH2O. Subsequently, 25 seeds were distributed evenly on 140 mm Petri dishes containing water agar (1%, previously autoclaved). 2-3 mL dH2O were added to ensure proper imbibition of seeds. The Petri dishes were incubated at 27° C. in the dark. Seedlings were incubated in GUS-staining solution (1 mM EDTA, 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 100 mM sodium phosphate, pH 7.0, 1% Triton-X-100, 0.1 mg/mL X-Gluc predissolved in 54/mg N,N-dimethylformamide, 0.1% IPTG) directly after harvesting at 37° C. for 20 hours. Samples were then destained by rinsing the samples with 70% ethanol, discarded, and the samples fixed in paraformaldehyde solution (4% paraformaldehyde dissolved in PBS at 60° C. with constant stirring until clarifying of the solution) overnight at 4° C. Finally, the fixed samples were rinsed 3 times in PBS and stored in the last rinse at 4° C. until further processing. GUS-activity in pepper seedlings obtained from this germination experiment was below detection limit by optical examination without additional equipment. When observed under a confocal microscope (FluoView FV1000 by Olympus, Tokio, Japan) at brightfield settings, few blue cells were observed and ranged from 10-25 per seedling, mostly located in the stem. Where an empty seed coat was still attached to the seedling and was also subjected to GUS-staining, the coat was found to stain slightly blue. This observation concerned the control seedlings as well as the ones obtained from parent plants inoculated with PsJN::gusA110. However, a meaningful quantification of GUS-activity occurring in the seed coat is not possible due to the fact that it was only in few cases still attached to the seedling. It is not unlikely though, that other endophytic bacteria not yet characterized may be present in our pepper plants and lead to the appearance of a blue background in control samples ( As in the case of pepper, GUS-staining of tomato seedlings was hard to detect with the naked eye except in empty seed coats of both control and PsJN::gusA110 treatment. However, in one seedling of the treated parental generation, a transition of the GUS-activity from the seed shell to the tips of the cotyledons could be observed ( During the sample harvesting of the fully ripe fruits, seed material for a subsequent germination experiment was gathered. In the case of tomato, seeds were collected in a fine sieve and rinsed with tap water while gently rubbing off the mucilaginous seed coat containing germination inhibiting substances. Seeds were stored for drying at room temperature (in the dark) in Petri dishes containing a filter paper to remove residual moisture. 3-4 weeks later, the seed material was transferred to 4° C. for cool treatment to break seed dormancy for germination. The germination assay was carried out with seeds of tomato cv. Micro Tom 3 weeks after harvesting and a 24 hour period at 4° C. and with seeds of pepper 7 weeks after harvesting and a 3 week period at 4° C. In both cases, seeds were surface sterilized prior to spreading them on the growth substrate. For this, seeds of all 6 replicates of the different treatments (PsJN wild type, PsJN::gusA110, control) were pooled put in a sieve and soaked in 70% ethanol for 1 minute followed by a bath in 3.5% NaClO for 15 minutes. Afterwards, they were rinsed 6 times with dH2O. Subsequently, 25 pepper and tomato seeds were distributed evenly on 140 mm Petri dishes containing water agar (1%, previously autoclaved). 2-3 mL dH2O were added to ensure proper imbibition of seeds. The Petri dishes were incubated at 27° C. in the dark. Additionally, 25 surface-sterilized seeds of pepper were spread on seed trays containing potting soil (Compo Sana Anzucht-und Kräutererde), slightly covered with potting soil, irrigated, covered with a plastic sheet and left for germination at 26° C. day temperature/22° C. night temperature in the greenhouse. This growth environment was not tested with seeds of tomato cv. Micro Tom due to a lack of seed material available. In the growth chamber as well as in the greenhouse, the germination process was constantly monitored and documented until no further germination could be observed for 3 subsequent days. Pepper seeds showed a similar behavior on both water agar and potting soil as a growth medium. On water agar, initial germination was observed on the 7th day after sowing and on potting soil on the 8th day. Germination of all batches was completed after 23 days on water agar, while it took only 20 days to reach the maximum germination rate in all batches on potting soil. The control seeds and the PsJN::gusA110 inoculated seeds started to germinate on both media roughly equally in time and showed overall a parallel development. PsJN::gusA110 inoculated seeds performed somewhat better under either growth conditions than the control, which was exemplified by their earlier germination when sown on water agar in comparison to the control. However the two treatments were found to meet again on the maximum level of 92% germination. On potting soil, the better performance became manifest in the constantly steep germination rate of the PsJN::gusA110 inoculated seeds until reaching the maximum, whereas the control appeared to suffer from a slight lag phase prior to reaching the same maximal value (84% of seeds germinated) as the PsJN::gusA110 inoculated seeds. The seeds obtained from parent plants inoculated with the PsJN wild type strain however showed a significant delay in their germination behavior on both growing media. While these observations strongly demonstrate that the inoculation of flowers lead to incorporation of PsJN wild type into the seed, the actual effect on the seeds is obviously not the desired one. However, despite the fact that the growth-promoting effect of Due to low abundance of seed material, the germination experiment with tomato was only conducted on water agar plates ( To understand whether the endophyte introduced inside of barley and wheat seeds by the flower-spray method described above can be detected, DNA was extracted from the seed and was used to amplify 16s rDNA by PCR. Amplicons were cloned and sequenced. Barley and wheat seeds obtained from Example 13, in which flowers of these plants were inoculated with strains Surface-disinfected seeds were cut in pieces and crushed using a sterile mortar. The seed material was transferred to Matrix E (MPbio DNA isolation kit from soil) homogenized by 30 sec beat beating using in a bead beater (FastPrep FP 120, Bio101, Savant Instruments, Inc., Holbrook, N.Y.). DNA was extracted with the MPbio DNA isolation kit from soil (MP Biomedicals, Solon, Ohio, USA) according to protocol provided by the manufacturer. A single seed was used for DNA isolation. Amplifications were performed with a thermocycler (PTC-100™, MJ Research, Inc.) the primers pHr (5′-TGCGGCTGGATCACCTCCTT-3′; SEQ ID 1225)(Massol-Deya et al. 1995) and P23SR01 (5′-GGCTGCTTCTAAGCCAAC-3′; SEQ ID 1226) (Massol-Deya et al. 1995). PCR-reactions (50 μl total volume) contained 10-30 ng of DNA, 1×PCR reaction buffer (Invitrogen), 1.5 mM MgCl2, 0.2 μM of each primer, 0.2 mM of each deoxynucleoside triphosphate, and 2.5 U Taq DNA polymerase (LifeTech, Vienna, Austria). PCR amplifications were performed with an initial denaturation step for 5 minutes at 95° C., 30 cycles consisting of denaturation for 30 sec at 95° C., primer annealing for 30 sec at 53° C., polymerization for 1 min at 72° C., and completed by a final extension for 10 min at 72° C. PCR products (5 μl) were checked by electrophoresis in 0.8% (w/v) agarose gels (Biozym Biotech Trading, Vienna, Austria). PCR products were purified by using a QIAquick™ PCR Purification kit (QIAGEN GmbH, Hilden, Germany). DNA fragments were ligated into the vector pSC-A-amp/kan (Strata Clone PCR Cloning Kit, Stratagene, Agilent Technologies, Santa Clara, Calif., USA) and the ligation products were transformed into competent Clones were sequenced with the primer M13r making use of the sequencing service of LGC Genomics AGOWA (Berlin, Germany). Retrieved sequences were visualized and vector sequences were removed with sequence alignment editor package of BioEdit (Ibis Biosciences, Carlsbad, Calif., USA). Sequences within a library were dereplicated and grouped using FastGroupll (http://fastgroup.sdsu.edu/fg_tools.htm). For identification representative sequences of each group were subjected to the Basic Local Alignment Search Tool (BLAST) analysis with the National Center for Biotechnology Information (NCBI) database (blast.ncbi.nlm.nih.gov/Blast.cgi). Wheat and Barley Sequence analysis of the IGS-region confirmed the presence of The concept of internal seed colonization with microorganisms tested with the endophytic bacterium The present invention provides seeds having microorganisms located internally in the seed compartment. Strain PsJN was used as a test strain to test flower inoculation into seeds in a winter wheat cultivar (Pannonikus). Two sets of experiments are designed to: (A) evaluate strain PsJN colonization potential in different tissues of winter wheat plants (particularly grains); and (B) follow-up evaluation of germination, biomass production and yield assays. Growth of PsJN Strain as Bacterial Inoculum The bacterial strain was grown by loop-inoculating one single colony in LB broth amended with spectinomycin (100 μg mL−1) in 100 mL flasks. The bacterial culture was incubated at 28° C. for 2 days at 180 rpm in a shaking incubator. The bacterial inoculum was applied by spraying inoculum at flowering stage using a standard pressure sprayer (max. volume 3.6 L; 0.98 L/min/3 bar), as shown in Endophytic Colonization by PsJN Strain (Particularly Grain Colonization) Prior to the plant experiments, seeds of inoculated flowers as well as control seeds were tested to see whether PsJN cells are present. For this purpose, 24 seeds were surface-sterilized with 70% ethanol (3 min), treated with 5% NaOHCl for 5 min, and followed by washing 3 times with sterile distilled water (1 min each time). The efficacy of surface sterilization was checked by plating seed, and aliquots of the final rinse onto LB plates. Samples were considered to be successfully sterilized when no colonies were observed on the LB plates after inoculation for 3 days at 28° C. Surface-disinfected seeds were cut in pieces and crushed using a sterile mortar. The seed material was transferred to Matrix E (MPbio DNA isolation kit from soil) homogenized by 30 sec beat beating using in a bead beater (FastPrep FP 120, Bio101, Savant Instruments, Inc., Holbrook, N.Y.). DNA was extracted with the MPbio DNA isolation kit from soil (MP Biomedicals, Solon, Ohio, USA) according to protocol provided by the manufacturer. A single seed was used for DNA isolation. For each seed, the IGS region of PsJN was amplified using the pHr primer (Massol-Deya et al. 1995) and one of twenty-four different variants of the IGS forward (P23SR01) primer (Massol-Deya et al. 1995) (IGSFw Ti to T24) containing a 10 bp long overhang (barcode) on the 5′ end. PCR amplifications were performed with a thermocycler (PTC-100™, MJ Research, Inc.) using an initial denaturation step of 5 min at 95° C. followed by 30 cycles of 30 s at 95° C., 1 min annealing at 52° C. and 2 min extension at 72° C. PCR reaction mixtures (50 μl) contained 1× reaction buffer (Gibco, BRL), 200 μM each dATP, dCTP, dGTP and dTTP, 2 mM MgCl2 and 2.5 U Taq DNA polymerase (Gibco, BRL), 0.2 μM each of the primers and 1 μl extracted DNA. PCR products were pooled and purified by using a QIAquick™ PCR Purification kit (QIAGEN GmbH, Hilden, Germany). DNA fragments were ligated into the vector pSC-A-amp/kan (Strata Clone PCR Cloning Kit, Stratagene, Agilent Technologies, Santa Clara, Calif., USA) and the ligation products were transformed into competent Germination and Yield Seeds were planted on Oct. 23, 2013 at a field near Raasdorf in Lower Austria, Austria. The layout as well as planting and trial management is standard procedure for such assays and conducted exactly in the same manner as e.g., as seed companies do to test new genetics and as the Official Registration Authorities do in crop registration trials (See The ability of strain PsJN to colonize winter wheat seeds was analyzed in plants treated by specific flower inoculation (by spraying), as compared to untreated seeds. Inoculation of flowers resulted in internal colonization of seeds. IGS region-PCR cloning and sequencing resulted in about 90 sequences matching the quality criteria for subsequent analysis each for seeds of PsJN-treated and non-treated plants. After removing chimeric and wheat plastid sequences the PsJN-endoseed library sequences grouped in a total number of 54 sequence groups and 59 groups in case of control seeds. IGS sequences of the PsJN-endoseed library could be assigned to seven different bacterial species with the majority of sequences showed highest homology to The primer tags used for barcoding of single seeds were not evenly distributed within the library of sequences. Out of 24 tags used 16 tags were found again, meaning that we had sequences of 16 individual seeds in the sequence library. The sequences were clustered due to the barcode and within four sequence clusters we found the IGS of Effect of PsJN on Germination of Winter Wheat As described in Table 25, treatment V1 (PsJN inside of the seed) increased the percentage germination average within all three replicates repeats by 10% and 4% when compared to seeds coming from controls V2 and V3, respectively. In both summer wheat cultivars sprayed with PsJN we found that PsJN-endoseed (V1) yielded 7.5% over the control variety (V3), which was original seed (Z1 seed) of the same variety Pannonikus (Table 26). On the other hand, seed not treated with PsJN but derived from the same field (V2) as PsJN treated seed, yielded below the PsJN treated seed, still higher than the Z1 control. We conclude that yield measurements, as well as data on general agronomics, such as germination and plant height, can be used as surrogates for the presence of endophytes introduced by the endoseed method, just as with endophytes introduced by seed treatment as above. In this example, we describe the production of summer wheat ( Summer wheat and barley endoseed production was as follows: 10 by 1.3 m plots were planted on Mar. 13, 2014 with summer wheat (Trappe and Kronjet cultivars) at a density of 180 kg/ha and barley (Calculae and Eunova) at a density of 150 kg/ha in a field located in Tulln, Austria. Plants got sprayed with herbicide once (Apr. 23, 2014; 1.25 l/ha Andiamo Maxx) and fertilized twice on Apr. 3, 2014. NPK-Fertilzer 16:6:18+5S was applied at a concentration of 300 kg/ha and on May, 9, 2014 N-Fertilzer 27% was applied at a concentration of 220 kg/ha. At flowering time, each plot was sprayed twice (wheat: Jun. 4 and Jun. 12, 2014; barley: June 2 and June 10) with one of the treatments as indicated in Table 27. The bacterial inoculant used for spraying summer wheat and barley was prepared as follows: endophytes were streaked on large (diameter: 14.5 cm) 20% TSA (Tryptic Soy Agar) plates, grown at 28° C. for 2 days, scraped from the plates and resuspended in 2 L of 1×PBS supplemented with 20 g zeolite (used as a carrier) and 2004 Silwet L-77 (used as a surfactant) (final OD600 of about 0.1). Suspensions were filled into spraying bottles and each plot was sprayed with 1 L of the corresponding treatment. For the simultaneous application of PsJN and S10 1 L bacterial suspension each was prepared as described above and mixed carefully before adding zeolite and the surfactant. Negative control plots were sprayed with 1×PBS containing zeolite and Silwet. Only 10 whole spikes per plot were harvested for further colonization analysis. Remaining plants were harvested, threshed and stored. Winter wheat PsJN endoseed production was as follows: two 10 m2plots were planted with winter wheat (Pannonikus cultivar) seeds at a density of 180 kg/ha in a field located in Tulln, Austria. One plot was sprayed with The bacterial inoculant used for spraying winter barley was prepared as follows: 10 mL of 10% TSB (Tryptic Soy Broth) were inoculated with a single colony of Both plots were harvested manually yielding about 10 kg each. The ears were threshed with a standard lab threshing. 10 ears per treatment were kept intact for the analysis of variations on single ears. Soy endoseed production was as follows: eighty soy seeds of each variety (Merlin and Essor cultivars) were sown into a mixture of Einheitserde special—Topfsubstrat ED 63 and perlite in a proportion of 5:3 in a greenhouse chamber at the AIT in Tulln, Austria. Ten days after sowing 55 seedlings each were individually potted into 1 L (12×12×12 cm) pots containing substrate as described above. Plants were watered automatically twice a week by flooding for 10 min. Plants were fertilized once with 3% “Wuxal Super”. At flowering time, each pot was sprayed three times (30, 35 and 39 days after sowing) with one of the treatments as indicated in Table 28. Each treatment was applied on ten plants per cultivar. The bacterial inoculant used for spraying soy was prepared as follows: 5 ml trypic soy broth (10%) were inoculated with single colonies of endophytes and incubated overnight at 28° C. in a rotary shaker. 5 overnight cultures per endophyte were pooled and cells harvested by centrifugation at 4,700 rpm and room temperature. The supernatant was discarded and the pellet resuspended in 1×PBS buffer to a final OD 0.2 (about 25 ml). Suspensions were filled into 50 ml-nebulizers and used to spray 20 plants. Endophytic Colonization by PsJN Strain (Particularly Grain Colonization) Quantification of PsJN in endoseeds from summer wheat, winter wheat, barley and soy was determined with qPCR. Seeds were surface-sterilized by soaking the seeds in 70% ethanol for 3 min followed by 5% sodium hypochloride for 5 min, and washed three times with sterile distilled water (1 min for each wash). Seeds and aliquots of the final wash were plated on LB plates to verify the efficiency of surface sterilization. Seeds were considered to be successfully sterilized when no colonies were observed on the LB plates after inoculation for 3 days at 28° C. Single surface-sterilized seeds were aseptically peeled using a scalpel, cut in pieces and crushed using a sterile mortar. Seed material was homogenized for 30 s in lysing matrix E (MPbio DNA isolation kit from soil) using in a bead beater (FastPrep FP 120, Bio101, Savant Instruments, Inc., Holbrook, N.Y.). DNA was then extracted with the MPbio DNA isolation kit from soil (MP Biomedicals, Solon, Ohio, USA) according to protocol provided by the manufacturer. For quantification of For qPCR standard preparation, chromosomal DNA of Detection of PsJN in Soy Plant Tissue (Seeds) Using DOPE-FISH For microscopy analysis, plant samples were used and cut in small parts (0.5-cm long sections). Samples were then fixed overnight at 4° C. in a paraformaldehyde solution (4% in PBS pH 7.2), and rinsed twice in PBS. Treatment with a lysozyme solution (1 mg mL−1in PBS) was then applied to the samples for 10 min at 37° C. before being dehydrated in an ethanol series (25, 50, 75 and 99.9%; 15 min each step). Fluorescence in situ hybridization using double labeling of oligonucleotide probes (DOPE-FISH) was carried out using probes from Eurofins (Germany) labeled at both the 5′ and 3′ positions. An EUBmix (equivalent mixture of EUB338, EUB338II, EUB338III) coupled with a ATTO488 fluorochrome (Amann et al. (1990), Nature reviews microbiology 6: 339-348; Daims et al. (1999), The results summarized in Tables 29 and 30 show that In both summer wheat cultivars sprayed with PsJN we found the strain to be effectively introduced into the seeds—21 (Trappe) or 22 (Kronjet) out of 24 seeds, respectively were tested positive in PsJN specific qPCR assays (up to 92% of wheat seeds were colonized by PsJN upon spraying of parent flowers). The PsJN cell number per seed varied strongly and reached up to 28000 in selected samples (cv. Kronjet). Simultaneous application of PsJN was not found in seeds of barley plants sprayed with the strain. However, we found PsJN in the respective negative controls. Two out of 24 seeds of both barley cultivars tested contained PsJN. In this context, it needs to be explained that summer wheat and barley endoseeds were produced in one field. When the plants were sprayed (twice during flowering) the weather conditions were extremely windy and the spray solutions were distributed across the plots. Taking this into account cross contaminations were to be expected. The cell number in the PsJN-colonized cells of the negative control however was relatively low ranging between 120 and 190 cells per seed. To exclude the possibility that PsJN is naturally occurring in wheat and barley seeds used to produce endoseeds in the field original seeds/seeds of the parental generation were tested with the PsJN-specific qPCR. No signal was found in any of the tested seed samples. Winter wheat (cv. Pannonikus) endoseeds were produced in a field. PsJN was not detected in the seeds derived from the not treated field plot or the original seeds bought from the producer but two out of 24 (8%) seeds of sprayed plants gave a positive signal in PsJN specific qPCR. In the case of soy the endoseed production was done in the greenhouse and no cross-contamination during spray application of Detection of PsJN in Soy Plant Tissues (Seeds) Using FISH Yellow fluorescent bacteria PsJN were found inside the embryo of soy PsJN-endoseed along with a very large amount of other unknown bacteria (green fluorescence), which also colonized the seed coat ( To determine the presence and abundance of the endophyte with which endoseed was prepared, DNA was extracted from the endoseed and was used to amplify 16S rDNA using the following method. Endoseeds were prepared as in Example 17. 16S rDNA amplicon sequencing (MiSeq, Illumina) was performed on the following samples: 1. summer wheat Trappe control, 2. summer wheat Trappe PsJN, 3. summer wheat Trappe PsJN+S10, 4. summer wheat Trappe S10, 5. summer wheat Trappe TC38, 6. summer wheat Trappe AB, 7. summer wheat Kronjet control, 8. summer wheat Kronjet PsJN, 9. summer wheat Kronjet PsJN+S10, 10. summer wheat Kronjet S10, 11. summer wheat Kronjet TC38, 12. summer wheat Kronjet AB, 13. barley Calcule control, 14. barley Calcule PsJN, 15. barley Calcule PsJN+S10, 16. barley Calcule S10, 17. barley Calcule TC38, 18. barley Calcule AB, 19. barley Eunova control, 20. barley Eunova PsJN, 21. barley Eunova PsJN+S10, 22. barley Eunova S10, 23. barley EunovaTC38, 24. barley Eunova AB. Genomic DNA was isolated based on FastDNA® SPIN Kit for soil as described above and all gDNA were adjusted to 5 ng/μl. A nested PCR approach was used to amplify bacterial 16S rDNA from DNA isolated of wheat and barley seeds. The first amplification was performed with primers 799for and 1392rev (Chelius and Triplett, 2001) with standard reaction parameters. Twenty-five μl of the 16S rDNA PCR amplicons were subjected to electrophoresis (100V for 1 h) in 2% (w/v) TBE agarose gels (Biozym Biotech Trading, Vienna, Austria). Amplification with the primer pair 799F and 1392R allows exclusion of the amplification of chloroplast 16S rDNA and results in co-amplification of bacterial and mitochondrial ribosomal genes with the mitochondrial amplicon being about 1000 bp long whereas the bacterial band is about 600 bp. The band of interest containing the PCR-product of bacterial 16S rDNA was excised. The gel pieces were put in a filter tip that was placed in a fresh tube and DNA was collected by centrifugation for 2 min at 1000 rpm. The eluate was collected. The second amplification was performed with the primers 799 for_illumina and 1175 R1_illumina, harboring the primer binding site for the Illumina indexing primers at the 5′-end using standard amplification reaction procedures as known in the art. Twenty-five μl of the 16S rDNA PCR amplicons were subjected to electrophoresis (100V for 1 h) in 2% (w/v) TBE agarose gels (Biozym Biotech Trading, Vienna, Austria). The 500 bp bands were cut and gel pieces were put in a filter tip that was placed in a fresh tube and DNA was collected by centrifugation for 2 min at 1000 rpm. The eluate was collected. Index PCR was performed with Nextera XT Index Kit (24 indices, 96 samples) (Illumina Inc., San Diego, USA) according to the manufacturers protocol. In order to purify the amplicon away from free nucleotides and primers and primer dimer species before quantification we used AMPure XP beads following the manufacturer's protocol strictly. Amplicon concentration has been measured using a Nanodrop and about 10 ng per sample were pooled. DNA quality and quantity of the pooled library was tested with an Agilent 2100 Bioanalyzer. The final amplicon size was about 570 bp including the adapter, sequencing primer binding site and index on both sides. The library denaturing, addition of internal control DNA (PhiX, Illumina) and sample loading were done according to the Illumina protocol. 16S rDNA sequences processing was done as follows: The raw reads were screened for PhiX contamination using Bowtie2 (B. Langmead et al. (2012), Overall shifts in bacterial community composition were assessed using non-metric multidimensional scaling and permutational multivariate analysis of variance. These analyses were based on a Bray-Curtis dissimilarities calculated from square-root transformed OTU observation counts. To compensate for differences in the number of sequences per sample, 1000 sequences were randomly taken from each sample to use in these analyses. Prior to analysis, OTUs without phylum level classifications were removed as an additional quality control measure. To assess shifts in the relative abundances of individual taxa, mean relative abundances were calculated for each wheat cultivar and each treatment or control samples. These relative abundances were compared using a mixed effects model applied to each taxon in an automated R script (R Core Team 2013). For this model, cultivar was treated as a random effect while the treatment was treated as a fixed effect. Relative abundances were rank transformed prior to fitting the models. The models were calculated using the ‘nlme’ package in R. To control for potentially spurious OTUs, only OTUs represented by at least 1 sequence (i.e. 0.1% of the sequences), on average, were included in the analysis. In addition, changes in the relative abundances of OTUs representing the strains used in the Endoseed treatments were assessed. This analysis was conducted by identifying these OTUs which were classified to the same genus as the strains used in the experimental treatments. The relative abundance of these OTUs were compared across controls and treatments. Deep amplicon sequencing of partial 16S rDNA of single endoseeds allowed identification of DNA of strain PsJN and S10 in summer wheat and barley seeds ( Looking at the level of the individual taxa, these sequencing indicated that, apart from taxa belonging to the Bacterial strains of different phylogenetic background and ecological origin could be introduced into seeds of summer wheat and barley by spraying bacterial formulations on flowers of parent plants. Endoseed of summer wheat and barley carrying both, gram-positive ( The following endoseeds were used for this experiment: soy (Essor and Merlin) treated with sterile broth, PsJN or NC92, summer wheat (Kronjet and Trappe) treated with sterile broth, PsJN, S10, PsJN+S10 or From this experiment, the The generation of seeds containing endophytes resulted in a decrease of bacteria of the In order to explore the pathways augmented or otherwise modified by the bacteria in the endoseeds, we performed proteomic analysis on extracts of wheat, maize and soy plants grown from endoseeds. As in Example 9 above, the changes in protein levels in the endoseed or a plant grown from the endoseed can be used as a surrogage for determination of the presence of an endophyte within a bioreactor. Endoseeds were prepared as in Example 17, and the following samples were used for proteomic measurements (Table 31). After 7 days of growth on water agar, 12 whole seedlings (including roots, seeds and hypocotyls) per treatment were collected in a 50 mL falcon tube using sterile forceps and immediately snap-frozen in liquid nitrogen to minimize protein degradation and proteomic changes during sample collection (such as wound responses from using the forceps). The frozen samples were then homogenized using a pestle and mortar previously cooled in liquid nitrogen and transferred to a 15 mL falcon tube on dry ice. The homogenized samples were stored at −80° C. until further processing. 1 mL of 5% SDS 1 mM DTT was added to 1 mL of homogenized tissue and the samples were boiled for 5 m. The samples were cooled on ice and 2 mL of 8M urea solution was added. The samples were spun for 20 m at 14,000 rpm and the soluble phase recovered. A 25% volume of 100% TCA solution was added to the soluble phase, left on ice for 20 m and centrifuged for 10 m at 14,000 rpm. The protein pellet was washed twice with ice-cold acetone and solubilized in 125 μL 0.2M NaOH and neutralized with 125 μL of 1M Tris-Cl pH 8.0. Protein solutions were diluted in THE (50 mM Tris-Cl pH8.0, 100 mM NaCl, 1 mM EDTA) buffer. RapiGest SF reagent (Waters Corp., Milford, Mass.) was added to the mix to a final concentration of 0.1% and samples were boiled for 5 min. TCEP (Tris (2-carboxyethyl) phosphine) was added to 1 mM (final concentration) and the samples were incubated at 37° C. for 30 min. Subsequently, the samples were carboxymethylated with 0.5 mg ml−1of iodoacetamide for 30 min at 37° C. followed by neutralization with 2 mM TCEP (final concentration). Proteins samples prepared as above were digested with trypsin (trypsin:protein ratio of 1:50) overnight at 37° C. RapiGest was degraded and removed by treating the samples with 250 mM HCl at 37° C. for 1 h followed by centrifugation at 14,000 rpm for 30 min at 4° C. The soluble fraction was then added to a new tube and the peptides were extracted and desalted using Aspire RP30 desalting columns (Thermo Scientific). The trypsinized samples were labeled with isobaric tags (iTRAQ, ABSCIEX, Ross et al 2004), where each sample was labeled with a specific tag to its peptides. Each set of experiments (samples 1-6; 7, 8; 9-12; 13-16; 17-20) was then pooled and fractionated using high pH reverse phase chromatography (HPRP-Xterra C18 reverse phase, 4.6 mm×10 mm 5 μm particle (Waters)). The chromatography conditions were as follows: the column was heated to 37° C. and a linear gradient from 5-35% B (Buffer A-20 mM ammonium formate pH10 aqueous, Buffer B-20 mM ammonium formate pH10 in 80% ACN-water) was applied for 80 min at 0.5 ml min−1flow rate. A total of 30 fractions of 0.5 ml volume where collected for LC-MS/MS analysis. Each of these fractions was analyzed by high-pressure liquid chromatography (HPLC) coupled with tandem mass spectroscopy (LC-MS/MS) using nano-spray ionization. The nanospray ionization experiments were performed using a TripleTOF 5600 hybrid mass spectrometer (AB SCIEX Concord, Ontario, Canada)) interfaced with nano-scale reversed-phase HPLC (Tempo, Applied Biosystems (Life Technologies), CA, USA) using a 10 cm-180 micron ID glass capillary packed with 5 μm C18 Zorbax™ beads (Agilent Technologies, Santa Clara, Calif.). Peptides were eluted from the C18 column into the mass spectrometer using a linear gradient (5-30%) of ACN (Acetonitrile) at a flow rate of 550 μl min−1for 100 min. The buffers used to create the ACN gradient were: Buffer A (98% H2O, 2% ACN, 0.2% formic acid, and 0.005% TFA) and Buffer B (100% ACN, 0.2% formic acid, and 0.005% TFA). MS/MS data were acquired in a data-dependent manner in which the MS1 data was acquired for 250 ms at m/z of 400 to 1250 Da and the MS/MS data was acquired from m/z of 50 to 2,000 Da. For Independent data acquisition (IDA) parameters MS1-TOF 250 ms, followed by 50 MS2 events of 25 ms each. The IDA criteria, over 200 counts threshold, charge state +2-4 with 4 s exclusion. Finally, the collected data were analyzed using Protein Pilot 4.0 (AB SCIEX) for peptide identifications and quantification. Synthetic combinations of wheat plants and bacterial endophytes (PsJN, Changes in the levels of the proteins shown in Tables 32, 33, and 34 within a plant bioreactor may be indicative of the presence of an endophyte. The ambition of this germination assay was to find out if there is a difference in germination and growth between endoseeds and non-treated seeds of summer wheat ( Endoseeds were prepared as in Example 17. Seeds were put on filter paper strips, moistened with Milli-Q-water. Another moistened filter paper strip was put on top of it. Both stripes, with the seeds in-between, were rolled up. The rolls were put into an airtight plastic container for germination and to keep them moist. The rolls were opened up daily for regular rating of the state of germination and the germination rate was scored starting on day 1 until day 4, except the germination was rated only until day 3, as the germination was finished by then. The germination state was determined on a scale of 0 to 5 for wheat as follows: “0” is no germination; “1” corresponds to germination, first root tip visible; “2” corresponds to three little roots and a first little shoot visible; “3” corresponds to a light green shoot; “4” corresponds to a green shoot at least 1 cm in length; “5” corresponds to a green shoot at least 2 cm in length. For barley, germination state was determined on a scale of 0 to 7 as follows: “0” is no germination; “1” corresponds to germination, first root tip visible; “2” corresponds to two to three little roots and a first little shoot visible; “3” corresponds to a light green shoot; “4” corresponds to a green shoot at least 1 cm in length; “5” corresponds to a green shoot at least 2 cm in length; “6” corresponds to tip of leaf being visible; “7” corresponds to leaf being visible for at least 2 cm. Apart from germination seedling growth was determined by measuring the length of the main root and the shoot with a ruler on day 4. In this experiment the effect of bacteria of different phylogeny and origin introduced into seeds of summer wheat and barley on seed germination and seeding growth has been tested. PsJN, TC38 and S10 endoseeds of summer wheat cultivar Trappe showed increased germination rate as compared to control seeds. Eighty-five % of control seeds germinated whereas 100% of PsJN- and S10-endoseeds and 95% of TC38-endoseeds were germinated after three days Bacterial strains introduced into seeds upon spraying flowers of parent plants had a stimulating effect on seed germination and seedling growth in summer wheat and barley. Both, gram-positive (S10, AB) and gram-negative (TC38) bacteria were found to be able to increase germination and seedling growth in summer wheat and barley when introduced into the seeds. Strains of different origin were able to increase germination and seedling growth of summer wheat (PsJN isolated from onion roots, TC38 isolated from maize roots, S10 isolated form maize seeds) and of barley (TC38, S10 and AB isolated from summer wheat). This greenhouse test was conducted to determine the difference in germination, growth and flower onset between summer wheat ( Endoseeds and control seeds were prepared in a field in 2014 as in Example 9. The colonization of endoseeds by strain PsJN has been tested prior to this experiment. Eighty-eight % of the seeds carried PsJN cells at a detectable level (102to 103copies per seed). The following treatments were used in this experiment:
For the preparation of bacterial inoculum for seed coating single colonies of After inoculation each batch of 24 moist seeds was sown in multipot plates with a single pot diameter of 5.5 cm and a depth of 6 cm containing pot soil (Einheitserde special—Topfsubstrat ED 63). Trays were watered with tap water. Regular rating of germination rate was conducted on a daily basis starting on day 3 until day 10. During this period plants were still in multipot plates. From day 11 onwards only height was measured as germination was finished. On day 17, six plants per treatment were potted individually in pots with a diameter of 15 cm, containing pot soil (Einheitserde special—Topfsubstrat ED 63). Height was measured once a week until day 69. From day 48 forward, the number of tillers was also counted once per week. The appearance of the first spike per plant was monitored between Dec. 4, 2014 and Dec. 15, 2014. The day on which first spike on the first plant was observed (Dec. 4, 2014) was rated with 1, and subsequent days were rated in ascending order, i.e. if the first spike on a particular plant was observed on Dec. 7, 2014, the plant was rated with a 4. Accordingly the lower the overall value the sooner the spike appeared. Strain PsJN had no effect on plant growth in summer wheat ( Regardless of the method by which the endophyte is introduced into the plant bioreactor (seed coating or endoseed), determination of the developmental time for spike formation of the plant can be used as surrogate assay to determine the presence of the endophyte within the bioreactor. The purpose of this experiment is to determine the extent of colonization of endoseeds from different locations on a spike for summer wheat cultivar Trappe, and the colonization rate of individual seeds from a soybean pod. In each case, the endoseed was generated using Endoseeds and control seeds were prepared in a field in 2014 as in Example 9. At time of harvest ten individual heads per treatment were harvested. Endoseeds used in this experiment:
Quantification of PsJN in endoseeds was achieved by strain specific qPCR. Seeds were surface-sterilized by soaking the seeds in 70% ethanol for 3 min followed by 5% sodium hypochloride for 5 min, and washed three times with sterile distilled water (1 min for each wash). Seeds and aliquots of the final wash were plated on LB plates to verify the efficiency of surface sterilization. Seeds were considered to be successfully sterilized when no colonies were observed on the LB plates after inoculation for 3 days at 28° C. Single surface-sterilized seeds were aseptically peeled using a scalpel, cut in pieces and crushed using a sterile mortar. Seed material was homogenized for 30 s in lysing matrix E (MPbio DNA isolation kit from soil) using in a bead beater (FastPrep FP 120, Bio101, Savant Instruments, Inc., Holbrook, N.Y.). DNA was then extracted with the MPbio DNA isolation kit from soil (MP Biomedicals, Solon, Ohio, USA) according to protocol provided by the manufacturer. For quantification of For qPCR standard preparation, chromosomal DNA of where fragment length is 8214658 bp (size of PsJN genome). For absolute quantification of DNA in seed samples, a calibration curve was generated from the real-time qPCR results of 3 respective replicates of a 10-fold serial dilution of the purified chromosomal DNA of PsJN. Unknown starting quantity of DNA copy numbers in the samples were calculated based on a standard curve. All data analysis was performed using the software Bio-Rad CFX Manager 3.0. Results were considered as positive when the starting quantity estimated was at least 10 copies. Only seeds for which two out of three replicates in qPCR gave a positive signal were considered to be colonized by strain PsJN. In general, PsJN was found in seeds of heads of summer wheat and barley (Table 35, Table 36, Table 37, and Table 38). Single heads were not evenly colonized by strain PsJN and the number of colonized seeds varied strongly from head to head. Seeds of single heads were not evenly colonized by The goal of this drought stress assay was to find out if there is a difference in the resistance to drought stress between endoseeds and untreated seeds of barley ( Germination Assay: Tested treatments are PsJN-EndoSeeds, TC38-EndoSeeds, S10-EndoSeeds, 510+PsJN-EndoSeeds, To generate a drought stress, plants did not get irrigated any more from day 12 onwards. Trays needed about 2 days for drying out. First symptoms could be seen on day 15 (3 days after irrigation was stopped). Drought was rated according to Table 40. Data of the germination state, germination rate, and drought stress are seen in In this experiment the effect of bacteria of different phylogeny and origin introduced into seeds of barley on seedling response to drought stress. The results are summarized in Use of a drought assay as a way to determine the presence of an endophyte in a plant bioreactor may be useful.RELATED APPLICATION DATA
SEQUENCE LISTING
BACKGROUND
SUMMARY OF THE INVENTION
b. producing from the first agricultural seed a second agricultural plant, under conditions such that a population of agricultural seed-endophyte combinations is generated.
DESCRIPTION OF THE FIGURES
DETAILED DESCRIPTION OF THE INVENTION
Definitions
EXAMPLES
Example 1—Cultivation Independent Analysis of Microbial Taxa in Agriculturally Relevant Seed Communities Based on Marker Gene High Throughput Sequencing
Example Description
Experimental Description
Example Results
2227 OTU_2152 Actinosynnemataceae 2228 OTU_90 Actinosynnemataceae 2229 OTU_309 Dermabacteraceae 2230 OTU_2984 Geodermatophilaceae 2231 OTU_132 Glycomycetaceae 2232 OTU_1588 Intrasporangiaceae 2233 OTU_161 Kineosporiaceae 2234 OTU_1207 Kineosporiaceae 2235 OTU_28 Microbacteriaceae 2236 OTU_302 Microbacteriaceae 2237 OTU_3428 Microbacteriaceae 2238 OTU_94 Micrococcaceae 2239 OTU_2968 Micrococcaceae 2240 OTU_179 Micrococcaceae 2241 OTU_200 Micromonosporaceae 2242 OTU_350 Mycobacteriaceae 2243 OTU_100 Nocardioidaceae 2244 OTU_3177 Nocardioidaceae 2245 OTU_1142 Nocardioidaceae 2246 OTU_238 Nocardioidaceae 2247 OTU_730 Nocardioidaceae 2248 OTU_992 Nocardioidaceae 2249 OTU_392 Promicromonosporaceae 2250 OTU_91 Promicromonosporaceae 2251 OTU_134 Pseudonocardiaceae 2252 OTU_573 Streptomycetaceae 2253 OTU_3556 Streptomycetaceae 2254 OTU_88 Streptomycetaceae 2255 OTU_409 Streptomycetaceae 2256 OTU_882 2257 OTU_713 Gaiellaceae 2258 OTU_402 Chitinophagaceae 2259 OTU_3325 Chitinophagaceae 2260 OTU_218 Chitinophagaceae 2261 OTU_57 Chitinophagaceae 2262 OTU_213 Chitinophagaceae 2263 OTU_362 Chitinophagaceae 2264 OTU_348 Chitinophagaceae 2265 OTU_208 Chitinophagaceae 2266 OTU_237 Chitinophagaceae 2267 OTU_163 Cyclobacteriaceae 2268 OTU_112 Cytophagaceae 2269 OTU_120 Cytophagaceae 2270 OTU_234 Cytophagaceae 2271 OTU_210 Cytophagaceae 2272 OTU_187 Cytophagaceae 2273 OTU_152 Cytophagaceae 2274 OTU_1201 Cytophagaceae 2275 OTU_287 Cytophagaceae 2276 OTU_377 Cytophagaceae 2277 OTU_2342 Cytophagaceae 2278 OTU_487 2279 OTU_276 Cryomorphaceae 2280 OTU_141 Flavobacteriaceae 2281 OTU_148 Flavobacteriaceae 2282 OTU_3571 Flavobacteriaceae 2283 OTU_3528 Flavobacteriaceae 2284 OTU_67 Sphingobacteriaceae 2285 OTU_109 Sphingobacteriaceae 2286 OTU_3687 Sphingobacteriaceae 2287 OTU_3184 Sphingobacteriaceae 2288 OTU_3212 Sphingobacteriaceae 2289 OTU_3301 Sphingobacteriaceae 2290 OTU_86 Sphingobacteriaceae 2291 OTU_406 Sphingobacteriaceae 2292 OTU_129 Sphingobacteriaceae 2293 OTU_2892 Sphingobacteriaceae 2294 OTU_3722 Sphingobacteriaceae 2295 OTU_191 2296 OTU_223 Parachlamydiaceae 2297 OTU_195 2298 OTU_790 A4b 2299 OTU_103 2300 OTU_467 Bacillaceae 2301 OTU_3 Bacillaceae 2302 OTU_27 Bacillaceae 2303 OTU_3473 Bacillaceae 2304 OTU_131 Bacillaceae 2305 OTU_106 Bacillaceae 2306 OTU_6 Paenibacillaceae 2307 OTU_38 Planococcaceae 2308 OTU_763 2309 OTU_9 Clostridiaceae 2310 OTU_1079 Clostridiaceae SMB53 2311 OTU_181 Clostridiaceae 2312 OTU_262 Caldicellulosiruptoraceae 2313 OTU_431 Carboxydocellaceae 2314 OTU_158 Caulobacteraceae 2315 OTU_340 Caulobacteraceae 2316 OTU_157 Caulobacteraceae 2317 OTU_243 Caulobacteraceae 2318 OTU_292 Caulobacteraceae 2319 OTU_341 2320 OTU_69 Methylobacteriaceae 2321 OTU_149 Phyllobacteriaceae 2322 OTU_54 Rhizobiaceae 2323 OTU_3736 Rhizobiaceae 2324 OTU_174 Rhizobiaceae 2325 OTU_3518 Rhodospirillaceae 2326 OTU_245 Rhodospirillaceae 2327 OTU_289 Rhodospirillaceae 2328 OTU_242 2329 OTU_185 Erythrobacteraceae 2330 OTU_184 Sphingomonadaceae 2331 OTU_304 Sphingomonadaceae 2332 OTU_568 Sphingomonadaceae 2333 OTU_23 Sphingomonadaceae 2334 OTU_3351 Sphingomonadaceae 2335 OTU_383 Sphingomonadaceae 2336 OTU_78 Sphingomonadaceae 2337 OTU_3439 Sphingomonadaceae 2338 OTU_93 Sphingomonadaceae 2339 OTU_199 Alcaligenaceae 2340 OTU_18 Burkholderiaceae 2341 OTU_639 Burkholderiaceae 2342 OTU_2905 Burkholderiaceae 2343 OTU_64 Comamonadaceae 2344 OTU_283 Comamonadaceae 2345 OTU_215 Comamonadaceae 2346 OTU_3641 Comamonadaceae 2347 OTU_3253 Comamonadaceae 2348 OTU_3420 Comamonadaceae 2349 OTU_236 Comamonadaceae 2350 OTU_222 Comamonadaceae 2351 OTU_2922 Comamonadaceae 2352 OTU_3580 Comamonadaceae 2353 OTU_443 Comamonadaceae 2354 OTU_2585 Comamonadaceae 2355 OTU_50 Oxalobacteraceae 2356 OTU_3392 Oxalobacteraceae 2357 OTU_156 Oxalobacteraceae 2358 OTU_3582 Oxalobacteraceae 2359 OTU_315 Oxalobacteraceae 2360 OTU_2266 Oxalobacteraceae 2361 OTU_2954 Oxalobacteraceae 2362 OTU_2344 Oxalobacteraceae 2363 OTU_58 Oxalobacteraceae 2364 OTU_15 Oxalobacteraceae 2365 OTU_221 Oxalobacteraceae 2366 OTU_2199 Oxalobacteraceae 2367 OTU_1776 2368 OTU_507 2369 OTU_176 Methylophilaceae 2370 OTU_115 2371 OTU_3227 2372 OTU_165 Syntrophobacteraceae 2373 OTU_52 Alteromonadaceae 2374 OTU_146 Alteromonadaceae 2375 OTU_1384 Enterobacteriaceae 2376 OTU_35 Enterobacteriaceae 2377 OTU_2912 Enterobacteriaceae 2378 OTU_319 Enterobacteriaceae 2379 OTU_2 Enterobacteriaceae 2380 OTU_1255 Enterobacteriaceae 2381 OTU_3489 Enterobacteriaceae 2382 OTU_2970 Enterobacteriaceae 2383 OTU_3078 Enterobacteriaceae 2384 OTU_3153 Enterobacteriaceae 2385 OTU_145 Coxiellaceae 2386 OTU_379 Coxiellaceae 2387 OTU_390 Coxiellaceae 2388 OTU_209 Coxiellaceae 2389 OTU_197 Coxiellaceae 2390 OTU_3292 Pasteurellaceae 2391 OTU_363 Pasteurellaceae 2392 OTU_155 Moraxellaceae 2393 OTU_216 Moraxellaceae 2394 OTU_2544 Pseudomonadaceae 2395 OTU_11 Pseudomonadaceae 2396 OTU_7 Pseudomonadaceae 2397 OTU_3276 Pseudomonadaceae 2398 OTU_3748 Pseudomonadaceae 2399 OTU_3228 Pseudomonadaceae 2400 OTU_204 Pseudomonadaceae 2401 OTU_2653 Pseudomonadaceae 2402 OTU_144 Xanthomonadaceae 2403 OTU_3850 Xanthomonadaceae 2404 OTU_177 Xanthomonadaceae 2405 OTU_194 Xanthomonadaceae 2406 OTU_527 Xanthomonadaceae 2407 OTU_168 Xanthomonadaceae 2408 OTU_83 Xanthomonadaceae 2409 OTU_2829 Xanthomonadaceae 2410 OTU_382 Xanthomonadaceae 2411 OTU_334 Leptospiraceae 2412 OTU_89 Mycoplasmataceae 2413 OTU_214 auto67_4W 2414 OTU_385 Opitutaceae 2415 OTU_252 Opitutaceae 2416 OTU_279 Opitutaceae 2417 OTU_280 Verrucomicrobiaceae 2418 OTU_172 Verrucomicrobiaceae OTU_28 2235 Actinomycetales Microbacteriaceae OTU_57 2261 Saprospirales Chitinophagaceae OTU_3473 2303 Bacillales Bacillaceae OTU_131 2304 Bacillales Bacillaceae OTU_38 2307 Bacillales Planococcaceae OTU_9 2309 Clostridiales Clostridiaceae OTU_181 2311 Clostridiales Clostridiaceae OTU_64 2343 Burkholderiales Comamonadaceae OTU_3392 2356 Burkholderiales Oxalobacteraceae OTU_2344 2362 Burkholderiales Oxalobacteraceae OTU_15 2364 Burkholderiales Oxalobacteraceae OTU_1384 2375 Enterobacteriales Enterobacteriaceae OTU_35 2376 Enterobacteriales Enterobacteriaceae OTU_2912 2377 Enterobacteriales Enterobacteriaceae OTU_319 2378 Enterobacteriales Enterobacteriaceae OTU_2 2379 Enterobacteriales Enterobacteriaceae OTU_1255 2380 Enterobacteriales Enterobacteriaceae OTU_3489 2381 Enterobacteriales Enterobacteriaceae OTU_2970 2382 Enterobacteriales Enterobacteriaceae OTU_11 2395 Pseudomonadales Pseudomonadaceae OTU_7 2396 Pseudomonadales Pseudomonadaceae OTU_3276 2397 Pseudomonadales Pseudomonadaceae OTU_83 2408 Xanthomonadales Xanthomonadaceae Example 2—Isolation of Bacterial Endophytes from Seeds, Seedlings, and Plants
Example 3—Sequence Analysis & Phylogenetic Assignment
Endophytic bacteria isolated from corn, rice and wheat seeds, including assignment to specific OTUs, corresponding Sequence ID numbers, Family, Genus, Taxonomic information and plant source from which the microbe was derived. Legend: For “Source of seed-origin microbe” Surface sterilized seeds” = seed-origin microbes isolated from seeds that were surface sterilized as described in the Examples; “Seed surface wash” = microbes derived from the surface of seeds as described in the Examples; “Roots” = seed-origin microbes isolated from roots of seeds that were germinated in sterile culture; “Roots & Seeds” = seed-origin microbes isolated from roots and residual seed material that was generated by germinating seeds under sterile conditions; “Leaves” = seed-origin microbes isolated from shoots and leaves that emerged from seeds that were germinated under sterile conditions. Seed- Origin OTU SEQ ID Seed-Origin Cultivar Source of seed-origin Family of Seed- Taxonomy of Seed- Strain # NO: Crop Type Type microbes Origin Microbe Origin Microbe SYM00033 0 541 Teosinte Wild Surface sterilized seeds Enterobacteriaceae Enterobacter sp. relative SYM00173 0 593 Rice Modern Surface sterilized seeds Enterobacteriaceae Pantoea sp. SYM00176 0 596 Wild Surface sterilized seeds Enterobacteriaceae Pantoea sp. relative SYM00284 0 633 Maize Modern Surface sterilized seeds Enterobacteriaceae Pantoea ananatis SYM00605 0 716 Maize Modern Seed surface wash Enterobacteriaceae SYM00607 0 717 Maize Modern Seed surface wash Enterobacteriaceae SYM00608 0 718 Maize Modern Seed surface wash Enterobacteriaceae Pantoea sp. SYM00620 0 720 Teosinte Wild Seed surface wash Enterobacteriaceae Enterobacter sp. relative SYM00658 0 736 Wild Seed surface wash Enterobacteriaceae relative SYM00985 0 851 Rice Modern Surface sterilized seeds Enterobacteriaceae SYM01006 0 866 Rice Modern Surface sterilized seeds Enterobacteriaceae SYM01035 0 887 Wild Surface sterilized seeds Enterobacteriaceae relative SYM01041 0 892 Rice Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM01158 0 937 Wild Roots & Seeds Enterobacteriaceae relative SYM01173 0 943 Rice Ancient Roots & Seeds Enterobacteriaceae Landrace SYM01231 0 980 Rice Modern Roots & Seeds Enterobacteriaceae SYM00472 1 636 Maize Modern Roots Pseudomonadaceae Pseudomonas sp. SYM00660 1 737 Wild Seed surface wash Pseudomonadaceae Pseudomonas sp. relative SYM00011 2 522 Teosinte Wild Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. relative SYM00011b 2 523 Teosinte Wild Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. relative SYM00013 2 524 Teosinte Wild Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. relative SYM00014 2 526 Teosinte Wild Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. relative SYM00062 2 557 Teosinte Wild Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. relative SYM00067 2 562 Teosinte Wild Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. relative SYM00068 2 563 Teosinte Wild Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. relative SYM00069 2 564 Teosinte Wild Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. relative SYM00646 2 730 Rice Modern Seed surface wash Pseudomonadaceae Pseudomonas sp. SYM00649 2 733 Rice Modern Seed surface wash Pseudomonadaceae Pseudomonas sp. SYM00650 2 734 Rice Modern Seed surface wash Pseudomonadaceae Pseudomonas sp. SYM00657 2 735 Wild Seed surface wash Pseudomonadaceae Pseudomonas sp. relative SYM00672 2 738 Wild Seed surface wash Pseudomonadaceae Pseudomonas sp. relative SYM00709 2 747 Rice Modern Seed surface wash Pseudomonadaceae Pseudomonas sp. SYM00926 2 804 Rice Ancient Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM00927 2 805 Rice Ancient Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM00946 2 821 Rice Modern Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. SYM00955 2 828 Rice Ancient Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM00970 2 839 Rice Ancient Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM00971 2 840 Rice Ancient Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM00973 2 842 Rice Ancient Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM00993 2 857 Wild Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. relative SYM01007 2 867 Rice Modern Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. SYM01024 2 880 Wild Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. relative SYM01032 2 885 Wild Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. relative SYM01036 2 888 Rice Modern Surface sterilized seeds Pseudomonadaceae Pseudomonas sp. SYM01164 2 940 Rice Ancient Roots & Seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM01171 2 942 Rice Ancient Roots & Seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM01177 2 947 Rice Ancient Roots & Seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM01178 2 948 Rice Ancient Roots & Seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM01225 2 975 Rice Modern Roots & Seeds Pseudomonadaceae Pseudomonas sp. SYM01245 2 988 Rice Ancient Roots & Seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM01251 2 989 Rice Ancient Roots & Seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM01254 2 990 Rice Ancient Roots & Seeds Pseudomonadaceae Pseudomonas sp. Landrace SYM00013b 3 525 Teosinte Wild Surface sterilized seeds Microbacteriaceae Curtobacterium sp. relative SYM00167 3 588 Rice Modern Surface sterilized seeds Microbacteriaceae Curtobacterium sp. SYM00171 3 591 Rice Modern Surface sterilized seeds Microbacteriaceae Curtobacterium sp. SYM00174 3 594 Rye Modern Surface sterilized seeds Microbacteriaceae Curtobacterium sp. SYM00178 3 598 Rice Ancient Surface sterilized seeds Microbacteriaceae Curtobacterium sp. Landrace SYM00180 3 600 Rice Ancient Surface sterilized seeds Microbacteriaceae Curtobacterium sp. Landrace SYM00181 3 601 Rice Ancient Surface sterilized seeds Microbacteriaceae Curtobacterium sp. Landrace SYM00235 3 622 Rice Modern Surface sterilized seeds Microbacteriaceae Curtobacterium sp. SYM00244 3 626 Barley Modern Surface sterilized seeds Microbacteriaceae Curtobacterium sp. SYM00525 3 654 Wild Seed surface wash Microbacteriaceae Curtobacterium sp. relative SYM00625 3 724 Maize Modern Seed surface wash Microbacteriaceae Curtobacterium sp. SYM00645 3 729 Rice Modern Seed surface wash Microbacteriaceae Curtobacterium sp. SYM00647 3 731 Rice Modern Seed surface wash Microbacteriaceae Curtobacterium sp. SYM00673b 3 739 Wild Seed surface wash Microbacteriaceae Curtobacterium sp. relative SYM00690 3 740 Rice Modern Seed surface wash Microbacteriaceae Curtobacterium sp. SYM00691 3 741 Rice Modern Seed surface wash Microbacteriaceae Curtobacterium sp. SYM00693 3 742 Rice Modern Seed surface wash Microbacteriaceae Curtobacterium sp. SYM00694b 3 744 Rice Modern Seed surface wash Microbacteriaceae Curtobacterium sp. SYM00712 3 748 Rice Modern Seed surface wash Microbacteriaceae Curtobacterium sp. SYM00716 3 752 Rice Ancient Seed surface wash Microbacteriaceae Curtobacterium sp. Landrace SYM00722 3 753 Rice Ancient Seed surface wash Microbacteriaceae Curtobacterium sp. Landrace SYM00722B 3 754 Rice Ancient Seed surface wash Microbacteriaceae Curtobacterium sp. Landrace SYM00731B 3 756 Rice Ancient Seed surface wash Microbacteriaceae Curtobacterium sp. Landrace SYM00749 3 758 Rice Ancient Surface sterilized seeds Microbacteriaceae Curtobacterium sp. Landrace SYM00784 3 773 Maize Modern Seed surface wash Microbacteriaceae Curtobacterium sp. SYM00947 3 822 Rice Modern Surface sterilized seeds Microbacteriaceae Curtobacterium sp. SYM00949 3 823 Rice Modern Surface sterilized seeds Microbacteriaceae Curtobacterium sp. SYM00952 3 826 Rice Ancient Surface sterilized seeds Microbacteriaceae Curtobacterium sp. Landrace SYM00964 3 834 Rice Ancient Surface sterilized seeds Microbacteriaceae Curtobacterium sp. Landrace SYM00976 3 844 Rice Ancient Surface sterilized seeds Microbacteriaceae Curtobacterium sp. Landrace SYM00980 3 847 Rice Modern Surface sterilized seeds Microbacteriaceae Curtobacterium sp. SYM00984 3 850 Rice Modern Surface sterilized seeds Microbacteriaceae Curtobacterium sp. SYM00996 3 859 Wild Surface sterilized seeds Microbacteriaceae Curtobacterium sp. relative SYM01013 3 872 Rice Ancient Surface sterilized seeds Microbacteriaceae Curtobacterium sp. Landrace SYM01022 3 879 Wild Surface sterilized seeds Microbacteriaceae Curtobacterium sp. relative SYM01025 3 881 Wild Surface sterilized seeds Microbacteriaceae Curtobacterium sp. relative SYM01142 3 928 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01144 3 929 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01148 3 931 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01151 3 932 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01155 3 935 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01156 3 936 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01179 3 949 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01181 3 951 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01182 3 952 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01183 3 953 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01184 3 954 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01185 3 955 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01188 3 957 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01198 3 962 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01199 3 963 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01201 3 964 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01202 3 965 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01204 3 966 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01205 3 967 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01207 3 969 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01215 3 971 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01218 3 973 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM01222 3 974 Rice Modern Roots & Seeds Microbacteriaceae Curtobacterium sp. SYM00188 6 605 Maize Modern Leaves Paenibacillaceae Paenibacillus sp. SYM00190 6 607 Maize Modern Leaves Paenibacillaceae Paenibacillus sp. SYM00195 6 610 Maize Modern Leaves Paenibacillaceae Paenibacillus sp. SYM00217 6 616 Soybean Modern Roots Paenibacillaceae Paenibacillus sp. SYM00227 6 619 Soybean Modern Leaves Paenibacillaceae Paenibacillus sp. SYM00292 6 634 Maize Modern Surface sterilized seeds Paenibacillaceae Paenibacillus taichungensis SYM00597 6 711 Maize Ancient Seed surface wash Paenibacillaceae Paenibacillus sp. Landrace SYM01108 6 915 Wild Surface sterilized seeds Paenibacillaceae Paenibacillus sp. relative SYM01109 6 916 Wild Surface sterilized seeds Paenibacillaceae Paenibacillus sp. relative SYM01110 6 917 Wild Surface sterilized seeds Paenibacillaceae Paenibacillus sp. relative SYM01111 6 918 Wild Surface sterilized seeds Paenibacillaceae Paenibacillus sp. relative SYM01112 6 919 Wild Surface sterilized seeds Paenibacillaceae Paenibacillus sp. relative SYM01114 6 921 Maize Modern Roots Paenibacillaceae Paenibacillus sp. SYM01117 6 922 Maize Ancient Roots Paenibacillaceae Paenibacillus sp. Landrace SYM01118 6 923 Maize Ancient Roots Paenibacillaceae Paenibacillus sp. Landrace SYM01127 6 925 Teosinte Wild Roots Paenibacillaceae Paenibacillus sp. relative SYM01256 6 991 Maize Ancient Roots Paenibacillaceae Paenibacillus sp. Landrace SYM00014b 7 527 Teosinte Wild Surface sterilized seeds Enterobacteriaceae Erwinia sp. relative SYM00017b 7 532 Rice Modern Surface sterilized seeds Enterobacteriaceae Pantoea sp. SYM00018 7 534 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00020 7 535 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00022 7 537 Teosinte Wild Surface sterilized seeds Enterobacteriaceae Pantoea sp. relative SYM00025 7 538 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00026 7 539 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00043 7 544 Maize Modern Surface sterilized seeds Enterobacteriaceae Pantoea sp. SYM00047 7 546 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00049 7 547 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00055 7 553 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00057 7 554 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00058 7 555 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00078 7 568 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00081 7 569 Maize Ancient Seed surface wash Enterobacteriaceae Pantoea sp. Landrace SYM00082a 7 570 Maize Ancient Seed surface wash Enterobacteriaceae Pantoea sp. Landrace SYM00085 7 571 Maize Modern Surface sterilized seeds Enterobacteriaceae Pantoea sp. SYM00086 7 572 Maize Modern Surface sterilized seeds Enterobacteriaceae Pantoea sp. SYM00087 7 573 Maize Maize PI Surface sterilized seeds Enterobacteriaceae Pantoea sp. 485356 SYM00088 7 574 Maize Maize PI Surface sterilized seeds Enterobacteriaceae Pantoea sp. 485356 SYM00094 7 576 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00095 7 577 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00096 7 578 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00100 7 579 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00101 7 580 Maize Ancient Surface sterilized seeds Enterobacteriaceae Pantoea sp. Landrace SYM00502 7 639 Maize Ancient Seed surface wash Enterobacteriaceae Erwinia sp. Landrace SYM00506 7 641 Maize Ancient Seed surface wash Enterobacteriaceae Erwinia sp. Landrace SYM00506b 7 642 Maize Ancient Seed surface wash Enterobacteriaceae Erwinia sp. Landrace SYM00511 7 647 Maize Ancient Seed surface wash Enterobacteriaceae Erwinia sp. Landrace SYM00514b 7 649 Maize Ancient Seed surface wash Enterobacteriaceae Erwinia sp. Landrace SYM00514C 7 650 Maize Ancient Seed surface wash Enterobacteriaceae Erwinia sp. Landrace SYM00514D 7 651 Maize Ancient Seed surface wash Enterobacteriaceae Erwinia sp. Landrace SYM00731A 7 755 Rice Ancient Seed surface wash Enterobacteriaceae Erwinia sp. Landrace SYM00785 7 774 Maize Modern Seed surface wash Enterobacteriaceae Erwinia sp. SYM01056 7 903 Teosinte Wild Surface sterilized seeds Enterobacteriaceae Erwinia sp. relative SYM01235 7 984 Wild Roots & Seeds Enterobacteriaceae Erwinia sp. relative SYM01238 7 986 Wild Roots & Seeds Enterobacteriaceae Erwinia sp. relative SYM00967 8 837 Rice Ancient Surface sterilized seeds Methylobacteriaceae Landrace SYM01233 8 982 Wild Roots & Seeds Methylobacteriaceae relative SYM00544 9 663 Maize Ancient Seed surface wash Brucellaceae Ochrobactrum sp. Landrace SYM00545B 9 665 Maize Ancient Seed surface wash Brucellaceae Ochrobactrum sp. Landrace SYM00548 9 667 Maize Ancient Seed surface wash Brucellaceae Ochrobactrum sp. Landrace SYM00552 9 670 Maize Ancient Seed surface wash Brucellaceae Ochrobactrum sp. Landrace SYM00558 9 675 Maize Ancient Seed surface wash Brucellaceae Ochrobactrum sp. Landrace SYM00580A 9 688 Maize Modern Seed surface wash Brucellaceae Ochrobactrum sp. SYM00580b 9 689 Maize Modern Seed surface wash Brucellaceae Ochrobactrum sp. SYM00580d 9 691 Maize Modern Seed surface wash Brucellaceae Ochrobactrum sp. SYM00581d 9 698 Maize Modern Seed surface wash Brucellaceae Ochrobactrum sp. SYM00583 9 699 Maize Ancient Seed surface wash Brucellaceae Ochrobactrum sp. Landrace SYM00584 9 700 Maize Ancient Seed surface wash Brucellaceae Ochrobactrum sp. Landrace SYM00588 9 705 Maize Ancient Seed surface wash Brucellaceae Ochrobactrum sp. Landrace SYM00596 9 710 Maize Ancient Seed surface wash Brucellaceae Ochrobactrum sp. Landrace SYM00600 9 713 Maize Ancient Seed surface wash Brucellaceae Ochrobactrum sp. Landrace SYM00746 9 757 Rice Ancient Surface sterilized seeds Brucellaceae Ochrobactrum sp. Landrace SYM00752 9 759 Maize Modern Seed surface wash Brucellaceae Ochrobactrum sp. SYM00756 9 761 Maize Modern Seed surface wash Brucellaceae Ochrobactrum sp. SYM00763 9 767 Maize Modern Seed surface wash Brucellaceae Ochrobactrum sp. SYM00783 9 772 Maize Modern Seed surface wash Brucellaceae Ochrobactrum sp. SYM00812 9 775 Rice Modern Seed surface wash Brucellaceae Ochrobactrum sp. SYM00902 9 783 Maize Ancient Surface sterilized seeds Brucellaceae Ochrobactrum sp. Landrace SYM00923 9 802 Maize Modern Surface sterilized seeds Brucellaceae Ochrobactrum sp. SYM00935 9 810 Rice Modern Surface sterilized seeds Brucellaceae Ochrobactrum sp. SYM00937 9 812 Rice Modern Surface sterilized seeds Brucellaceae Ochrobactrum sp. SYM00954 9 827 Rice Ancient Surface sterilized seeds Brucellaceae Ochrobactrum sp. Landrace SYM01029 9 883 Wild Surface sterilized seeds Brucellaceae Ochrobactrum sp. relative SYM01043 9 894 Rice Modern Surface sterilized seeds Brucellaceae Ochrobactrum sp. SYM01047 9 896 Wild Surface sterilized seeds Brucellaceae Ochrobactrum sp. relative SYM01052 9 899 Maize Ancient Surface sterilized seeds Brucellaceae Ochrobactrum sp. Landrace SYM01054 9 901 Maize Ancient Surface sterilized seeds Brucellaceae Ochrobactrum sp. Landrace SYM01055 9 902 Maize Ancient Surface sterilized seeds Brucellaceae Ochrobactrum sp. Landrace SYM01058 9 904 Maize Ancient Surface sterilized seeds Brucellaceae Ochrobactrum sp. Landrace SYM01064 9 906 Maize Ancient Surface sterilized seeds Brucellaceae Ochrobactrum sp. Landrace SYM01066 9 908 Maize Ancient Surface sterilized seeds Brucellaceae Ochrobactrum sp. Landrace SYM01069 9 909 Maize Modern Surface sterilized seeds Brucellaceae Ochrobactrum sp. SYM01079 9 913 Maize Modern Surface sterilized seeds Brucellaceae Ochrobactrum sp. SYM00064a 10 560 Teosinte Wild Surface sterilized seeds Xanthomonadaceae Stenotrophomonas sp. relative SYM00183 10 603 Wild Surface sterilized seeds Xanthomonadaceae Stenotrophomonas sp. relative SYM00184 10 604 Wild Surface sterilized seeds Xanthomonadaceae Stenotrophomonas sp. relative SYM00905 10 786 Maize Modern Surface sterilized seeds Xanthomonadaceae Stenotrophomonas sp. SYM00543 12 662 Maize Ancient Seed surface wash Bacillaceae Bacillus sp. Landrace SYM00595 12 709 Maize Ancient Seed surface wash Bacillaceae Bacillus sp. Landrace SYM01227 12 977 Rice Modern Roots & Seeds Bacillaceae Bacillus sp. SYM00547 13 666 Maize Ancient Seed surface wash Alcaligenaceae Achromobacter sp. Landrace SYM00551 13 669 Maize Ancient Seed surface wash Alcaligenaceae Achromobacter sp. Landrace SYM00560 13 676 Maize Ancient Seed surface wash Alcaligenaceae Achromobacter sp. Landrace SYM00565B 13 681 Maize Modern Seed surface wash Alcaligenaceae Achromobacter sp. SYM00580C 13 690 Maize Modern Seed surface wash Alcaligenaceae Achromobacter sp. SYM00580i 13 694 Maize Modern Seed surface wash Alcaligenaceae Achromobacter sp. SYM00585 13 701 Maize Ancient Seed surface wash Alcaligenaceae Achromobacter sp. Landrace SYM00586b 13 702 Maize Ancient Seed surface wash Alcaligenaceae Achromobacter sp. Landrace SYM00588b 13 706 Maize Ancient Seed surface wash Alcaligenaceae Achromobacter sp. Landrace SYM00591 13 708 Maize Ancient Seed surface wash Alcaligenaceae Achromobacter sp. Landrace SYM00602 13 715 Maize Modern Seed surface wash Alcaligenaceae Achromobacter sp. SYM00758 13 763 Maize Modern Seed surface wash Alcaligenaceae Achromobacter sp. SYM00761 13 765 Maize Modern Seed surface wash Alcaligenaceae Achromobacter sp. SYM00764 13 768 Maize Modern Seed surface wash Alcaligenaceae Achromobacter sp. SYM00765 13 769 Maize Modern Seed surface wash Alcaligenaceae Achromobacter sp. SYM00824 13 777 Rice Ancient Seed surface wash Alcaligenaceae Achromobacter sp. Landrace SYM00828 13 778 Rice Ancient Seed surface wash Alcaligenaceae Achromobacter sp. Landrace SYM00830 13 779 Rice Ancient Seed surface wash Alcaligenaceae Achromobacter sp. Landrace SYM00831 13 780 Rice Ancient Seed surface wash Alcaligenaceae Achromobacter sp. Landrace SYM00901 13 782 Maize Ancient Surface sterilized seeds Alcaligenaceae Achromobacter sp. Landrace SYM00903 13 784 Maize Modern Surface sterilized seeds Alcaligenaceae Achromobacter sp. SYM00904 13 785 Maize Modern Surface sterilized seeds Alcaligenaceae Achromobacter sp. SYM00907 13 787 Maize Modern Surface sterilized seeds Alcaligenaceae Achromobacter sp. SYM00908 13 788 Maize Ancient Surface sterilized seeds Alcaligenaceae Achromobacter sp. Landrace SYM00909 13 789 Maize Ancient Surface sterilized seeds Alcaligenaceae Achromobacter sp. Landrace SYM00910 13 790 Maize Modern Surface sterilized seeds Alcaligenaceae Achromobacter sp. SYM00914 13 794 Maize Modern Surface sterilized seeds Alcaligenaceae Achromobacter sp. SYM00917 13 796 Maize Modern Surface sterilized seeds Alcaligenaceae Achromobacter sp. SYM00929 13 806 Wild Surface sterilized seeds Alcaligenaceae Achromobacter sp. relative SYM00930 13 807 Rice Modern Surface sterilized seeds Alcaligenaceae Achromobacter sp. SYM00938 13 813 Rice Modern Surface sterilized seeds Alcaligenaceae Achromobacter sp. SYM00957 13 829 Rice Ancient Surface sterilized seeds Alcaligenaceae Achromobacter sp. Landrace SYM00959 13 830 Rice Ancient Surface sterilized seeds Alcaligenaceae Achromobacter sp. Landrace SYM01017 13 875 Rice Modern Surface sterilized seeds Alcaligenaceae Achromobacter sp. SYM01020 13 877 Rice Modern Surface sterilized seeds Alcaligenaceae Achromobacter sp. SYM01021 13 878 Wild Surface sterilized seeds Alcaligenaceae Achromobacter sp. relative SYM01030 13 884 Wild Surface sterilized seeds Alcaligenaceae Achromobacter sp. relative SYM00028 18 540 Maize Ancient Surface sterilized seeds Enterobacteriaceae Enterobacter sp. Landrace SYM00052 18 550 Teosinte Wild Surface sterilized seeds Enterobacteriaceae Enterobacter sp. relative SYM00053 18 551 Teosinte Wild Surface sterilized seeds Enterobacteriaceae Enterobacter sp. relative SYM00054 18 552 Teosinte Wild Surface sterilized seeds Enterobacteriaceae Enterobacter sp. relative SYM00175 18 595 Winter rye Modern Surface sterilized seeds Enterobacteriaceae Enterobacter sp. SYM00627 18 725 Maize Modern Seed surface wash Enterobacteriaceae Enterobacter sp. SYM00715 18 751 Rice Modern Seed surface wash Enterobacteriaceae Enterobacter sp. SYM00189 19 606 Maize Modern Leaves Bacillaceae Bacillus sp. SYM00192 19 608 Maize Modern Leaves Bacillaceae Bacillus sp. SYM00197 19 611 Maize Modern Leaves Bacillaceae Bacillus sp. SYM00201 19 612 Maize Maize Roots Bacillaceae Bacillus sp. SYM00202 19 613 Maize Maize Roots Bacillaceae Bacillus sp. SYM00215 19 615 Soybean Modern Roots Bacillaceae Bacillus sp. SYM00233 19 621 Soybean Modern Leaves Bacillaceae Bacillus sp. SYM00260 19 632 Maize Modern Surface sterilized seeds Bacillaceae Bacillus simplex SYM01113 19 920 Maize Modern Roots Bacillaceae Bacillus sp. SYM01119 19 924 Maize Ancient Roots Bacillaceae Bacillus sp. Landrace SYM00016b 25 529 Rice Modern Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. SYM00236 25 623 Rice Modern Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. SYM00237 25 624 Rice Modern Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. SYM00240 25 625 Rice Modern Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. SYM00924 25 803 Rice Ancient Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. Landrace SYM00936 25 811 Rice Modern Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. SYM00950 25 824 Rice Ancient Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. Landrace SYM00968 25 838 Rice Ancient Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. Landrace SYM00986 25 852 Rice Modern Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. SYM00998 25 861 Wild Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. relative SYM00999 25 862 Wild Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. relative SYM01003 25 864 Rice Modern Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. SYM01008 25 868 Rice Modern Surface sterilized seeds Methylobacteriaceae Methylobacterium sp. SYM00501 27 638 Maize Ancient Seed surface wash Burkholderiaceae Burkholderia sp. Landrace SYM00504 27 640 Maize Ancient Seed surface wash Burkholderiaceae Burkholderia sp. Landrace SYM00536 27 656 Maize Ancient Seed surface wash Burkholderiaceae Burkholderia sp. Landrace SYM00536A 27 657 Maize Ancient Seed surface wash Burkholderiaceae Burkholderia sp. Landrace SYM00538E 27 659 Maize Ancient Seed surface wash Burkholderiaceae Burkholderia sp. Landrace SYM00566A 27 682 Maize Modern Seed surface wash Burkholderiaceae Burkholderia sp. SYM00568 27 683 Maize Modern Seed surface wash Burkholderiaceae Burkholderia sp. SYM00570 27 684 Maize Modern Seed surface wash Burkholderiaceae Burkholderia sp. SYM00574 27 685 Maize Ancient Seed surface wash Burkholderiaceae Burkholderia sp. Landrace SYM00575 27 686 Maize Ancient Seed surface wash Burkholderiaceae Burkholderia sp. Landrace SYM00578 27 687 Maize Modern Seed surface wash Burkholderiaceae Burkholderia sp. SYM00621 27 721 Maize Modern Seed surface wash Burkholderiaceae Burkholderia sp. SYM00623 27 722 Maize Modern Seed surface wash Burkholderiaceae Burkholderia sp. SYM00624 27 723 Maize Modern Seed surface wash Burkholderiaceae Burkholderia sp. SYM00633 27 727 Maize Ancient Seed surface wash Burkholderiaceae Burkholderia sp. Landrace SYM00822 27 776 Rice Modern Seed surface wash Burkholderiaceae Burkholderia sp. SYM01010 27 869 Rice Ancient Surface sterilized seeds Burkholderiaceae Burkholderia sp. Landrace SYM01012 27 871 Rice Ancient Surface sterilized seeds Burkholderiaceae Burkholderia sp. Landrace SYM01015 27 873 Rice Ancient Surface sterilized seeds Burkholderiaceae Burkholderia sp. Landrace SYM01037 27 889 Rice Modern Surface sterilized seeds Burkholderiaceae Burkholderia sp. SYM00037 28 543 Maize Modern Surface sterilized seeds Microbacteriaceae Bacillus sp. SYM00051 28 549 Teosinte Wild Surface sterilized seeds Microbacteriaceae Microbacterium sp. relative SYM00104 28 582 Maize Ancient Surface sterilized seeds Microbacteriaceae Microbacterium sp. Landrace SYM00177 28 597 Wild Surface sterilized seeds Microbacteriaceae Microbacterium sp. relative SYM00514A 28 648 Maize Ancient Seed surface wash Microbacteriaceae Microbacterium sp. Landrace SYM00523 28 652 Wild Seed surface wash Microbacteriaceae Microbacterium sp. relative SYM00538H 28 660 Maize Ancient Seed surface wash Microbacteriaceae Microbacterium sp. Landrace SYM00542 28 661 Maize Ancient Seed surface wash Microbacteriaceae Microbacterium sp. Landrace SYM00556 28 674 Maize Ancient Seed surface wash Microbacteriaceae Microbacterium sp. Landrace SYM00581A 28 695 Maize Modern Seed surface wash Microbacteriaceae Microbacterium sp. SYM00586c 28 703 Maize Ancient Seed surface wash Microbacteriaceae Microbacterium sp. Landrace SYM00587 28 704 Maize Ancient Seed surface wash Microbacteriaceae Microbacterium sp. Landrace SYM00598 28 712 Maize Ancient Seed surface wash Microbacteriaceae Microbacterium sp. Landrace SYM00757 28 762 Maize Modern Seed surface wash Microbacteriaceae Microbacterium sp. SYM00760 28 764 Maize Modern Seed surface wash Microbacteriaceae Microbacterium sp. SYM00780 28 771 Maize Modern Seed surface wash Microbacteriaceae Microbacterium sp. SYM00832 28 781 Rice Ancient Seed surface wash Microbacteriaceae Microbacterium sp. Landrace SYM00911 28 791 Maize Modern Surface sterilized seeds Microbacteriaceae Microbacterium sp. SYM00912 28 792 Maize Ancient Surface sterilized seeds Microbacteriaceae Microbacterium sp. Landrace SYM00913 28 793 Maize Ancient Surface sterilized seeds Microbacteriaceae Microbacterium sp. Landrace SYM00915 28 795 Maize Modern Surface sterilized seeds Microbacteriaceae Microbacterium sp. SYM00918 28 797 Maize Ancient Surface sterilized seeds Microbacteriaceae Microbacterium sp. Landrace SYM00919 28 798 Maize Ancient Surface sterilized seeds Microbacteriaceae Microbacterium sp. Landrace SYM00920 28 799 Maize Ancient Surface sterilized seeds Microbacteriaceae Microbacterium sp. Landrace SYM00921 28 800 Maize Modern Surface sterilized seeds Microbacteriaceae Microbacterium sp. SYM00922 28 801 Maize Modern Surface sterilized seeds Microbacteriaceae Microbacterium sp. SYM00931 28 808 Rice Modern Surface sterilized seeds Microbacteriaceae Microbacterium sp. SYM00933 28 809 Rice Modern Surface sterilized seeds Microbacteriaceae Microbacterium sp. SYM00939 28 814 Rice Modern Surface sterilized seeds Microbacteriaceae Microbacterium sp. SYM00944 28 819 Rice Modern Surface sterilized seeds Microbacteriaceae Microbacterium sp. SYM00962 28 832 Rice Ancient Surface sterilized seeds Microbacteriaceae Microbacterium sp. Landrace SYM01000 28 863 Wild Surface sterilized seeds Microbacteriaceae Microbacterium sp. relative SYM01034 28 886 Wild Surface sterilized seeds Microbacteriaceae Microbacterium sp. relative SYM01206 28 968 Rice Modern Roots & Seeds Microbacteriaceae Microbacterium sp. SYM00015 29 528 Rice Modern Surface sterilized seeds Xanthomonadaceae Xanthomonas sp. SYM00021 29 536 Teosinte Wild Surface sterilized seeds Xanthomonadaceae Xanthomonas sp. relative SYM00179 29 599 Rice Ancient Surface sterilized seeds Xanthomonadaceae Xanthomonas sp. Landrace SYM00182 29 602 Rice Ancient Surface sterilized seeds Xanthomonadaceae Xanthomonas sp. Landrace SYM00252 29 630 Rice Ancient Surface sterilized seeds Xanthomonadaceae Xanthomonas sp. Landrace SYM00977 29 845 Rice Ancient Surface sterilized seeds Xanthomonadaceae Xanthomonas sp. Landrace SYM00988 29 854 Rice Modern Surface sterilized seeds Xanthomonadaceae Xanthomonas sp. SYM00997 29 860 Wild Surface sterilized seeds Xanthomonadaceae Xanthomonas sp. relative SYM01018 29 876 Rice Modern Surface sterilized seeds Xanthomonadaceae Xanthomonas sp. SYM01028 29 882 Wild Surface sterilized seeds Xanthomonadaceae Xanthomonas sp. relative SYM01146 29 930 Rice Modern Roots & Seeds Xanthomonadaceae Xanthomonas sp. SYM01153 29 933 Rice Modern Roots & Seeds Xanthomonadaceae Xanthomonas sp. SYM01154 29 934 Rice Modern Roots & Seeds Xanthomonadaceae Xanthomonas sp. SYM01162 29 939 Rice Ancient Roots & Seeds Xanthomonadaceae Xanthomonas sp. Landrace SYM01190 29 959 Rice Modern Roots & Seeds Xanthomonadaceae Xanthomonas sp. SYM00565A 30 680 Maize Modern Seed surface wash Nocardiaceae Rhodococcus sp. SYM00580G 30 693 Maize Modern Seed surface wash Nocardiaceae Rhodococcus sp. SYM00753 30 760 Maize Modern Seed surface wash Nocardiaceae Rhodococcus sp. SYM00762 30 766 Maize Modern Seed surface wash Nocardiaceae Rhodococcus sp. SYM00775 30 770 Maize Modern Seed surface wash Nocardiaceae Rhodococcus sp. SYM00943 30 818 Rice Modern Surface sterilized seeds Nocardiaceae Rhodococcus sp. SYM00951 30 825 Rice Ancient Surface sterilized seeds Nocardiaceae Rhodococcus sp. Landrace SYM01039 30 890 Rice Ancient Surface sterilized seeds Nocardiaceae Rhodococcus sp. Landrace SYM01040 30 891 Rice Ancient Surface sterilized seeds Nocardiaceae Rhodococcus sp. Landrace SYM01042 30 893 Rice Modern Surface sterilized seeds Nocardiaceae Rhodococcus sp. SYM01046 30 895 Rice Modern Surface sterilized seeds Nocardiaceae Rhodococcus sp. SYM01048 30 897 Wild Surface sterilized seeds Nocardiaceae Rhodococcus sp. relative SYM01053 30 900 Maize Modern Surface sterilized seeds Nocardiaceae Rhodococcus sp. SYM01063 30 905 Maize Modern Surface sterilized seeds Nocardiaceae Rhodococcus sp. SYM01065 30 907 Maize Ancient Surface sterilized seeds Nocardiaceae Rhodococcus sp. Landrace SYM01070 30 910 Rice Modern Surface sterilized seeds Nocardiaceae Rhodococcus sp. SYM01071 30 911 Maize Ancient Surface sterilized seeds Nocardiaceae Rhodococcus sp. Landrace SYM01078 30 912 Rice Modern Surface sterilized seeds Nocardiaceae Rhodococcus sp. SYM00589 31 707 Maize Ancient Seed surface wash Paenibacillaceae Paenibacillus sp. Landrace SYM00991 36 855 Rice Modern Surface sterilized seeds Comamonadaceae Acidovorax sp. SYM01236 36 985 Wild Roots & Seeds Comamonadaceae Acidovorax sp. relative SYM00057B 37 1446 Maize Ancient Surface sterilized seeds Burkholderiaceae Burkholderia Landrace phytofirmans SYM00102 38 581 Maize Ancient Surface sterilized seeds Staphylococcaceae Staphylococcus sp. Landrace SYM00072 39 566 Teosinte Wild Surface sterilized seeds Bacillaceae Bacillus sp. relative SYM00075 39 567 Teosinte Wild Surface sterilized seeds Bacillaceae Bacillus sp. relative SYM00249 39 628 Soybean Modern Surface sterilized seeds Bacillaceae Bacillus sp. SYM00507 39 645 Maize Ancient Seed surface wash Bacillaceae Bacillus sp. Landrace SYM00553 39 671 Maize Ancient Seed surface wash Bacillaceae Bacillus sp. Landrace SYM00562 39 677 Maize Ancient Seed surface wash Bacillaceae Bacillus sp. Landrace SYM00564 39 679 Maize Ancient Seed surface wash Bacillaceae Bacillus sp. Landrace SYM00580E 39 692 Maize Modern Seed surface wash Bacillaceae Bacillus sp. SYM00581b 39 696 Maize Modern Seed surface wash Bacillaceae Bacillus sp. SYM00581c 39 697 Maize Modern Seed surface wash Bacillaceae Bacillus sp. SYM00601 39 714 Maize Ancient Seed surface wash Bacillaceae Bacillus sp. Landrace SYM00036 41 542 Maize Modern Surface sterilized seeds Bacillaceae Bacillus sp. SYM00110 41 586 Maize Modern Surface sterilized seeds Bacillaceae Bacillus sp. SYM00193 41 609 Maize Modern Leaves Bacillaceae Bacillus sp. SYM00218 41 617 Soybean Modern Roots Bacillaceae Bacillus sp. SYM00250 41 629 Soybean Modern Surface sterilized seeds Bacillaceae Bacillus sp. SYM00697 41 745 Rice Modern Seed surface wash Bacillaceae Bacillus sp. SYM00704 41 746 Rice Modern Seed surface wash Bacillaceae Bacillus sp. SYM00017c 45 533 Rice Modern Surface sterilized seeds Sphingomonadaceae Sphingomonas sp. SYM00062b 45 558 Teosinte Wild Surface sterilized seeds Sphingomonadaceae Sphingomonas sp. relative SYM00065 45 561 Teosinte Wild Surface sterilized seeds Sphingomonadaceae Sphingomonas sp. relative SYM00168 45 589 Rice Modern Surface sterilized seeds Sphingomonadaceae Sphingomonas sp. SYM00169 45 590 Rice Modern Surface sterilized seeds Sphingomonadaceae Sphingomonas sp. SYM00942 45 817 Rice Modern Surface sterilized seeds Sphingomonadaceae Sphingomonas sp. SYM00994 45 858 Wild Surface sterilized seeds Sphingomonadaceae Sphingomonas sp. relative SYM01016 45 874 Rice Modern Surface sterilized seeds Sphingomonadaceae Sphingomonas sp. SYM01174 45 944 Rice Ancient Roots & Seeds Sphingomonadaceae Sphingomonas sp. Landrace SYM01176 45 946 Rice Ancient Roots & Seeds Sphingomonadaceae Sphingomonas sp. Landrace SYM01187 45 956 Rice Modern Roots & Seeds Sphingomonadaceae Sphingomonas sp. SYM01191 45 960 Rice Modern Roots & Seeds Sphingomonadaceae Sphingomonas sp. SYM01214 45 970 Rice Modern Roots & Seeds Sphingomonadaceae Sphingomonas sp. SYM01216 45 972 Rice Modern Roots & Seeds Sphingomonadaceae Sphingomonas sp. SYM00231 46 620 Soybean Modern Leaves Sphingomonadaceae Sphingobium sp. SYM00975 51 843 Rice Ancient Surface sterilized seeds Oxalobacteraceae Herbaspirillum sp. Landrace SYM00506c 53 643 Maize Ancient Seed surface wash Paenibacillaceae Paenibacillus sp. Landrace SYM00506D 53 644 Maize Ancient Seed surface wash Paenibacillaceae Paenibacillus sp. Landrace SYM00545 53 664 Maize Ancient Seed surface wash Paenibacillaceae Paenibacillus sp. Landrace SYM00549 53 668 Maize Ancient Seed surface wash Paenibacillaceae Paenibacillus sp. Landrace SYM00554 53 672 Maize Ancient Seed surface wash Paenibacillaceae Paenibacillus sp. Landrace SYM00555 53 673 Maize Ancient Seed surface wash Paenibacillaceae Paenibacillus sp. Landrace SYM00012 55 1447 Teosinte Wild Surface sterilized seeds Microbacteriaceae Microbacterium relative binotii SYM00046 56 545 Maize Ancient Surface sterilized seeds Enterobacteriaceae Enterobacter sp. Landrace SYM00050 56 548 Maize Ancient Surface sterilized seeds Enterobacteriaceae Enterobacter sp. Landrace SYM00628 56 726 Maize Modern Seed surface wash Enterobacteriaceae Enterobacter sp. SYM01049 56 898 Teosinte Wild Surface sterilized seeds Enterobacteriaceae relative SYM00106 59 583 Maize Ancient Surface sterilized seeds Micrococcaceae Micrococcus sp. Landrace SYM00107 59 584 Maize Ancient Surface sterilized seeds Micrococcaceae Micrococcus sp. Landrace SYM00108 59 585 Maize Ancient Surface sterilized seeds Micrococcaceae Micrococcus sp. Landrace SYM00254 59 631 Maize Modern Surface sterilized seeds Micrococcaceae Micrococcus sp. SYM00090 62 575 Maize Ancient Surface sterilized seeds Flavobacteriaceae Chryseobacterium sp. Landrace SYM00002 66 521 Teosinte Wild Surface sterilized seeds Rhizobiaceae Agrobacterium sp. s relative SYM00017a 66 531 Rice Modern Surface sterilized seeds Rhizobiaceae Agrobacterium sp. SYM00326 66 635 Maize Modern Roots Rhizobiaceae Agrobacterium tumefaciens SYM00714 66 750 Rice Modern Seed surface wash Rhizobiaceae Agrobacterium sp. SYM00983 66 849 Rice Modern Surface sterilized seeds Rhizobiaceae Agrobacterium sp. SYM01004 66 865 Rice Modern Surface sterilized seeds Rhizobiaceae Agrobacterium sp. SYM00060 67 556 Maize Ancient Surface sterilized seeds Staphylococcaceae Staphylococcus sp. Landrace SYM00113 67 587 Maize Modern Surface sterilized seeds Staphylococcaceae Staphylococcus sp. SYM01257 67 992 Rice Ancient Roots & Seeds Staphylococcaceae Staphylococcus sp. Landrace SYM01259 67 993 Rice Ancient Roots & Seeds Staphylococcaceae Staphylococcus sp. Landrace SYM00071 76 565 Teosinte Wild Surface sterilized seeds Bacillaceae Bacillus sp. relative SYM00204 76 614 Maize Maize Roots Bacillaceae Bacillus sp. SYM00563 76 678 Maize Ancient Seed surface wash Bacillaceae Bacillus sp. Landrace SYM00617 76 719 Teosinte Wild Seed surface wash Bacillaceae Bacillus sp. relative SYM00016c 82 530 Rice Modern Surface sterilized seeds Xanthomonadaceae Luteibacter sp. SYM00960 82 831 Rice Ancient Surface sterilized seeds Xanthomonadaceae Luteibacter sp. Landrace SYM00965 82 835 Rice Ancient Surface sterilized seeds Xanthomonadaceae Luteibacter sp. Landrace SYM01167 82 941 Rice Ancient Roots & Seeds Xanthomonadaceae Luteibacter sp. Landrace SYM00940 83 815 Rice Modern Surface sterilized seeds Enterobacteriaceae SYM00941 83 816 Rice Modern Surface sterilized seeds Enterobacteriaceae SYM00963 83 833 Rice Ancient Surface sterilized seeds Enterobacteriaceae Landrace SYM00972 83 841 Rice Ancient Surface sterilized seeds Enterobacteriaceae Landrace SYM00987 83 853 Rice Modern Surface sterilized seeds Enterobacteriaceae SYM00713 84 749 Rice Modern Seed surface wash Enterobacteriaceae Erwinia sp. SYM00945 84 820 Rice Modern Surface sterilized seeds Enterobacteriaceae SYM01103 84 914 Rice Modern Surface sterilized seeds Enterobacteriaceae SYM01138 84 926 Wild Roots & Seeds Enterobacteriaceae relative SYM01139 84 927 Wild Roots & Seeds Enterobacteriaceae relative SYM01180 84 950 Rice Modern Roots & Seeds Enterobacteriaceae SYM01189 84 958 Rice Modern Roots & Seeds Enterobacteriaceae SYM01193 84 961 Rice Modern Roots & Seeds Enterobacteriaceae SYM01226 84 976 Rice Modern Roots & Seeds Enterobacteriaceae SYM01229 84 978 Rice Modern Roots & Seeds Enterobacteriaceae Pantoea sp. SYM01230 84 979 Rice Modern Roots & Seeds Enterobacteriaceae SYM00992 126 856 Wild Surface sterilized seeds Sphingomonadaceae Sphingomonas sp. relative SYM00063 134 559 Teosinte Wild Surface sterilized seeds Microbacteriaceae Microbacterium sp. relative SYM00226 134 618 Soybean Modern Leaves Microbacteriaceae Microbacterium sp. SYM00246 134 627 Barley Modern Surface sterilized seeds Microbacteriaceae Microbacterium sp. SYM00524 134 653 Wild Seed surface wash Microbacteriaceae Microbacterium sp. relative SYM00694a 134 743 Rice Modern Seed surface wash Microbacteriaceae Microbacterium sp. SYM01234 134 983 Wild Roots & Seeds Microbacteriaceae Microbacterium sp. relative SYM00199 135 1448 Maize Maize Roots Bacillaceae Bacillus sp. SYM00172 146 592 Rice Modern Surface sterilized seeds Enterobacteriaceae Pantoea sp. SYM00527 146 655 Wild Seed surface wash Enterobacteriaceae Erwinia sp. relative SYM00644 146 728 Rice Modern Seed surface wash Enterobacteriaceae Erwinia sp. SYM00648 146 732 Rice Modern Seed surface wash Enterobacteriaceae SYM00966 146 836 Rice Ancient Surface sterilized seeds Enterobacteriaceae Landrace SYM00978 146 846 Rice Ancient Surface sterilized seeds Enterobacteriaceae Landrace SYM00981 146 848 Rice Modern Surface sterilized seeds Enterobacteriaceae SYM01011 146 870 Rice Ancient Surface sterilized seeds Enterobacteriaceae Erwinia sp. Landrace SYM01159 146 938 Wild Roots & Seeds Enterobacteriaceae relative SYM01175 146 945 Rice Ancient Roots & Seeds Enterobacteriaceae Landrace SYM01232 146 981 Rice Modern Roots & Seeds Enterobacteriaceae SYM01244 146 987 Rice Ancient Roots & Seeds Enterobacteriaceae Landrace SYM00538A 172 658 Maize Ancient Seed surface wash Sphingomonadaceae Sphingomonas sp. Landrace SYM00508 196 646 Maize Ancient Seed surface wash Enterobacteriaceae Landrace Example 4—In-Vitro Characterization of Bacterial Endophytes
Experiment 1
Functional assays to examine the potential for seed-origin microbes to confer novel functions to crops. Legend “—“ indicates no significant increase; “1” = low activity; “2” = medium activity; “3” = high activity An- An- tag- tag- o- Shows Shows Sec- Phos- o- nizes Cellu- Pecti- retes phate ACC Pro- Pro- ni- loly- noly- side- Solu- Growth Deam- duces duc- SEQ zes tic tic ro- bili- on N inase Auxin/ es Sym ID activ- activ- pho- za- Free Activ- In- Ace- Strain ID NO: Habitat origin Taxonomy ity ity res tion LGI ity doles toin SYM00033 541 Mexico, Mexico Enterobacter sp. — — 1 1 1 2 — — 3 — SYM00173 593 Louisiana, USA Pantoea sp. 2 — 1 1 — 2 Yes — 3 1 SYM00176 596 India Pantoea sp. 1 — 1 1 2 1 — — 2 1 SYM00605 716 Ancash, Peru — — 1 1 2 2 — — 1 — SYM00607 717 Ancash, Peru — — — — 2 2 — — 1 2 SYM00608 718 Ancash, Peru Pantoea sp. — — — — 1 — — 1 1 1 SYM00620 720 Ancash, Peru Enterobacter sp. — 1 1 1 — 1 — — 2 2 SYM00658 736 Holot Yavne, Israel 1 1 1 1 — 2 — 1 2 3 SYM00660 737 Holot Yavne, Israel Pseudomonas sp. — 1 2 2 1 — — 1 — 1 SYM00011 522 Durango, Mexico Pseudomonas sp. — — — — — 1 Yes — 2 — SYM00011b 523 Durango, Mexico Pseudomonas sp. — — — — — — — — — 1 SYM00013 524 Durango, Mexico Pseudomonas sp. — — 2 2 2 — Yes — 2 — SYM00014 526 Durango, Mexico Pseudomonas sp. — — 2 2 1 — Yes — 2 — SYM00062 557 Michoacan, Mexico Pseudomonas sp. — — 2 2 2 — — 1 2 — SYM00068 563 Michoacan, Mexico Pseudomonas sp. — — 2 2 2 1 — 3 2 — SYM00069 564 Michoacan, Mexico Pseudomonas sp. — — — — — — — — — 2 SYM00646 730 Segou, Mali Pseudomonas sp. — — 2 2 3 — — — 2 — SYM00649 733 Segou, Mali Pseudomonas sp. — — 2 2 1 — — 3 2 — SYM00650 734 Segou, Mali Pseudomonas sp. — 1 2 2 — — — 3 2 — SYM00657 735 Holot Yavne,Israel Pseudomonas sp. — — 2 2 — — — 3 2 — SYM00672 738 Valle, Honduras Pseudomonas sp. — — 2 2 2 1 — 3 1 — SYM00709 747 Guandong, China seudomonas sp. — — 3 3 — — — — — 3 SYM00013b 525 Durango, Mexico Curtobacterium sp. — — — — — — — — — 1 SYM00167 588 Unknown Curtobacterium sp. — — — — — — — — 1 — SYM00171 591 Louisiana, USA Curtobacterium sp. — — — — 2 — — — 1 — SYM00174 594 Unknown Curtobacterium sp. — — — — — — — — 1 1 SYM00178 598 Guandong, China Curtobacterium sp. — — 1 1 1 — — — — 1 SYM00180 600 Guandong, China Curtobacterium sp. — — — — — — — — — 1 SYM00181 601 Guandong, China Curtobacterium sp. — — — — — — — — — 2 SYM00235 622 Louisiana, USA Curtobacterium sp. — — 1 1 — 1 Yes — 3 3 SYM00244 626 Curtobacterium sp. — — 1 1 — 1 — — — 1 SYM00525 654 Rangoon, Myanmar Curtobacterium sp. — — — — — — — — 2 1 SYM00625 724 Indiana, USA Curtobacterium sp. — — 2 2 — — — 1 1 — SYM00645 729 Segou, Mali Curtobacterium sp. — — — — 3 — — 3 1 — SYM00647 731 Segou, Mali Curtobacterium sp. — — 1 1 — — — — 1 3 SYM00690 740 Hunan, China Curtobacterium sp. — — — — — — — 1 1 1 SYM00691 741 Hunan, China Curtobacterium sp. — — — — — — — 1 — 1 SYM00693 742 Hunan, China Curtobacterium sp. — — 1 1 — — — 1 — 1 SYM00712 748 Guandong, China Curtobacterium sp. — — 1 1 — — — 1 1 — SYM00716 752 Louisiana, USA Curtobacterium sp. — — — — — — — 1 1 1 SYM00722 753 Louisiana, USA Curtobacterium sp. — — 1 1 — — — 1 1 — SYM00731B 756 Louisiana, USA Curtobacterium sp. — — — — — — — 1 1 — SYM00784 773 Thailand Curtobacterium sp. 2 — — — — — — — 1 — SYM00188 605 USA Paenibacillus sp. — — — — — — — — — 2 SYM00190 607 USA Paenibacillus sp. — — 1 1 — 1 — — — — SYM00195 610 USA Paenibacillus sp. — — — — — 2 — — — 2 SYM00217 616 Unknown Paenibacillus sp. — — — — — 2 — — — — SYM00227 619 Unknown Paenibacillus sp. — — 1 1 — 1 — 1 — — SYM00597 711 Peru Paenibacillus sp. — — — — — 1 — — — 3 SYM00017b 532 Arkansas, USA Pantoea sp. — — 1 1 — 2 — — 3 — SYM00018 534 USA Pantoea sp. — — — — — — — — 2 — SYM00020 535 USA Pantoea sp. — — — — — 1 Yes — 3 — SYM00022 537 Guererro, Mexico Pantoea sp. — — 1 1 1 — — — 2 — SYM00025 538 USA Pantoea sp. — — 1 1 — — — — 2 1 SYM00043 544 USA Pantoea sp. — — 1 1 1 2 Yes — 1 — SYM00047 546 USA Pantoea sp. — — 1 1 — 2 — — 1 1 SYM00049 547 USA Pantoea sp. — — — — 1 — — — 3 1 SYM00055 553 USA Pantoea sp. — — 1 1 1 2 — — — — SYM00057 554 USA Pantoea sp. — — — — — — — — — 1 SYM00058 555 USA Pantoea sp. — — — — — — — — — 3 SYM00078 568 Columbia Pantoea sp. 3 1 1 1 1 2 Yes — 3 — SYM00081 569 USA Pantoea sp. — — 1 1 1 2 Yes — 1 — SYM00082a 570 USA Pantoea sp. — — — — 1 — Yes — 1 — SYM00085 571 Cuba Pantoea sp. — — 1 1 1 2 — — 1 1 SYM00086 572 Peru Pantoea sp. — — 1 1 1 2 — — 1 1 SYM00088 574 Peru Pantoea sp. — — — — — — — — — 3 SYM00094 576 USA Pantoea sp. — — 1 1 1 2 Yes — 1 1 SYM00095 577 USA Pantoea sp. — — 1 1 1 2 Yes — 1 1 SYM00096 578 USA Pantoea sp. — — 1 1 1 — — — 1 1 SYM00100 579 USA Pantoea sp. 1 1 1 1 1 1 — — 3 — SYM00101 580 USA Pantoea sp. — — — — 1 — — — 2 — SYM00502 639 USA Erwinia sp. — — — — 1 1 — — 3 — SYM00506 641 USA Erwinia sp. — — 1 1 1 1 — — 3 1 SYM00506b 642 USA Erwinia sp. — 1 1 1 1 1 — — 3 3 SYM00511 647 Virgin Islands, Erwinia sp. — — — — — — — — 2 1 USA SYM00514b 649 Virgin Islands, Erwinia sp. — — — — — 2 — — 3 3 USA SYM00514C 650 Virgin Islands, Erwinia sp. — — — — — — — 3 — 1 USA SYM00514D 651 Virgin Islands, Erwinia sp. — — — — — — — — 2 3 USA SYM00731A 755 Louisiana, USA Erwinia sp. — — 1 1 — 1 — 1 2 — SYM00785 774 Thailand Erwinia sp. 1 1 1 1 — 2 — 1 2 — SYM00544 663 Ecuador Ochrobactrum sp. — 1 — — — 1 — — 3 — SYM00545B 665 Ecuador Ochrobactrum sp. — 1 — — — — — — 2 — SYM00548 667 Magdalena, Ochrobactrum sp. — 1 — — — 1 — — 2 — Colombia SYM00552 670 Magdalena, Ochrobactrum sp. — 1 — — — — — — 2 1 Colombia SYM00558 675 Narino, Colombia Ochrobactrum sp. — 1 — — — 1 — — 2 — SYM00580b 689 Peru Ochrobactrum sp. — 1 — — — — — — 1 — SYM00580d 691 Peru Ochrobactrum sp. — 1 — — — — — — 2 — SYM00583 699 Columbia Ochrobactrum sp. — 1 — — — 1 — — 2 — SYM00584 700 Columbia Ochrobactrum sp. — — — — — 1 — — 2 — SYM00588 705 Columbia Ochrobactrum sp. — 1 — — — 2 — — 2 2 SYM00596 710 Peru Ochrobactrum sp. — 1 — — — 1 — — 2 3 SYM00600 713 Peru Ochrobactrum sp. — 1 — — — 2 — — 2 — SYM00746 757 South Korea Ochrobactrum sp. 1 1 — — — 1 — 1 1 1 SYM00752 759 Mexico, Mexico Ochrobactrum sp. 1 1 — — — 1 — 1 2 — SYM00756 761 Mexico, Mexico Ochrobactrum sp. 1 — — — — 1 — 1 1 — SYM00763 767 Mexico, Mexico Ochrobactrum sp. 1 — — — — 1 — — 2 — SYM00783 772 Thailand Ochrobactrum sp. 1 1 — — — 1 — — 2 — SYM00812 775 Ashanti, Ghana Ochrobactrum sp. — — — — — — — — 2 — SYM00064a 560 Michoacan, Mexico Stenotrophomonas — — — — — — — — 1 — sp. SYM00183 603 Amazonas, Brazil Stenotrophomonas — — — — — — — — 1 2 sp. SYM00184 604 Amazonas, Brazil Stenotrophomonas — — — — — — — — 1 3 sp. SYM00543 662 Ecuador Bacillus sp. 1 1 — — — — — — 1 — SYM00595 709 Peru Bacillus sp. 1 1 — — — — — — 1 — SYM00580C 690 Peru Achromobacter sp. — — — — 1 — — 1 1 — SYM00547 666 Magdalena, Achromobacter sp. — — — — 2 — — 1 1 — Colombia SYM00551 669 Magdalena, Achromobacter sp. — 1 — — 1 — — 2 1 — Colombia SYM00560 676 Narino, Colombia Achromobacter sp. — — — — 1 — — — 2 — SYM00565B 681 Mexico Achromobacter sp. — — — — 1 1 — 1 1 1 SYM00580i 694 Peru Achromobacter sp. — 1 — — — — — — 1 — SYM00585 701 Columbia Achromobacter sp. — — — — 1 2 — 1 2 — SYM00586b 702 Columbia Achromobacter sp. — 1 — — 2 — — — 2 — SYM00588b 706 Columbia Achromobacter sp. — — — — — — — — 3 2 SYM00591 708 Peru Achromobacter sp. — — — — — — — 3 1 — SYM00602 715 Ancash, Peru Achromobacter sp. — — — — 3 — — — 1 2 SYM00758 763 Mexico, Mexico Achromobacter sp. — — — — — — — 3 1 — SYM00761 765 Mexico, Mexico Achromobacter sp. — — — — 1 — — 1 — — SYM00764 768 Mexico, Mexico Achromobacter sp. — — — — 1 — — 1 1 — SYM00765 769 Mexico, Mexico Achromobacter sp. — — — — — — — — — 3 SYM00824 777 Kabul, Afghanistan Achromobacter sp. — 1 — — — — — 3 1 — SYM00828 778 Kabul, Afghanistan Achromobacter sp. — — — — 1 — — — 1 — SYM00830 779 Kabul, Afghanistan Achromobacter sp. — — — — — — — 3 1 — SYM00831 780 Kabul, Afghanistan Achromobacter sp. — — — — 1 1 — 1 1 — SYM00028 540 Arizona, U.S. Enterobacter sp. 1 1 1 1 — 1 — — 1 3 SYM00052 550 Guererro, Mexico Enterobacter sp. — — 1 1 — 1 — — 1 1 SYM00053 551 Guererro, Mexico Enterobacter sp. — — 1 1 — 1 — — — 1 SYM00054 552 Guererro, Mexico Enterobacter sp. — — — — 1 — — — — 3 SYM00175 595 Unknown Enterobacter sp. — — 1 1 1 2 Yes — 1 — SYM00627 725 Indiana, USA Enterobacter sp. 1 2 1 1 — 2 — 1 — 3 SYM00715 751 Guandong, China Enterobacter sp. — — — — — 2 — 1 — 2 SYM00189 606 USA Bacillus sp. — — — — — — — — — 1 SYM00192 608 USA Bacillus sp. — — — — — — — — — — SYM00197 611 USA Bacillus sp. — — — — — — — — 1 2 SYM00201 612 USA Bacillus sp. — — — — — — — — 1 — SYM00202 613 USA Bacillus sp. — — — — — 2 — — — — SYM00215 615 Unknown Bacillus sp. — — — — — — — — — 3 SYM00233 621 Unknown Bacillus sp. — — — — — — Yes — 2 1 SYM00016b 529 Arkansas, USA Methylobacterium — — 1 1 — — — — 1 1 sp. SYM00236 623 Louisiana, USA Methylobacterium — — 1 1 — 1 Yes 1 — — sp. SYM00237 624 Louisiana, USA Methylobacterium — — 1 1 — 1 Yes 1 2 — sp. SYM00240 625 Unknown Methylobacterium — — 1 1 — 1 Yes 3 — — sp. SYM00501 638 USA Burkholderia sp. 3 1 — — 2 — — 3 2 — SYM00504 640 USA Burkholderia sp. 3 1 — — 2 — — 3 2 — SYM00536 656 Oyo, Nigeria Burkholderia sp. 3 1 — — 3 1 — 1 2 — SYM00538E 659 Oyo, Nigeria Burkholderia sp. 1 1 — — 2 1 — 3 1 — SYM00566A 682 Mexico Burkholderia sp. 2 1 — — 2 — — 3 — 3 SYM00568 683 Mexico Burkholderia sp. 2 1 — — 2 — — 3 1 — SYM00570 684 Mexico Burkholderia sp. 2 1 — — 2 1 — 3 1 — SYM00574 685 Haiti Burkholderia sp. 2 1 — — 2 1 — 3 1 1 SYM00575 686 Haiti Burkholderia sp. 3 1 — — 2 1 — 3 1 — SYM00578 687 Peru Burkholderia sp. 2 1 — — 2 2 — 3 — — SYM00621 721 Indiana, USA Burkholderia sp. 1 1 — — 3 — — 3 1 — SYM00623 722 Indiana, USA Burkholderia sp. 1 1 — — 3 — — 3 — — SYM00624 723 Indiana, USA Burkholderia sp. 1 1 — — 3 — — 3 — — SYM00633 727 Peru Burkholderia sp. 1 1 1 1 — 2 — 1 3 3 SYM00822 776 Ashanti, Ghana Burkholderia sp. — — — — 3 1 — — — — SYM00037 543 USA Bacillus sp. — — — — — — — — — 2 SYM00051 549 Guererro, Mexico Microbacterium sp. — 2 — — 2 — — — 2 2 SYM00104 582 Peru Microbacterium sp. 1 — — — — — Yes — — — SYM00177 597 India Microbacterium sp. — — — — — — — — 1 3 SYM00514A 648 Virgin Islands, Microbacterium sp. — — — — — — — — 2 2 USA SYM00523 652 Rangoon, Myanmar Microbacterium sp. — — — — — — — — 2 2 SYM00538H 660 Oyo, Nigeria Microbacterium sp. — — — — — — — — — 2 SYM00542 661 Ecuador Microbacterium sp. — — 1 1 — — — — 1 1 SYM00556 674 Magdalena, Microbacterium sp. — — 1 1 — — — — 3 — Colombia SYM00581A 695 Peru Microbacterium sp. — — — — — — — — 2 3 SYM00586c 703 Columbia Microbacterium sp. — — 1 1 — — — — 2 2 SYM00587 704 Columbia Microbacterium sp. — — 2 2 — — — — 2 1 SYM00598 712 Peru Microbacterium sp. — — — — — — — — 1 2 SYM00757 762 Mexico, Mexico Microbacterium sp. — — — — — — — 1 — 3 SYM00760 764 Mexico, Mexico Microbacterium sp. — — — — — — — 1 — 2 SYM00780 771 Kentucky, USA Microbacterium sp. — — — — 1 — — — 1 — SYM00832 781 Kabul, Afghanistan Microbacterium sp. 1 — — — — — — — — 1 SYM00015 528 Arkansas, USA Xanthomonas sp. 1 — 2 2 2 — Yes — 1 1 SYM00021 536 Guererro, Mexico Xanthomonas sp. 2 — 3 3 2 — — — 2 — SYM00179 599 Guandong, China Xanthomonas sp. 1 — 2 2 — 1 — — 1 1 SYM00182 602 Guandong, China Xanthomonas sp. 1 — 1 1 — 1 — 1 3 3 SYM00252 630 Guandong, China Xanthomonas sp. — — — — — — Yes — — — SYM00565A 680 Mexico Rhodococcus sp. — 1 — — — 1 — — — — SYM00580G 693 Peru Rhodococcus sp. — 1 — — 2 1 — — 1 — SYM00753 760 Mexico, Mexico Rhodococcus sp. 1 1 — — — — Yes 1 1 2 SYM00762 766 Mexico, Mexico Rhodococcus sp. 1 — — — 1 1 Yes — 1 — SYM00775 770 Kentucky, USA Rhodococcus sp. 1 1 — — 2 1 Yes 1 1 — SYM00589 707 Columbia Paenibacillus sp. — — — — — — — — 3 2 SYM00057B 1446 USA Burkholderia — 1 1 1 1 1 Yes 3 1 — phytofirmans SYM00102 581 Colombia Staphylococcus sp. — — — — — — — — — 2 SYM00072 566 Durango, Mexico Bacillus sp. 2 — — — — — — — — 3 SYM00075 567 Durango, Mexico Bacillus sp. 2 — — — — — — — — 3 SYM00249 628 Guangxi, China Bacillus sp. — — — — — — — — — — SYM00507 645 USA Bacillus sp. 2 1 — — — — — — 2 1 SYM00553 671 Magdalena, Bacillus sp. — 1 — — — — — — — 1 Colombia SYM00562 677 Narino, Colombia Bacillus sp. 2 — — — — — — — — — SYM00564 679 Narino, Colombia Bacillus sp. 2 1 — — — — — — — — SYM00580E 692 Peru Bacillus sp. — 1 — — 1 — — — — 1 SYM00581b 696 Peru Bacillus sp. 2 — — — — — — — 2 3 SYM00581c 697 Peru Bacillus sp. — — — — — — — 1 1 3 SYM00601 714 Peru Bacillus sp. 1 — — — — — — — — 3 SYM00036 542 USA Bacillus sp. 3 2 — — — — — — — 3 SYM00110 586 Cuba Bacillus sp. 3 1 — — — — Yes — 1 — SYM00193 609 USA Bacillus sp. 3 — — — — — — — — 1 SYM00218 617 Unknown Bacillus sp. 3 1 — — — 1 — — — — SYM00250 629 Guangxi, China Bacillus sp. — 1 — — — 1 Yes — — — SYM00697 745 Northern Cameroon Bacillus sp. 3 3 — — — — — — — 3 SYM00704 746 Northern Cameroon Bacillus sp. 3 3 — — — — — — — 3 SYM00017c 533 Arkansas, USA Sphingomonas sp. — — 1 1 — — Yes — 2 1 SYM00062b 558 Michoacan, Mexico Sphingomonas sp. — — 1 1 — — — — 3 1 SYM00065 561 Michoacan, Mexico Sphingomonas sp. — — — — — — — — — 1 SYM00168 589 Unknown Sphingomonas sp. — 1 2 2 — 2 Yes — 2 1 SYM00169 590 Unknown Sphingomonas sp. — 1 2 2 — 2 Yes — 3 3 SYM00231 620 Unknown Sphingobium sp. — 1 2 2 1 2 Yes — 2 — SYM00975 843 South Korea Herbaspirillum sp. — — — — 2 2 — — — 3 SYM00506c 643 USA Paenibacillus sp. — — — — — — — — 3 1 SYM00506D 644 USA Paenibacillus sp. — — — — — — — — 2 — SYM00545 664 Ecuador Paenibacillus sp. — 1 — — — — — — 2 — SYM00549 668 Magdalena, Paenibacillus sp. — — — — — — — — 1 — Colombia SYM00554 672 Magdalena, Paenibacillus sp. — 1 — — — — — — 1 1 Colombia SYM00555 673 Magdalena, Paenibacillus sp. — 1 — — — — — — — — Colombia SYM00012 1447 Durango, Mexico Microbacterium 1 — — — — 1 — — 1 1 binotii SYM00046 545 USA Enterobacter sp. 1 3 1 1 2 1 — — 1 3 SYM00050 548 USA Enterobacter sp. — 2 1 1 1 1 — — 2 2 SYM00628 726 Indiana, USA Enterobacter sp. 1 1 1 1 — 1 — 1 3 3 SYM00106 583 Peru Micrococcus sp. — — 1 1 — — Yes — — — SYM00107 584 Peru Micrococcus sp. — — — — — — Yes — — 1 SYM00108 585 Peru Micrococcus sp. — — 1 1 — — Yes — — — SYM00090 575 USA Chryseobacterium 1 — — — 1 — — — — — sp. SYM00002 521 Durango, Mexico Agrobacterium sp. — — 2 2 — — — — 3 — SYM00017a 531 Arkansas, USA Agrobacterium sp. — — 2 2 — — — — 3 — SYM00714 750 Guandong, China Agrobacterium sp. — — 1 1 — — — 1 2 — SYM00060 556 Peru Staphylococcus sp. — — — — — — — — — 3 SYM00071 565 Durango, Mexico Bacillus sp. — — — — — — — — — 2 SYM00204 614 USA Bacillus sp. — — — — — — — — — — SYM00563 678 Narino, Colombia Bacillus sp. — — — — — — — — — — SYM00617 719 Ancash, Peru Bacillus sp. — — — — — — — — 1 2 SYM00960 831 Louisiana, USA Luteibacter sp. — — — — 2 — — — — 3 SYM00940 815 Zhejian, China — — — — — 1 — — — 3 SYM00713 749 Guandong, China Erwinia sp. — 1 1 1 1 1 — 1 2 1 SYM00992 856 Mindanao, Sphingomonas sp. — — — — — 2 — — — 2 Phillipines SYM00063 559 Michoacan, Mexico Microbacterium sp. 1 — — — — — — — 1 3 SYM00226 618 Unknown Microbacterium sp. — — — — — — — — — — SYM00246 627 Unknown Microbacterium sp. — 1 — — — — — — 1 1 SYM00524 653 Rangoon, Myanmar Microbacterium sp. — — — — — — — — 1 3 SYM00199 1448 USA Bacillus sp. — — — — — 2 — — — — SYM00172 592 Louisiana, USA Pantoea sp. 2 — 1 1 3 2 Yes — 3 3 SYM00527 655 Rangoon, Myanmar Erwinia sp. — — 1 1 — 1 — — 3 1 SYM00644 728 Segou, Mali Erwinia sp. — — 1 1 1 1 — 3 2 2 SYM00648 732 Segou, Mali 1 1 — — 1 2 — 1 1 3 SYM00538A 658 Oyo, Nigeria Sphingomonas sp. — — 1 1 — — — — 2 — SYM00508 646 USA — — 1 1 — 1 — — 2 — 3 1 1 1 3 1 3 9 3 3 1 3 2
ACC Deaminase Activity
12 1 1 15 9 3 5 3 2 3 1 7 2 1
Acetoin and Diacetyl Production
3 14 2 1 1 2 5 2 2
Pectinase Activity
Experiment 2
Experiment Description
% aggregation=(Results
Physico-chemical and growth-promoting characteristics of maize seed- associated endophytic bacteria Enterobacter sp. (FD17), Agrobacterium sp. (FA13), Pantoea sp. (FF34), Sphingobium (FC42), Pseudomonas sp. (FB12) and Micrococcus sp. (S2). Enterobacter Agrobacterium Pantoea Sphingobium Pseudomonas Micrococcus Characteristics sp. (FD17) sp. (FA13) sp. (FF34) sp. (FC42) sp. (FB12) sp. (S2) TPhenotypic and physiological characterization Colony Creamy Grey Yellow Yello Grey Creamy color white Colony Round Round Round Round Round Round morphology Bacterial growth conditionsa NaCl 2% + + + + + + 6% + − + − − + pH 5 + + + + + + 12 + + − − + + Motility/ chemotaxisb Swimming +++ + + − ++ − Swarming + − − − − − Twitching + + + − + − Biofilm formation OD (600 nm) 0.95 ± 0.04 0.92 ± 0.04 059 ± 0.02 0.95 ± 0.08 0.57 ± 0.08 n.d. Biofilm (595 nm) 0.83 ± 0.06 0.23 ± 0.02 0.22 ± 0.03 0.08 ± 0.01 0.08 ± 0.04 n.d. Aggregate 40.22 ± 1.99 35.91 ± 2.57 26.07 ± 0.88 32.61 ± 2.13 36.38 ± 1.48 n.d. stability (%) Biochemical characterizationa Catalase + + + + + + Oxidase − − − − + − Casein − − − − + − Gelatin + − + − + + Methanol − + − − + + Ethanol − + − − + + Growth promoting characterizationb ACC- +++ − ++ − ++ + deaminase Auxin production (IAA equivalent (μg mL−1) without L-TRP 7.54 ± 1.02 1.74 ± 0.18 10.33 ± 0.35 4.89 ± 0.78 1.63 ± 0.65 − with L-TRP 12.30 ± 0.98 16.13 ± 1.05 95.34 ± 2.14 38.41 ± 1.78 7.26 ± 1.05 − P-solubilization (inorganic/organic P) Ca3(PO4)2 +++ − ++ − + − CaHPO4 +++ ++ ++ − + − Ca(H2PO4)2 +++ n.d. n.d. n.d. n.d. n.d. Ca-phytate +++ − ++ − ++ − Na-phytate +++ − ++ − ++ − Exopolysaccharide + ++ − + − − HCN production − − − − + − NH3production + + + + + + Siderophore +++ +++ + + ++ n.d. production AHL − − − − + − PHB + − + − + + Enzyme hydrolyzing activityb Amylase − − − − − − Cellulase ++ + − + + + Chitinase + − − − + − Hemolytic + + + − + n.d. Lipase ++ ++ + + +++ − Pectinase + − + − + − Phosphatase +++ − ++ − ++ − Protease − − − − − + Xylanase ++ + − +++ + + Heavy metal resistance (mg mL−1)‡ Cadmium 120 120 120 − 120 − nitrate (++) (++) (+) (−) Copper 330 330 − 330 330 − sulphate (−) (+) (+) (−) Chromium 250 250 250 250 250 250 nitrate (++) (+) (+) (+) (+) (+) Lead nitrate 660 660 660 660 660 660 (++) (+) (+) (+) (+) (−) Nickel 110 110 110 − − 110 sulphate (+) (+) (+) (−) Zinc 330 330 330 330 − 330 sulphate (+) (+) (+) (+) (−) Antagonistic activities against plant pathogenic bacteria, fungi and oomycetesb Anti-bacterial activity + − − − ++ − + − − − +++ − n.d. n.d. n.d. n.d. n.d. + − − − − + + Anti-fungal activity +++ ++ + + ++ − ++ + + + + − ++ + ++ + ++ + +++ ++ + ++ ++ − ++ + + + ++ + + + + + ++ − Anti-oomycete activity ++ + + + ++ − +++ + + + ++ − ++ + + + + − Results are obtained from 4-6 replicates a−, absent; +, present b+, low efficiency; ++, medium efficiency; +++, high efficiency Physico-chemical and growth promoting characteristics of maize seed- associated endophytic bacteria and Characteristics† S4 sp. S10 S6 sp. S9 Phenotypic and physiological characterization Colony color Off-white Creamy white Yellow White Colony Round Round Round Round morphology Gram reaction positive negative Negative Negative Bacterial growth conditions* Temperature 4° C. + + + + 42° C. − − − − NaCl 2% + + + + 6% + + + − pH 5 + + + + 12 − + + − Motility/ chemotaxis‡ Swimming − ++ + − Swarming − + ++ − Twitching + + + − Biofilm formation OD (600 nm) n.d. n.d. n.d. n.d. Biofilm (595 nm) n.d. n.d. n.d. n.d. Aggregate n.d. n.d. n.d. n.d. stability (%) Biochemical characterization* Catalase + + + + Oxidase + + − − Casein + − − − Gelatin − − + − Methanol − + − + Ethanol − + − + Growth promoting characterization‡ ACC- + + + + deaminase activity Auxin production (μg mL−1) Without L- − − − − TRP With L-TRP − − − − P-solubilization (Inorganic/organic P) Ca3(PO4)2 − + + − CaHPO4 − + + − Ca(H2PO4)2 n.d. n.d. n.d. n.d. Ca-Phytate − + + − Na-Phytate + + − Exopolysaccharide − + − − N2-fixation − + + − HCN − − − − production NH3 − − + + production Siderophore + + n.d. − AHL − + + − PHB − + + − Enzyme hydrolyzing activity‡ Amylase − + − − Cellulase + + − − Chitinase + − − − Hemolytic n.d. n.d. n.d. n.d. Lipase + + + + Pectinase − + + − Phosphatase − + + − Protease + − − − Xylanase + + + − Heavy metal resistance (mg mL−1)‡ Cadmium 120 (+) − − − nitrate Copper 330 (+) − − 330 (−) sulphate Chromium 250 (+) 250 (+) 250 (+) 250 (+) nitrate Lead nitrate 660 (+) 660 (+) 660 (++) 660 (+) Nickel sulphate 110 (+) 110 (+) 110 (+) 110 (+) Zinc sulphate 330 (+) 330 (+) − − Antagonistic activities against plant pathogenic bacteria, fungi and oomycetes‡ Anti-bacterial activity + + − − + + − − + + − − + + + + Anti-fungal and Oomycete + + + − − + + + + − + − + + − − + + + + + + + − Anti-Oomycete − − + − − + + + + + + + †Results in characterization table are of 4-6 replicates *−, absent; +, present ‡+, low efficiency; ++, medium efficiency; +++, high efficiency Example 5—Seed Endophyte Establishment and Persistence in Corn and Wheat
Example 6—Colonization of Plants Grown from Seeds Coated with Endophytes
Experimental Description—Experiment 1
Experimental Results—Experiment 1
Confirmed colonization of seed origin strains in corn shoot and root tissue at 7 days after seed inoculation. Seed-origin microbes Shoot tissue Root tissue SYM00254 ++ +++ SYM00284 +++ +++ SYM00290 + +++ SYM00292 ++ +++ + - <104cells per tissue type; ++ - 104to 106cells per tissue type; +++ - >106cells per tissue type. Experimental Description—Experiment 2
composition of the PCR mastermix and the used PCR conditions Real Time PCR Bio-Rad CFX-96 Real-Time detection ystem Given 1 x PCR approach conc. final conc. approach 104 x SsoFast Probe 2 x 1 x 5.00 μl 520.00 μl Supermix 10 μM 0.35 μM 0.35 μl 36.40 μl probe F-Primer 10 μM 0.5 μM 0.50 μl 52.00 μl R-Primer 10 μl 0.5 μM 0.50 μl 52.00 μl template 0 ng/μl 5-100 ng/μl 1.00 μl 104.00 μl H2O 2.65 μl 275.60 μl reaction volume 10 μl Enzym activation 95° C. 120 sec Denaturierung 95° C. 5 sec 40 x Annealing/ 59° C. 10 sec Extension Experimental Results—Experiments 2
Example 7. Localization of Microbes in the Plant and its Environment
Experiment Description
Experiment Results
Bacterial endophytes found in the root tissue SEQ ID OTU_ID NO: Class Order Family Genus OTU_73 2532 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_188 2553 Actinobacteria Actinomycetales Microbacteriaceae OTU_90 2552 Gammaproteobacteria Pseudomonadales Moraxellaceae OTU_115 2494 Betaproteobacteria Methylophilales Methylophilaceae OTU_13 2528 Bacilli Bacillales Bacillaceae OTU_3194 2513 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_3034 2487 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_127 2469 Alphaproteobacteria BD7-3 OTU_134 2550 Bacilli Bacillales Paenibacillaceae OTU_64 2499 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_290 2444 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_118 2419 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_3760 2527 Betaproteobacteria Burkholderiales Alcaligenaceae OTU_2272 2420 Betaproteobacteria Burkholderiales Comamonadaceae OTU_99 2525 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_119 2447 Sphingobacteriia Sphingobacteriales Sphingobacteriaceae OTU_24 2453 Flavobacteriia Flavobacteriales [Weeksellaceae] OTU_85 2431 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_108 2470 Bacilli Bacillales Paenibacillaceae OTU_121 2561 Bacilli Bacillales Paenibacillaceae OTU_2406 2549 Bacilli Bacillales Paenibacillaceae OTU_3268 2445 Cytophagia Cytophagales Cytophagaceae OTU_604 2518 Alphaproteobacteria Sphingomonadales Erythrobacteraceae OTU_367 2558 Alphaproteobacteria Sphingomonadales Erythrobacteraceae OTU_124 2556 Alphaproteobacteria Rhodospirillales Rhodospirillaceae OTU_343 2524 Cytophagia Cytophagales Cytophagaceae OTU_130 2531 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_89 2491 Bacilli Bacillales OTU_70 2433 Cytophagia Cytophagales Cytophagaceae OTU_65 2427 Verrucomicrobiae Verrucomicrobiales Verrucomicrobiaceae OTU_43 2437 Sphingobacteriia Sphingobacteriales Sphingobacteriaceae OTU_3678 2547 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_123 2539 Actinobacteria Actinomycetales Micrococcaceae OTU_79 2478 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_87 2481 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_264 2542 Bacilli Bacillales Paenibacillaceae OTU_217 2489 Bacilli Bacillales Planococcaceae OTU_9 2479 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_1 2424 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_69 2452 Betaproteobacteria IS-44 OTU_139 2514 Bacilli Bacillales OTU_399 2458 Verrucomicrobiae Verrucomicrobiales Verrucomicrobiaceae OTU_104 2526 Bacilli Bacillales Paenibacillaceae OTU_71 2523 Alphaproteobacteria Rhizobiales Bradyrhizobiaceae OTU_72 2439 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_204 2541 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_141 2555 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_50 2551 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_56 2454 Deltaproteobacteria Myxococcales OTU_16 2425 Bacilli Bacillales Paenibacillaceae OTU_2969 2430 Bacilli Bacillales Bacillaceae OTU_183 2521 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_61 2488 Cytophagia Cytophagales Cytophagaceae OTU_75 2475 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_68 2471 Betaproteobacteria Burkholderiales Comamonadaceae OTU_76 2461 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_2017 2474 Sphingobacteriia Sphingobacteriales Sphingobacteriaceae OTU_29 2477 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_86 2530 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_78 2457 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_22 2510 Bacilli Bacillales Paenibacillaceae OTU_2460 2473 Betaproteobacteria Burkholderiales Oxalobacteraceae OTU_66 2497 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_3062 2490 Bacilli Bacillales Paenibacillaceae OTU_18 2484 Bacilli Bacillales Paenibacillaceae OTU_2966 2522 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_54 2511 Sphingobacteriia Sphingobacteriales OTU_92 2493 Deltaproteobacteria Myxococcales Polyangiaceae OTU_60 2546 Bacilli Bacillales Paenibacillaceae OTU_63 2480 Planctomycetia Pirellulales Pirellulaceae OTU_2433 2483 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_95 2496 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_62 2564 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_356 2498 Betaproteobacteria Burkholderiales Comamonadaceae OTU_176 2516 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_91 2455 Deltaproteobacteria Myxococcales OTU_148 2537 Betaproteobacteria Burkholderiales Comamonadaceae OTU_53 2533 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_3272 2535 Bacilli Bacillales Paenibacillaceae OTU_2819 2456 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_57 2472 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_1751 2467 Gammaproteobacteria Alteromonadales Alteromonadaceae OTU_67 2548 Bacilli Bacillales Paenibacillaceae OTU_41 2468 Cytophagia Cytophagales Cytophagaceae OTU_51 2529 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_77 2545 Betaproteobacteria Burkholderiales Comamonadaceae OTU_7 2451 Cytophagia Cytophagales Cytophagaceae OTU_52 2554 Deinococci Deinococcales Deinococcaceae OTU_28 2495 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_23 2485 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_37 2438 Verrucomicrobiae Verrucomicrobiales Verrucomicrobiaceae OTU_721 2448 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_45 2460 Gammaproteobacteria Alteromonadales Alteromonadaceae OTU_42 2476 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_10 2515 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_44 2426 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_3676 2520 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_49 2443 Betaproteobacteria Burkholderiales Oxalobacteraceae OTU_3658 2462 Alphaproteobacteria Rhizobiales OTU_35 2563 Bacilli Bacillales Paenibacillaceae OTU_2846 2436 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_34 2557 Bacilli Bacillales Paenibacillaceae OTU_33 2536 Bacilli Bacillales Paenibacillaceae OTU_17 2432 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_32 2459 Betaproteobacteria Burkholderiales Comamonadaceae OTU_15 2534 Bacilli Bacillales Paenibacillaceae OTU_2408 2562 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_5 2466 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_4 2540 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_3 2464 Betaproteobacteria Burkholderiales Oxalobacteraceae Bacterial endophytes found in the shoot tissue SEQ ID OTU_ID NO: Class Order Family Genus OTU_37 2438 Verrucomicrobiae Verrucomicrobiales Verrucomicrobiaceae OTU_721 2448 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_2819 2456 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_45 2460 Gammaproteobacteria Alteromonadales Alteromonadaceae OTU_3658 2462 Alphaproteobacteria Rhizobiales OTU_1300 2463 Deinococci Deinococcales Deinococcaceae OTU_1751 2467 Gammaproteobacteria Alteromonadales Alteromonadaceae OTU_57 2472 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_75 2475 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_87 2481 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_217 2489 Bacilli Bacillales Planococcaceae OTU_95 2496 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_66 2497 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_22 2510 Bacilli Bacillales Paenibacillaceae OTU_54 2511 Sphingobacteriia Sphingobacteriales OTU_3194 2513 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_588 2519 Bacilli Bacillales OTU_2966 2522 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_51 2529 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_86 2530 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_3272 2535 Bacilli Bacillales Paenibacillaceae OTU_52 2554 Deinococci Deinococcales Deinococcaceae OTU_70 2433 Cytophagia Cytophagales Cytophagaceae OTU_72 2439 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_290 2444 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_96 2446 Betaproteobacteria OTU_399 2458 Verrucomicrobiae Verrucomicrobiales Verrucomicrobiaceae OTU_23 2485 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_3034 2487 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_176 2516 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_33 2536 Bacilli Bacillales Paenibacillaceae OTU_134 2550 Bacilli Bacillales Paenibacillaceae OTU_1 2424 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_178 2434 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_2433 2483 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_356 2498 Betaproteobacteria Burkholderiales Comamonadaceae OTU_1884 2435 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_81 2442 [Spartobacteria] [Chthoniobacterales] [Chthoniobacteraceae] OTU_24 2453 Flavobacteriia Flavobacteriales [Weeksellaceae] OTU_85 2431 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_483 2450 Rubrobacteria Rubrobacterales Rubrobacteraceae OTU_173 2486 Actinobacteria Actinomycetales Nocardioidaceae OTU_557 2500 Bacilli Bacillales Paenibacillaceae OTU_584 2501 Bacilli Bacillales Paenibacillaceae OTU_1618 2503 Bacilli Lactobacillales Streptococcaceae OTU_881 2507 Clostridia Clostridiales Clostridiaceae OTU_3561 2509 Actinobacteria Actinomycetales Actinomycetaceae OTU_240 2512 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_148 2537 Betaproteobacteria Burkholderiales Comamonadaceae OTU_1004 2543 Alphaproteobacteria Ellin329 OTU_3042 2544 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_141 2555 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_367 2558 Alphaproteobacteria Sphingomonadales Erythrobacteraceae OTU_1534 2429 Betaproteobacteria Burkholderiales Oxalobacteraceae OTU_64 2499 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_3738 2502 Actinobacteria Actinomycetales Microbacteriaceae OTU_1137 2505 Clostridia Clostridiales Clostridiaceae OTU_183 2521 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_71 2523 Alphaproteobacteria Rhizobiales Bradyrhizobiaceae OTU_99 2525 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_130 2531 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_123 2539 Actinobacteria Actinomycetales Micrococcaceae OTU_204 2541 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_3678 2547 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_124 2556 Alphaproteobacteria Rhodospirillales Rhodospirillaceae OTU_118 2419 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_873 2449 Betaproteobacteria Burkholderiales Alcaligenaceae OTU_343 2524 Cytophagia Cytophagales Cytophagaceae OTU_53 2533 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_3268 2445 Cytophagia Cytophagales Cytophagaceae OTU_2547 2482 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_615 2421 Clostridia Thermoanaerobacterales Carboxydocellaceae OTU_272 2428 Bacilli Bacillales Bacillaceae OTU_68 2471 Betaproteobacteria Burkholderiales Comamonadaceae OTU_42 2476 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_29 2477 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_9 2479 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_188 2553 Actinobacteria Actinomycetales Microbacteriaceae OTU_61 2488 Cytophagia Cytophagales Cytophagaceae OTU_3760 2527 Betaproteobacteria Burkholderiales Alcaligenaceae OTU_43 2437 Sphingobacteriia Sphingobacteriales Sphingobacteriaceae OTU_1703 2504 Gammaproteobacteria Pasteurellales Pasteurellaceae OTU_2846 2436 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_28 2495 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_661 2508 Gammaproteobacteria Xanthomonadales Sinobacteraceae OTU_3 2464 Betaproteobacteria Burkholderiales Oxalobacteraceae OTU_502 2465 Bacilli Bacillales Sporolactobacillaceae OTU_115 2494 Betaproteobacteria Methylophilales Methylophilaceae OTU_631 2506 Betaproteobacteria Rhodocyclales Rhodocyclaceae OTU_436 2423 Clostridia Clostridiales Clostridiaceae OTU_7 2451 Cytophagia Cytophagales Cytophagaceae OTU_4 2540 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_319 2422 Bacilli Bacillales Staphylococcaceae OTU_32 2459 Betaproteobacteria Burkholderiales Comamonadaceae OTU_90 2552 Gammaproteobacteria Pseudomonadales Moraxellaceae OTU_50 2551 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_10 2515 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_44 2426 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_2969 2430 Bacilli Bacillales Bacillaceae OTU_77 2545 Betaproteobacteria Burkholderiales Comamonadaceae OTU_73 2532 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_3676 2520 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_2408 2562 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_16 2425 Bacilli Bacillales Paenibacillaceae OTU_2272 2420 Betaproteobacteria Burkholderiales Comamonadaceae OTU_5 2466 Alphaproteobacteria Rhizobiales Rhizobiaceae Bacterial endophytes found in the seed SEQ ID OTU_ID NO: Class Order Family Genus OTU_77 2545 Betaproteobacteria Burkholderiales Comamonadaceae OTU_32 2459 Betaproteobacteria Burkholderiales Comamonadaceae OTU_2408 2562 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_502 2465 Bacilli Bacillales Sporolactobacillaceae OTU_164 2492 Cytophagia Cytophagales Cytophagaceae OTU_3194 2513 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_604 2518 Alphaproteobacteria Sphingomonadales Erythrobacteraceae OTU_1300 2463 Deinococci Deinococcales Deinococcaceae OTU_436 2423 Clostridia Clostridiales Clostridiaceae OTU_777 2441 Bacilli Bacillales Alicyclobacillaceae OTU_290 2444 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_4 2540 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_2547 2482 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_13 2528 Bacilli Bacillales Bacillaceae OTU_1363 2440 Bacilli Bacillales Staphylococcaceae OTU_9 2479 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_89 2491 Bacilli Bacillales OTU_2969 2430 Bacilli Bacillales Bacillaceae OTU_71 2523 Alphaproteobacteria Rhizobiales Bradyrhizobiaceae OTU_272 2428 Bacilli Bacillales Bacillaceae OTU_2272 2420 Betaproteobacteria Burkholderiales Comamonadaceae OTU_16 2425 Bacilli Bacillales Paenibacillaceae OTU_1884 2435 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_3 2464 Betaproteobacteria Burkholderiales Oxalobacteraceae OTU_1 2424 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_118 2419 Gammaproteobacteria Enterobacteriales Enterobacteriaceae Bacterial endophytes found in the rhizosphere SEQ ID OTU_ID NO: Class Order Family Genus OTU_2460 2473 Betaproteobacteria Burkholderiales Oxalobacteraceae OTU_604 2518 Alphaproteobacteria Sphingomonadales Erythrobacteraceae OTU_173 2486 Actinobacteria Actinomycetales Nocardioidaceae OTU_1004 2543 Alphaproteobacteria Ellin329 OTU_3042 2544 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_118 2419 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_2547 2482 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_3760 2527 Betaproteobacteria Burkholderiales Alcaligenaceae OTU_91 2455 Deltaproteobacteria Myxococcales OTU_183 2521 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_73 2532 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_16 2425 Bacilli Bacillales Paenibacillaceae OTU_164 2492 Cytophagia Cytophagales Cytophagaceae OTU_367 2558 Alphaproteobacteria Sphingomonadales Erythrobacteraceae OTU_92 2493 Deltaproteobacteria Myxococcales Polyangiaceae OTU_2819 2456 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_95 2496 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_2433 2483 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_204 2541 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_9 2479 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_188 2553 Actinobacteria Actinomycetales Microbacteriaceae OTU_90 2552 Gammaproteobacteria Pseudomonadales Moraxellaceae OTU_2969 2430 Bacilli Bacillales Bacillaceae OTU_62 2564 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_2966 2522 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_240 2512 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_115 2494 Betaproteobacteria Methylophilales Methylophilaceae OTU_2272 2420 Betaproteobacteria Burkholderiales Comamonadaceae OTU_13 2528 Bacilli Bacillales Bacillaceae OTU_141 2555 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_124 2556 Alphaproteobacteria Rhodospirillales Rhodospirillaceae OTU_343 2524 Cytophagia Cytophagales Cytophagaceae OTU_44 2426 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_57 2472 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_52 2554 Deinococci Deinococcales Deinococcaceae OTU_99 2525 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_130 2531 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_3678 2547 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_89 2491 Bacilli Bacillales OTU_35 2563 Bacilli Bacillales Paenibacillaceae OTU_721 2448 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_1751 2467 Gammaproteobacteria Alteromonadales Alteromonadaceae OTU_1 2424 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_123 2539 Actinobacteria Actinomycetales Micrococcaceae OTU_60 2546 Bacilli Bacillales Paenibacillaceae OTU_3194 2513 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_86 2530 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_148 2537 Betaproteobacteria Burkholderiales Comamonadaceae OTU_10 2515 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_79 2478 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_779 2538 Bacilli Bacillales Paenibacillaceae OTU_138 2560 Bacilli Bacillales Paenibacillaceae OTU_3034 2487 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_49 2443 Betaproteobacteria Burkholderiales Oxalobacteraceae OTU_127 2469 Alphaproteobacteria BD7-3 OTU_67 2548 Bacilli Bacillales Paenibacillaceae OTU_3658 2462 Alphaproteobacteria Rhizobiales OTU_51 2529 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_119 2447 Sphingobacteriia Sphingobacteriales Sphingobacteriaceae OTU_101 2517 Bacilli Bacillales Paenibacillaceae OTU_176 2516 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_2846 2436 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_50 2551 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_76 2461 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_63 2480 Planctomycetia Pirellulales Pirellulaceae OTU_54 2511 Sphingobacteriia Sphingobacteriales OTU_134 2550 Bacilli Bacillales Paenibacillaceae OTU_356 2498 Betaproteobacteria Burkholderiales Comamonadaceae OTU_53 2533 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_78 2457 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_66 2497 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_96 2446 Betaproteobacteria OTU_41 2468 Cytophagia Cytophagales Cytophagaceae OTU_87 2481 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_24 2453 Flavobacteriia Flavobacteriales [Weeksellaceae] OTU_69 2452 Betaproteobacteria IS-44 OTU_2017 2474 Sphingobacteriia Sphingobacteriales Sphingobacteriaceae OTU_139 2514 Bacilli Bacillales OTU_264 2542 Bacilli Bacillales Paenibacillaceae OTU_178 2434 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_61 2488 Cytophagia Cytophagales Cytophagaceae OTU_81 2442 [Spartobacteria] [Chthoniobacterales] [Chthoniobacteraceae] OTU_85 2431 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_399 2458 Verrucomicrobiae Verrucomicrobiales Verrucomicrobiaceae OTU_108 2470 Bacilli Bacillales Paenibacillaceae OTU_70 2433 Cytophagia Cytophagales Cytophagaceae OTU_77 2545 Betaproteobacteria Burkholderiales Comamonadaceae OTU_3676 2520 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_104 2526 Bacilli Bacillales Paenibacillaceae OTU_75 2475 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_71 2523 Alphaproteobacteria Rhizobiales Bradyrhizobiaceae OTU_121 2561 Bacilli Bacillales Paenibacillaceae OTU_588 2519 Bacilli Bacillales OTU_64 2499 Alphaproteobacteria Sphingomonadales Sphingomonadaceae OTU_56 2454 Deltaproteobacteria Myxococcales OTU_2406 2549 Bacilli Bacillales Paenibacillaceae OTU_3272 2535 Bacilli Bacillales Paenibacillaceae OTU_65 2427 Verrucomicrobiae Verrucomicrobiales Verrucomicrobiaceae OTU_217 2489 Bacilli Bacillales Planococcaceae OTU_72 2439 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_45 2460 Gammaproteobacteria Alteromonadales Alteromonadaceae OTU_43 2437 Sphingobacteriia Sphingobacteriales Sphingobacteriaceae OTU_98 2559 Bacilli Bacillales Paenibacillaceae OTU_68 2471 Betaproteobacteria Burkholderiales Comamonadaceae OTU_29 2477 Gammaproteobacteria Xanthomonadales Xanthomonadaceae OTU_28 2495 Alphaproteobacteria Rhizobiales Hyphomicrobiaceae OTU_3268 2445 Cytophagia Cytophagales Cytophagaceae OTU_32 2459 Betaproteobacteria Burkholderiales Comamonadaceae OTU_23 2485 [Saprospirae] [Saprospirales] Chitinophagaceae OTU_42 2476 Alphaproteobacteria Caulobacterales Caulobacteraceae OTU_3062 2490 Bacilli Bacillales Paenibacillaceae OTU_17 2432 Flavobacteriia Flavobacteriales Flavobacteriaceae OTU_34 2557 Bacilli Bacillales Paenibacillaceae OTU_15 2534 Bacilli Bacillales Paenibacillaceae OTU_37 2438 Verrucomicrobiae Verrucomicrobiales Verrucomicrobiaceae OTU_33 2536 Bacilli Bacillales Paenibacillaceae OTU_22 2510 Bacilli Bacillales Paenibacillaceae OTU_2408 2562 Gammaproteobacteria Enterobacteriales Enterobacteriaceae OTU_4 2540 Gammaproteobacteria Pseudomonadales Pseudomonadaceae OTU_7 2451 Cytophagia Cytophagales Cytophagaceae OTU_18 2484 Bacilli Bacillales Paenibacillaceae OTU_5 2466 Alphaproteobacteria Rhizobiales Rhizobiaceae OTU_3 2464 Betaproteobacteria Burkholderiales Oxalobacteraceae Example 8—Testing of Seed-Origin Bacterial Endophyte Populations on Plants
Experimental Description
Experimental Results
Assay for seedling vigor in water agar conditions Corn cultivar A Corn-organic Weight Root length Root Length Strain OTU# Normal Normal normal salt SYM00002 66 2 2 SYM00011 2 — 1 SYM00012 55 2 2 SYM00017c 45 1 3 — SYM00028 18 2 SYM00049 7 2 1 3 1 SYM00052 18 1 — SYM00057b 37 3 2 SYM00060 67 1 SYM00064a 10 2 2 SYM00071 76 1 SYM00075 39 2 — — SYM00090 62 — 1 SYM00167 3 1 1 SYM00188 6 1 3 — SYM00192 19 1 2 SYM00199 135 1 1 SYM00231 46 2 — Assay for seedling vigor on filter paper. ROOT LENGTH SEEDLING WEIGHT OTU Corn organic Filter paper Corn organic Filter paper Strain # normal heat salt heat-salt drought normal heat salt heat-salt drought SYM00002 66 1 3 — — 3 2 3 1 — 1 SYM00011 2 2 — — — — 2 SYM00012 55 — 1 — — — 2 2 — 2 — SYM00017c 45 1 — 3 2 2 — 1 1 2 — SYM00028 18 — — — — 3 1 — 2 3 — SYM00033 0 — 1 3 2 2 1 3 — 2 — SYM00049 7 1 3 1 2 1 — — — 1 — SYM00052 18 2 — — — — 1 SYM00057b 37 1 1 — 1 1 1 3 1 1 1 SYM00071 76 — 1 2 3 — 2 1 2 3 — SYM00075 39 — — — — — 3 SYM00090 62 2 2 2 — 1 3 3 1 1 — SYM00102 38 — 2 3 3 — — 1 — 3 — SYM00107 59 — 1 — — — 1 — — 3 1 SYM00167 3 2 2 1 3 1 1 3 — 2 — SYM00172 146 — — — 1 — — — — — — SYM00188 6 — 1 2 — — 1 2 1 3 — SYM00192 19 — 2 — 3 — 1 2 1 3 — SYM00199 135 — 3 — 3 — 1 3 1 3 — SYM00218 41 — — — 1 — 3 SYM00231 46 — — — — — 1 SYM00508 196 — — — — — 1 — — — — SYM00547 13 2 1 3 — 1 1 — — — 1 SYM00554 53 — 3 — 3 — — 2 — 3 — SYM00589 31 — 2 3 3 — 1 3 1 3 — SYM00595 12 1 3 2 2 — 1 3 1 3 — SYM00596 9 1 3 3 3 1 — 3 — 3 — SYM00660 1 — 2 1 1 2 — 2 — — 2 SYM00713 84 — — — — 2 — — — — — SYM00775 30 — — 3 — — 2 2 — 3 2 SYM00940 83 — — — — 1 1 1 — — 1 SYM00967 8 — — 3 — 3 1 1 1 — 1 SYM00975 51 2 — 3 — 3 1 1 — — 2 SYM00991 36 — — — 3 — 1 — — — 1 SYM00992 126 1 — — — 3 — — — — —
Table 15. Wheat Stress/Vigor Test
Wheat seedling vigor assessment using water agar assay. Root Length Wheat Briggs Water-agar Strain OTU# Normal Heat Salt SYM00002 66 3 — 3 SYM00011 2 3 3 3 SYM00012 55 3 1 3 SYM00015 29 — 1 — SYM00016b 25 2 3 3 SYM00017c 45 3 2 3 SYM00021 29 3 — — SYM00028 18 3 — 2 SYM00033 0 3 — 3 SYM00046 56 3 SYM00049 7 3 2 2 SYM00052 18 1 — 3 SYM00057b 37 3 3 3 SYM00060 67 2 SYM00063 134 1 — — SYM00064a 10 3 — — SYM00071 76 3 — — SYM00075 39 3 — — SYM00090 62 3 2 1 SYM00102 38 2 — — SYM00107 59 2 3 — SYM00167 3 3 — 3 SYM00168 45 3 — 1 SYM00183 10 3 — — SYM00188 6 1 — — SYM00192 19 3 1 — SYM00199 135 3 1 3 SYM00218 41 3 1 — SYM00508 196 3 3 1 SYM00538A 172 1 — 1 SYM00547 13 2 3 2 SYM00589 31 — 3 1 SYM00595 12 — 3 — SYM00596 9 1 3 1 SYM00660 1 — — 2 SYM00713 84 2 — 1 SYM00775 30 — 2 — SYM00940 83 — 1 — SYM00965 82 2 — 1 SYM00967 8 2 3 3 SYM00975 51 1 — 2 SYM00992 126 — — 3 Legend: “—” indicates no significant increase relative to uninoculated control; “1” = 0-5% increase relative to uninoculated control; “2” = 5-10% increase relative to uninoculated control; “3” = >10% increase relative to uninoculated control Wheat seedling vigor using filter paper assay. Legend: “—” indicates no increase relative to uninoculated control; “1” = 0-5% increase; “2” = 5-10% increase; “3” = > 10% increase WHEAT BRIGGS FILTER PAPER OTU Shoot Length Weight Strain # Normal Salt Drought Normal Salt Drought SYM00002 66 — 1 — — 2 — SYM00011 2 3 1 3 3 — 2 SYM00012 55 — 2 3 2 — 1 SYM00016b 25 SYM00017c 45 — 1 — — 1 2 SYM00028 18 — 3 3 — 3 3 SYM00033 0 3 1 2 — — 1 SYM00049 7 3 — 3 2 — 2 SYM00052 18 1 — 1 3 — — SYM00057b 37 3 3 1 2 — 3 SYM00064a 10 — 2 2 — — — SYM00071 76 2 3 3 — 3 1 SYM00075 39 — 1 3 — — 3 SYM00090 62 — — 3 — — 3 SYM00102 38 — 3 3 2 3 — SYM00107 59 1 3 3 2 3 3 SYM00167 3 2 2 1 — — 2 SYM00168 45 SYM00172 146 — 3 SYM00188 6 1 3 — — 3 — SYM00192 19 — 3 — 2 3 — SYM00199 135 — — 1 2 — — SYM00218 41 — 2 3 3 — 3 SYM00231 46 — — 3 3 3 3 SYM00508 196 — 3 — — 2 — SYM00538A 172 SYM00547 13 1 — SYM00554 53 — 3 — — 3 — SYM00589 31 — — — — — — SYM00595 12 1 3 3 2 3 — SYM00596 9 1 3 3 1 3 2 SYM00660 1 3 — SYM00713 84 1 — SYM00965 82 SYM00967 8 — — SYM00975 51 — — SYM00992 126 — —
Growth Test of Inoculated Plants in Magenta Boxes
Summary of results of testing synthetic combinations of seed-origin endophytes and corn in plant growth tests on Magenta boxes. Plant vigor and stress resilience in Corn Root length Strain OTU# normal drought cold SYM00090 62 2 3 3 SYM00016b 25 — — — SYM00231 46 — 2 1 SYM00183 10 3 3 2 SYM00015 29 3 3 — SYM00167 3 2 2 — SYM00168 45 2 3 1 Legend: “—” indicates no significant increase relative to uninoculated control; “1” = 0-5% increase relative to uninoculated control; “2” = 5-10% increase relative to uninoculated control; “3” = >10% increase relative to uninoculated control.
Dose Response
Example 9—Proteomic Analysis of Inoculated Plants
1 Wheat (Briggs) R2A (mock control) Normal 2 Wheat (Briggs) SYM00218 Normal 3 Wheat (Briggs) R2A (mock control) Heat 4 Wheat (Briggs) SYM00011 Heat 5 Wheat (Briggs) SYM00016 Heat 6 Wheat (Briggs) SYM00057B Heat 7 Corn (40R73) R2A (mock control) Normal 8 Corn (40R73) SYM00057B Normal
Sample Collection:
Growth promotion Ratio Treatment/Control Accession SYM- SYM- SYM- number Gene name Pathway 00011 00016B 00057B gi|474293349 Acid beta-fructofuranosidase mobilization of 0.5-1Fold 1-2Fold 1-2Fold sucrose gi|473798701 ATP synthase subunit beta, ATP synthesis 1-2Fold 1-2Fold mitochondrial gi|473945263 Fructan 1-exohydrolase mobilization of 1-2Fold fructans gi|473798921 Glutamine synthetase cytosolic Amino acid 1-2Fold 1-2Fold isozyme 1-2 biosynthesis gi|474427549 Dynamin-related protein 1E Cell division 1-2Fold 1-2Fold 1-2Fold gi|474154210 Histone H1 Cell division 1-2Fold 1-2Fold 1-2Fold gi|474396419 Histone H1 Cell division 1-2Fold 1-2Fold gi|474315053 Histone H2A Cell division 1-2Fold 1-2Fold >2Fold gi|474114390 Histone H2A Cell division 1-2Fold gi|474408930 Histone H2A.1 Cell division 1-2Fold >2Fold gi|474247555 Protein H2A.7 Cell division 1-2Fold 0.5-1Fold gi|474400621 Histone H4 Cell division 1-2Fold 1-2Fold gi|474160133 Serine carboxypeptidase-like Amino acid release 1-2Fold 1-2Fold 1-2Fold protein gi|474397165 Serine carboxypeptidase-like Amino acid release >2Fold 1-2Fold 51 gi|474449933 Pectinesterase 1 Cell wall remodeling 1-2Fold >2Fold gi|474193958 Peptidyl-prolyl cis-trans Juvenile phase of 1-2Fold >2Fold >2Fold isomerase CYP40 vegetative development gi|473956589 Ribonucleoside-diphosphate DNA synthesis 0.1-0.5Fold 0.1-0.5Fold >10Fold reductase gi|474326915 Villin-4 Cell elongation >2Fold >10Fold >2Fold gi|474156626 Glutenin, low molecular weight Protein storage - 1-2Fold 1-2Fold subunit affected by heat Resistance against abiotic stress Ratio Treatment/Control Accession SYM- SYM- SYM- number Gene name Function 00011 00016B 00057B gi|474449933 Pectinesterase 1 Resistance to drought 1-2Fold >2Fold gi|474381202 Peroxiredoxin Q, chloroplastic Resistance to 0.5-1Fold 0.5-1Fold >2Fold oxidative stress gi|474299547 Glutathione S-transferase Resistance to 1-2Fold 1-2Fold >2Fold DHAR3, chloroplastic oxidative stress gi|474276683 Peroxidase 12 Resistance to 1-2Fold 1-2Fold 1-2Fold oxidative stress gi|474414579 3-hydroxybenzoate 6- Degradation of toxic 1-2Fold >2Fold 1-2Fold hydroxylase 1 organic compounds gi|474323467 BAHD acyltransferase DCR Cutin formation - 1-2Fold 1-2Fold 0.1-0.5Fold dessication resistance gi|473999626 5′-methylthioadenosine/S- Negative feedback on 0.5-1Fold 0.5-1Fold 0.5-1Fold adenosylhomocysteine ethylene production nucleosidase gi|474326305 Aldehyde dehydrogenase Controls acetaldehyde 0.5-1Fold 0.5-1Fold 0.5-1Fold family 2 member C4 accumulation gi|474041937 putative protein phosphatase Regulates ABA 0.5-1Fold 2C 45 signaling gi|473894812 DEAD-box ATP-dependent mRNA decay and 0.1-0.5Fold RNA helicase 40 ribosome biogenesis Symbiosis enhancement Ratio Treatment/Control Accession SYM- SYM- SYM- number Gene name Function 00011 00016B 00057B gi|474407144 Enolase 1 Glycolisis of sugars 0.5-1Fold 0.5-1Fold required by endophyte gi|474119301 Protochlorophyllide reductase Affected by symbiosis 0.5-1Fold B, chloroplastic gi|474213532 Elicitor-responsive protein 1 Microbe response 0.5-1Fold 0.5-1Fold 1-2Fold signaling Growth promotion Accession SYM- number Gene name Pathway 00057B/control gi|413950290 putative peptidyl-prolyl cis-trans Organ development >2-fold isomerase gi|414876902 ATP-dependent Clp protease Chloroplast component >2-fold proteolytic subunit gi|413948820 Translation elongation factor Tu Protein biosynthesis 1-2 fold isoform 3 gi|414878150 Chaperone protein dnaJ 15 Positive gravitropism <0.5-fold gi|413954599 translation elongation/initiation factor Embryo development ends <0.5-fold seed dormancy Accession SYM- number Gene name Function 00057B/control Resistance against abiotic stress gi|414867473 Glutathione S-transferase GSTU6 Resistance to oxidative 1-2 fold stress gi|414876903 Calmodulin2 ABA-induced antioxidant <0.5-fold defense gi|413920116 Ras protein Rab-18 ABA inducible, 0.5-1 fold accumulates in cold stress gi|413926351 DNA repair protein RAD23-1 isoform 3 Nucleotide-excision repair 0.5-1 fold Symbiosis enhancement gi|413920282 Hydroquinone glucosyltransferase Upregulated in Rhizobia >10-fold symbiosis gi|413939151 replication factor C subunit 3 Negative regulation of >10-fold defense response gi|413946904 NEDD8-activating enzyme E1 Protein neddylation - >10-fold catalytic subunit microbe response gi|413951445 delta3,5-delta2,4-dienoyl-CoA Peroxisome component - >10-fold isomerase defense gi|413925737 Proteasome subunit alpha type Response to compatible >2-fold symbiotic bacteria gi|413957021 Ras protein RHN1 Legume homolog involved >2-fold in nodulation gi|414875813 Early nodulin 20 Root nodule formation >2-fold gi|414886632 Putative plant regulator RWP-RK Nodule inception protein 1-2 fold family protein gi|413955359 putative metacaspase family protein Programmed cell death 0.5-1 fold regulation gi|413920552 win1 Defense response to <0.5-fold bacteria and fungi gi|413948744 protein brittle-1 Response to nematodes <0.5-fold gi|414869634 Proteasome subunit beta type Regulation of 0.5-1 fold hypersensitive response Example 10—Analysis of Hormone Levels in Inoculated Plants
Wheat (Briggs) R2A (mock control) Wheat (Briggs) SYM57B Wheat (Briggs) Mix (SYM11 + SYM17C + SYM49 + SYM57B) Corn (40R73) R2A (mock control) Corn (40R73) SYM57B Corn (40R73) Mix (SYM17C + SYM49 + SYM57B + SYM188)
Samples Analyzed for Plant Hormone Profiling
Methods
Sample Preparation
Example 11—Assessing Plant Bioreactors in the Field
Example 12—Introducing
Experiment Description
Results Experiment A (1stYear)
Seed Colonization by Strain PsJN
Experiment B1 (2ndYear)
Viability, Activation and Colonization Ability of Strain PsJN Colonizing Maize Seeds
Experiment B2 (2ndYear)
Effect of PsJN Colonized Seeds on Germination and Seedling Vigor as Compared to Untreated Control
Experiment B3 (2ndYear)
Effect of PsJN Colonized Seed on Plant Biomass Compared to Untreated Control (Pot Trials)
Conclusions
Comparative performance of PsJN colonized seed and PsJN inoculated seed (exogenously) on germination of maize cv Peso (Data presented is the average of n = 3 independent replicates.) Time to Time to Mean Coefficient Start 50% emergence Final Germination of uniform Germination Germination Germination Time (MET) Germination Energy emergence index Skewness Treatment (days) (T50) (days) (days) % (FGP) (GE) (CUE) (GI) Control 4a† 5.20b 6.74a 83.33bc 72.92ab 0.80NS 6.45bc 0.77bc PsJN Inoculation 3.33ab 4.80c 6.55a 100a 85.42a 0.67 8.82a 0.73c Control§ 4a 5.60a 6.83a 77.08c 64.58b 0.85 5.45c 0.82a PsJN Inoculation§ 3.33ab 5.30ab 6.73a 89.58b 68.75ab 0.74 6.85b 0.78ab PsJN colonized seed‡ 2.33bc 4.33d 5.49b 100a 69ab 0.77 8.75a 0.79ab †Values sharing similar letter(s) do not differ significantly at P < 0.05, according to Duncans Multiple Range Test. ‡Seeds prepared by spraying PsJN inoculum (108-109 CFU mL−1) Parent seed used for first year experiment
§Offspring seed produced from first year experiment a, b, c, d: The letters indicate significant differences. If the values are given the same letter they do not differ significantly. If they have different letters they are significantly different from each other. Comparative difference of PsJN inoculated and PsJN colonized seed on biomass of maize cv Peso in plastic tray experiment (Data presented is the average of n = 3 independent replicates.) No. of Fresh Plant biomass (g) Dry Plant biomass (g) Plant leaves Total Total height per Treatment Stem Leaves Root biomass Stem Leaves Root biomass (cm) plant Control 79.37 c† 95.70 b 37.20 b 212.27 c 3.63 c 9.65 b 1.39 b 14.67 c 93.37 b 6.58 c PsJN 93.77 b 111.03 a 38.4 ab 244.43 b 4.22 b 10.65 ab 1.73 a 16.90 b 95.87 a 7.04 b Inoculation PsJN 99.70 b 113.33 a 39.63 a 251.43 ab 4.39 b 11.17 a 1.79 a 17.35 b 97.33 a 7.20 b colonized seed‡ †Values sharing similar letter(s) do not differ significantly at P < 0.05, according to Duncans Multiple Range Test. ‡Seeds prepared by spraying PsJN inoculum onto flowers(108-109CFU mL−1) Comparative performance of PsJN colonized seed and PsJN inoculation (exogenously) on plant biomass of maize cv Peso grown in pots (Data presented is the average of n = 3 independent replicates.) Pot trial I (Direct sowing) Pot trial II No. of (Nurserysowing) Plant leaves per Shoot Root Shoot Root Treatment height(cm) plant biomass biomass biomass biomass Control 96.42 c† 6.98 c 5.32 c 0.82 c 1.29 c 0.28 c PsJN Inoculation 108.01 ab 9.04 ab 8.80 ab 1.42 a 2.37 b 0.423 ab PsJN colonized seed‡ 104.62 b 8.42 b 7.17 b 1.12 b 2.16 b 0.358 b †Values sharing similar letter(s) do not differ significantly at P < 0.05, according to Duncans Multiple Range Test. ‡Seeds prepared by spraying PsJN inoculum onto flowers(108-109CFU mL−1) Comparative performance of PsJN colonized seed and PsJN inoculated seed (exogenously) on germination of maize cv Morignon (Data presented is the average of n = 3 independent replicates.) Time to Time to Mean Final Coefficient Start 50% emergence Germi- Germi- of Germi- Germi- Germi- Time nation nation uniform nation nation nation (MET) % Energy emergence index Treatment (days) (T50) (days) (days) (FGP) (GE) (CUE) (GI) Skewness Control 4.33a† 4.98a 6.72a 85.42bc 79.17ab 0.81NS 6.66b 0.74NS PsJN 3.67a-c 4.96a 6.65a 95.83ab 89.58a 0.78 8.25a 0.75 Inoculation Control§ 4ab 5.02a 6.65a 79.17c 75b 0.74 6.65b 0.76 PsJN 3.33bc 5.07a 6.59a 91.67ab 75b 0.65 7.88ab 0.77 Inoculation§ PsJN colonized 3c 4.10b 5.69b 100a 83.33ab 0.69 9.06a 0.72 seed‡ †Values sharing similar letter(s) do not differ significantly at P < 0.05, according to Duncans Multiple Range Test. ‡Seeds prepared by spraying PsJN inoculum (108-109CFU mL−1) Parent seed used for first year experiment
§Offspring seed produced from first year experiment Comparative performance of PsJN colonized seed and PsJN inoculated seed (exogenously) on seedling biomass of maize cv Morignon in plastic tray experiment (Data presented is the average of n = 3 independent replicates.) Fresh Plant biomass (g) Dry Plant biomass (g) Plant No. of Total Total height leaves Treatment Stem Leaves Root biomass Stem Leaves Root biomass (cm) perplant Control 81.07 c† 97.70 b 38.43 b 215.93 c 3.83 c 9.67 c 1.76 b 15.26 c 94.76N 6.53 c PsJN 92.67 b 104.80 a 42.40 a 239.23 b 4.64 b 10.57 b 2.34 a 17.67 b 95.00 6.87 b Inoc- ulation PsJN 92.90 b 105.07 a 41.93 a 240.13 b 4.66 b 11.25 ab 2.35 a 18.24 ab 95.02 6.84 b colonized seed‡ †Values sharing similar letter(s) do not differ significantly at P < 0.05, according to Duncans Multiple Range Test. ‡Seeds prepared by spraying PsJN inoculum (108-109CFU mL−1) Comparative performance of PsJN colonized seed vs PsJN inoculated seed (exogenously) on plant biomass of maize cv Morignon grown in pots (Data presented is the average of n = 3 independent replicates.) Pot trial I (Direct sowing) Pot trial II No. of (Nursery sowing) Plant leaves Shoot Root Shoot Root Treatment height(cm) perplant biomass biomass biomass biomass Control 101.42 c† 7.98 c 6.36 c 1.12 c 3.29 c 0.41 c PsJN Inoculation 110.67 b 9.47 b 8.17 b 1.42 b 4.37 b 0.623 ab PsJN colonized seed‡ 113.01 ab 9.83 b 8.80 b 1.56 ab 4.26 b 0.558 b †Values sharing similar letter(s) do not differ significantly at P < 0.05, according to Duncans Multiple Range Test. ‡Seeds prepared by spraying PsJN inoculum (108-109CFU mL−1) Example 13: Introducing
Experiment Description
Results Experiment A (1stYear)
Conclusions Example 13
Example 14: Introducing
Experiment A
Inoculation of Tomato and Pepper Flowers with
Results Experiment A (1stYear)
Experiment B
Detection of PsJN in Plant Tissues (Fruits and Seeds) Using qPCR
Results Experiment B
Experiment C
Detection of PsJN in Pepper Plant Tissues (Seeds) Using FISH
Results Experiment C
Experiment D
Detection of PsJN in Pepper and Tomato F1 Seedlings Using X-Gluc Staining
Results Experiment D
Experiment E
Germination of F1 Pepper and Tomato Seeds Colonized with PsJN
Results for Experiment E
Conclusions of Example 14
Example 15: Cultivation-Independent Analysis of Barley and Wheat Seed Communities Based on IGS-Region Amplicon Sequencing after Endophyte Introduction by Flower-Spray
Experiment Description
Experiment Results
Example 16: Introducing
Experiment Description
Results Example 16
Winter Wheat Seed Colonization by Strain PsJN
Germination was measured by counting a sample of germinating seeds in each plot, and providing data per plot as well as an average of all 3 replications per variety treatment. “% germinated” is the number of germinated seeds divided by the seeding density of 450 seeds/m2. Plants % Plants % germi- germi- germi- germi- nated/m2 nated Plot Treatment* nated/m2 nated average average 1618 V1 382.22 84.94 1623 V1 364.44 80.99 376.38 83.62 1625 V1 382.22 84.94 1619 V2 333.33 74.07 1621 V2 333.33 74.07 330.37 73.42 1626 V2 324.44 72.1 1620 V3 351.11 78.02 1622 V3 373.33 82.96 355.56 79.01 1624 V3 342.22 67.05 *Treatment V1: Sprayed with PsJN in farmer field 2013 V2: Control in farmer field 2013 V3: Original (Z1) seed of the same variety bought in fall 2013 from seed distributor Effect of seed colonizing-PsJN on yield and plant height of winter wheat (cv. Pannonikus) plants. Ave. Ave. Ave. Plant Plant Plant height height height HL (cm) (cm) (cm) Moisture weight TKW 197 215 271 Yield difference Treatment % (kg) (g) days days days to lowest yield V1 16.12 78.83 51.70 69.13 95.73 92.77 7.47% V2 16.10 79.22 53.10 69.40 94.60 91.20 n/a V3 15.75 77.62 51.07 71.47 94.87 92.13 n/a *Treatment V1: Sprayed with PsJN in farmer field 2013 V2: Control in farmer field 2013 V3: Original (Z1) seed of the same variety bought in fall 2013 from seed distributor Conclusions for Example 16
Example 17—Production of Endoseeds with Endophytes of Different Taxa and Origin
Experimental Description
Bacterial strains used to spray flowers of summer wheat and barley plants with the aim of introducing the stains into seeds. Treatment Taxonomy Origin S10 Maize (cv. PESO) seed PsJN Onion roots TC38 Maize (DK315) roots AB Summer wheat (KWS Collada) seed PsJN + S10 Mock (negative control) Bacterial strains used to spray flowers of soy plants with the aim of introducing the stains into seeds. Treatment Taxonomy Origin S10 Maize (cv. PESO) seed PsJN Onion roots TC38 Maize (DK315) roots NC92 Mock (negative control)
where fragment length is 8214658 bp (size of PsJN genome). A dilution series was prepared to generate a standard curve.
Results from Example 17
Seed Colonization by Strain PsJN Analyzed by qPCR
(a) Number of seeds colonized by PsJN out of sample size indicated and range of numbers of copies of PsJN within colonized seeds. PsJN identification was done by qPCR. Original seed (parental Negative control* generation, untreated)# Colonized/ Colonized/ tested copies per tested copies per Plant species seeds seed seeds seed Summer wheat 0/24 0 0/3 0 (Trappe) Summer wheat 15/24 1.7E+2 to 0/3 0 (Kronjet) 7.2E+03 Barley 2/24 1.2E+02 to 0/3 0 (Calucle) 2.4E+02 Barley 2/24 1.9E+02 to 0/3 0 (Eunova) 2.69E+02 Soy (Merlin) 0/24 0 n.d. n.d. Soy (Essor) 0/24 0 n.d. n.d. Winter wheat 0/24 0 0/8 0 (Pannonikus) *Control in field or greenhouse #Original seed of the same variety (a) Number of seeds colonized by PsJN out of sample size indicated and range of numbers of copies of PsJN within colonized seeds. PsJN* PsJN + S10# Colonized/ Colonized/ tested copies per tested copies per seeds seed seeds seed Summer wheat 21/24 2.66E+02 to 0/24 0 (Trappe) 6.88E+03 Summer wheat 22/24 4.7E+02 to 13/24 1.23E+02 to (Kronjet) 2.8E+04 1.98E+03 Barley 0/24 0 0/24 0 (Calucle) Barley 0/24 0 0/24 0 (Eunova) Soy (Merlin) 2/12 3.66E+02 to n.d. n.d. 1.64E+03 Soy (Essor) 6/12 7.29E+02 to n.d. n.d. 4.50E+03 Winter wheat 2/24 1.5E+02 to n.d. n.d. (Pannonikus) 7.6E+02 *sprayed with #sprayed simultaneously with Conclusions for Example 17
Example 18: Analysis of Microbial Communities of Endoseed Prepared in the Field
Experiment A: Illumina Sequencing on Germinated Endoseeds
Experimental Description
Experimental Results Experiment A
Conclusion Experiment A
Experiment B: Sanger Sequencing on Germinated Endoseeds
Experimental Description
Results Experiment B
Conclusion for Experiment B
Example 19: Proteomic Analysis
Experimental Description
Samples used for proteomic measurements. Sample # Crop Cultivar Treatment 1 Winter wheat Pannonikus untreated 2 Winter wheat Pannonikus mock 3 Winter wheat Pannonikus PsJN 4 Summer wheat Trappe untreated 5 Summer wheat Trappe mock 6 Summer wheat Trappe S10 7 Summer wheat Trappe PsJN 8 Summer wheat Kronjet untreated 9 Summer wheat Kronjet mock 10 Summer wheat Kronjet PsJN 11 Summer wheat Kronjet Experimental Results
Proteins involved in growth promotion showing differential levels of expression in winter and summer wheat germinated seeds relative to not-inoculated control germinated seeds. Growth Promotion Treatment Accession number Gene name Function PsJN S10 gi|473753353 40S ribosomal Developmental regulation in + protein S19 endosperm gi|473882607 Hypothetical protein Similar to bacterial chromosome + TRIUR3_30538 segregation gi|474259811 Elongation factor 1- Upregulated in cotyledons during + gamma 2 development +, upregulated compared to control; −, downregulated compared to control Proteins involved in resistance against abiotic stress showing differential levels of expression in winter and summer wheat germinated seeds relative to not-inoculated control germinated seeds. Resistance Against Abiotic Stress Treatment Accession number Gene name Function PsJN S10 gi|473886243 60S ribosomal protein Upregulated in soy under + L26-1 flooding stress gi|473890451 T-complex protein 1 Upregulated in soy under + subunit beta flooding stress gi|473970552 Heat shock 70 kDa Upregulated in wheat under + protein, mitochondrial nitrogen stress gi|474154141 Adenosylhomocysteinase Regulated in wheat in response + + to Hg exposure gi|474188401 Enolase Upregulated in wheat in response + + to drought gi|474302864 Putative calcium-binding Downregulated in ascorbate- − protein CML7 primed wheat seeds during germination under salt stress gi|474431297 V-type proton ATPase Energy generation for transport + catalytic subunit A of ions (salt and water stress response in barley colonized with gi|474438538 RuBisCO large subunit- Upregulated in common bean in + binding protein subunit response to drought stress beta, chloroplastic gi|209944123 putative phospholipase D Mediated signal + alpha 1 precursor transduction/Upregulated in chinese cabbage under dessication stress gi|473901576 60S ribosomal protein Regulated in wheat in response − L19-2 to Hg exposure gi|474135678 26S proteasome non- Upregulated in seedling roots of + ATPase regulatory salt tolerant soybean in responses subunit RPN12A to salinity stress gi|474416088 Elongation factor 2 Downregulation in + +, upregulated compared to control; −, downregulated compared to control Proteins involved in symbiosis defense or establishment showing differential levels of expression in winter and summer wheat germinated seeds relative to not-inoculated control germinated seeds. Symbiosis Defense or Establishment Treatment Accession number Gene name Function PsJN Aneurinibacillus sp. S10 gi|1346344 Keratin, type II Infection structure development + cytoskeletal 6A gi|473790174 60S ribosomal protein Response to + L14-1 gi|473742212 60S ribosomal protein Response to − L18-2 gi|474186081 40S ribosomal protein Response to + S15a-1 gi|473970549 Aspartate Response to bacterial ACC + aminotransferase, deaminase cytoplasmic gi|474200923 Luminal-binding protein 3 Pathogen response in barley + + gi|474247591 ATP synthase subunit Upregulated in symbiotically + + alpha, mitochondrial colonized orchid gi|474250318 Phosphoenolpyruvate Upregulated in transgenic pest + + carboxylase 2 resistant oranges gi|474258378 Calreticulin Upregulated in sweetclover + + symbiotic with gi|474369382 Nucleoside diphosphate Upregulated in rice infected with + kinase 1 bacteria gi|474384893 Putative lipoxygenase 3 Symbiotic nodule formation + gi|474388024 Elongation factor 1-alpha Upregulated in cells harboring + arbuscular mycorrhiza gi|474449989 Glyceraldehyde-3- Upregulated in cell walls in + phosphate dehydrogenase, response to symbiotic elicitors cytosolic 3 gi|386848 keratin Regulated in cell walls during − − + nodulation gi|473930078 40S ribosomal protein S4 Regulated in response to − mycorrhiza gi|473935893 Actin-depolymerizing Similar to rice OslecRK, − factor 4 involved in immune response and seed germination gi|473939759 Stromal 70 kDa heat Upregulated in tomato in + shock-related protein, response to a protective strain of chloroplastic gi|473970552 Heat shock 70 kDa Upregulated in soybean root + protein, mitochondrial hairs after infection by gi|473987280 Aldehyde dehydrogenase Upregulated in + − family 2 member B7, guard cells in response to methyl mitochondrial jasmonate gi|473993048 UTP-glucose-1-phosphate Upregulated by salicilic acid − uridylyltransferase treatment on sweet cherry fruits in the presence of pathogens gi|473993302 5- Regulated in sugarcane in + methyltetrahydropteroyltri response to the endophytic plant- glutamate--homocysteine growth-promoting bacterium methyltransferase gi|474040032 Chaperonin CPN60-2, Sulfenylated in − mitochondrial gi|474077243 ADP, ATP carrier protein, Upregulated in perennial + mitochondrial ryegrass colonized with the endophytic fungus gi|474086745 60S ribosomal protein L8 Downregulated in common bean − roots symbiotic with compatible bacteria gi|474094006 1-Cys peroxiredoxin Pathogenesis related protein; − PER1 regulated during germination and seedling growth of chickpea under suboptimal soil-water conditions gi|474113969 RuBisCO large subunit- Sulfenylated in + binding protein subunit alpha, chloroplastic gi|474299793 40S ribosomal protein Downregulated in oak − S11 microcuttings inoculated with the ectomicorrhiza gi|474440867 60S ribosomal protein Upregulated in wheat leaves − L10-2 inoculated with pathogenic powdery mildew +, upregulated compared to control; −, downregulated compared to control Conclusion for Example 19
Example 20: Germination Rate of Endoseeds Prepared in the Field
Experimental Description
Experimental Results
Conclusion for Example 20
Example 21: Effect of PsJN Incorporated into Wheat (
Experimental Description
Experimental Results
Conclusion for Example 21
Example 22: Determination of Colonization Rates of Individual Endoseeds of the Same Head
Experiment Description
Experiment Results
qPCR results of summer wheat (Trappe). Numbers indicate seeds positive in PsJN specific qPCR of total number of seeds tested. Base middle and top refer to seed positions for each of 8 samples (PsJN-endoseed). T-PsJN T-PsJN T-PsJN Head (top) (middle) (bottom) 1 0/2 0/2 2/2 2 1/2 1/2 2/2 3 2/2 1/2 1/2 4 2/2 0/2 1/2 5 0/2 0/2 0/2 6 0/2 0/2 0/2 7 0/2 1/2 0/2 8 0/2 0/2 0/2 qPCR results of summer wheat (Kronjet). Numbers indicate seeds positive in PsJN specific qPCR of total number of seeds tested. Base middle and top refer to seed positions for each of 8 samples (PsJN-endoseed). K-PsJN K-PsJN K-PsJN Head (top) (middle) (bottom) 1 0/2 0/2 0/2 2 0/2 0/2 0/2 3 0/2 0/2 0/2 4 0/2 0/2 1/2 5 1/2 0/2 0/2 6 2/2 1/2 0/2 7 0/2 0/2 0/2 8 0/2 0/2 1/2 qPCR results of barley (Calcule). Numbers indicate seeds positive in PsJN specific qPCR of total number of seeds tested. Base middle and top refer to seed positions for each of 8 samples (PsJN-endoseed). C-PsJN C-PsJN C-PsJN Head (top) (middle) (bottom) 1 1/2 0/2 1/2 2 1/2 1/2 1/2 3 2/2 1/2 2/2 4 0/2 1/2 1/2 5 0/2 0/2 0/2 6 0/2 0/2 0/2 7 0/2 0/2 0/2 8 0/2 0/2 0/2 qPCR results of barley (Eunova). Numbers indicate seeds positive in PsJN specific qPCR of total number of seeds tested. Base middle and top refer to seed positions for each of 8 samples (PsJN-endoseed). E-PsJN E-PsJN E-PsJN Head (top) (middle) (bottom) 1 1/2 2/2 1/2 2 1/2 1/2 1/2 3 2/2 2/2 0/2 4 1/2 2/2 0/2 5 1/2 1/2 1/2 6 0/2 0/2 1/2 7 1/2 0/2 0/2 8 1/2 1/2 0/2 Conclusions
Example 23: Drought Stress Assay with Seeds of
Experiment Description
0 no germination 1 germination 2 germinated, cotyledon closed 3 erect, cotyledon closed 4 cotyledon visible but closed 5 cotyledon visible but not fully opened 6 cotyledon fully opened 7 cotyledon completely opened + new shoot 8 2. shoot 9 additional shoots 0 no wilting 1 plant is droopy, leaves start curling 2 cotyledon starts wilting 3 cotyledon dried up, real leaves begin to wilt till are dried up 4 all parts of the plant are dried up Results
CONCLUSIONS
Acidobacterium, Geothrix, Holophaga, Acidimicrobium, Actinobaculum, Actinomyces, Arcanobacterium, Mobiluncus, Trueperella, Varibaculum Corynebacterium, Gordoniaceae, Mycobacterium, Nocardia, Rhodococcus, Smaragdicoccus, Micropolyspora, Frankia, Actinotelluria, Blastococcus, Geodermatophilus, Modestobacter, Angustibacter, Kineococcus, Kineosporia, Pseudokineococcus, Quadrisphaera, Glycomyces, Haloglycomyces, Stackebrandtia, Beutenbergia, Miniimonas, Salana, Serinibacter, Bogoriella, Oerskovia, Paraoerskovia, Tropheryma, Brachybacterium. Dermabacter, Devriesea, Helcobacillus, Nostocoida type II, Arsenicicoccus, Fodinibacter, Humibacillus, Humihabitans, Intrasporangium, Janibacter, Knoellia, Kribbia, Lapillicoccus, Marihabitans, Ornithinibacter, Ornithinicoccus, Ornithinimicrobium, Oryzihumus, Phycicoccus, Serinicoccus, Terrabacter, Terracoccus, Tetrasphaera, Crocebacterium, Cryobacterium, Cryocola, Curtobacterium, Frigoribacterium, Frondihabitans, Glaciibacter, Gulosibacter, Herbiconiux, Humibacter, Klugiella, Labedella, Leifsonia, Leucobacter, Marisediminicola, Microbacterium, Microcella, Microterricola, Mycetocola, Okibacterium, Phycicola, Plantibacter, Pseudoclavibacter, Rathayibacter, Rhodoglobus, Salinibacterium, Schumannella, Subtercola, Yonghaparkia, Zimmermannell, Acaricomes, Arthrobacter, Auritidibacter, Citricoccus, Kocuria, Micrococcus, Nesterenkonia, Renibacterium, Rothia, Sinomonas, Tersicoccus, Yaniella, Zhihengliuella, Cellulosimicrobium, Isoptericola, Myceligenerans, Promicromonospora, Xylanibacterium, Xylanimicrobium, Xylanimonas, Rarobacter, Sanguibacte, Actinaurispora, Actinocatenispora, Actinoplanes, Allocatelliglobosispora, Asanoa, Catellatospora, Catelliglobosispora, Catenuloplanes, Couchioplanes, Dactylosporangium, Hamadaea, Jishengella, Krasilnikovia, Longispora, Luedemannella, Micromonospora, Phytohabitans, Phytomonospora, Pilimelia, Planosporangium, Plantactinospora, Polymorphospora, Pseudosporangium, Rugosimonospora, Salinispora, Spirilliplanes, Solwaraspora, Verrucosispora, Virgisporangium, Wangella, Nocardia, Kribella, Propionibacterium, Actinosynnemata, Actinoalloteichus, Actinokineospora, Actinomycetospora, Actinophytocola, Actinosynnema, Alloactinosynnema, Allokutzneria, Amycolatopsis, Crossiella, Goodfellowiella, Haloechinothrix, Kibdelosporangium, Kutzneria, Lechevalieria, Lentzea, Prauseria, Prauserella, Pseudonocardia, Saccharomonospora, Saccharopolyspora, Saccharothrix, Saccharothrixopsis, Sciscionella, Streptoalloteichus, Thermobispora, Thermocrispum, Umezawaea, Yuhushiella, Kitasatospora, Streptomyces, Streptoverticillium, Nocardiopsa, Streptosporangia, Thermomonospora, Actinomadura, Actinocorallia, Spirillospora, Aeriscardovia, Alloscardovia, Bifidobacterium, Gardnerella, Metascardovia, Parascardovia, Scardovia. Atopobium, Collinsella, Coriobacterium, Cryptobacterium, Denitrobacterium, Eggerthella, Slackia, Rubrobacter, Sphaerobacter, Aquifex, Hydrogenivirga, Hydrogenobacter, Hydrogenobaculum, Thermocrinis, Hydrogenothermus, Persephonella, Sulfurihydrogenibium, Venenivibrio, Bacteroides, Acetofilamentum, Acetomicrobium, Acetothermus, Anaerorhabdus, Megamonas, Rikenella, Marinilabilia, Porphyromonas, Dysgonomonas, Prevotella, Actibacter, Aequorivita, Algibacter, Aquimarina, Arenibacter, Bergeyella, Bizionia, Capnocytophaga, Cellulophaga, Chryseobacterium, Cloacibacterium, Coenonia, Costertonia, Croceibacter, Dokdonia, Donghaeana, Elizabethkingia, Empedobacter, Epilithonimonas, Flagellimonas, Flaviramulus, Flavobacterium, Formosa, Gaetbulibacter, Galbibacter, Gelidibacter, Gillisia, Gilvibacter, Gramella, Joostella, Kaistella, Kordia, Krokinobacter, Leeuwenhoekiellam, Lutibacter, Lutimonas, Maribacter, Mariniflexile, Marixanthomonas, Mesonia, Muricauda, Myroides, Nonlabens, Ornithobacterium, Pibocella, Polaribacter, Psychroflexus, Psychroserpens, Riemerella, Robiginitalea, Salegentibacter, Salinimicrobium, Sandarakinotalea, Sediminibacter, Sediminicola, Sejongia, Spongiimonas, Stenothermobacter, Subsaxibacter, Subsaximicrobium, Tamlana, Tenacibaculum, Ulvibacter, Vitellibacter, Wautersiella, Weeksella, Winogradskyella, Yeosuana, Zeaxanthinibacter, Zhouia, Zobellia, Zunongwangia, Myroides, Psychromonas, Blattabacterium, Rhodotherma, Sphingobacterium, Pedobacter, Mucilaginibacter, Saprospira, Haliscomenobacter, Lewinella, Flexibacter, Cyclobacterium, Cytophaga, Dyadobacter, Flectobacillus, Hymenobacter, Meniscus, Microscilla, Runella, Spirosoma, Sporocytophaga, Flammeovirga, Flexithrix, Persicobacter, Thermonema, Crenothrix, Chitinophaga, Rhodothermus, Toxothrix, Chlamydia, Chlamydophila, Parachlamydia, Protochlamydia, Neochlamydia, Rhabdochlamydia, Simkania, Fritschea, Waddlia, Chlorobium, Ancalochloris, Chloroherpeton, Clathrochloris, Pelodictyon, Prostheochloris, Herpetosiphon, Chloroflexus, Oscillochloris, Chloronema, Roseiflexus, Heliothrix, Herpetosiphon, Chrysiogenes, Microcystis, Anacystis, Chondrocystis, Eucapsis, Gloeocapsa, Merismopedia, Polycystis, Camptylonemopsis, Coleodesmiopsis, Coleodesmium, Fortiea, Hassallia, Microchaete, Ophiothrix, Petalonema, Rexia, Spirirestris, Streptostemon, Tolypothrix, Anabaena, Anabaenopsis, Aphanizomenon, Aulosira, Cylindrospermopsis, Cylindrospermum, Loefgrenia, Nodularia, Nostoc, Wollea, Amphithrix, Calothrix, Dichothrix, Diplotrichia, Gaillardotella, Gardnerula, Gloeotrichia, Gloiotrichia, Heteractis, Inomeria, Isactis, Mastigonema, Montanoa, Primorivularia, Rivularia, Rivulariopsis, Sacconema, Tildenia, Zonotrichites, Arthrosiphon, Arthrosiphon, Brasilonema, Desmonema, Diplocolon, Drilosiphon, Drilosiphon, Eoplectonema, Kyrtuthrix, Paraortonella, Scytonema, Scytonematopsis, Stigonemata, Deferribacter, Denitrovibrio, Flexistipes, Geovibrio, Deinococcus, Thermus, Meiothermus, Marinithermus, Oceanithermus, Vulcanithermus, Dictyoglomus, Fibrobacter, Alicyclobacillus, Pasteuria, Sulfobacillus, Alkalibacillus, Amphibacillus, Anoxybacillus, Bacillus, Caldalkalibacillus, Cerasibacillus, Exiguobacterium, Filobacillus, Geobacillus, Gracilibacillus, Halalkalibacillus, Halobacillus, Halolactibacillus, Jeotgalibacillus, Lentibacillus, Lysinibacillusm, Marinibacillus, Oceanobacillus, Ornithinibacillus, Paraliobacillus, Paucisalibacillus, Pelagibacillus, Piscibacillus, Pontibacillus, Saccharococcus, Salibacillus, Salimicrobium, Salinibacillus, Salirhabdus, Salsuginibacillus, Tenuibacillus, Terribacillus, Thalassobacillus, Ureibacillus, Virgibacillus, Vulcanibacillus, Caryophanon, Brochothrix, Listeria, Paenibacillus, Ammoniphilus, Aneurinibacillus, Brevibacillus, Oxalophagus, Thermicanus, Thermobacillus, Filibacter, Kurthia, Planomicrobium, Sporosarcina, Sinobaca, Sporolactobacillus, Tuberibacillus, Staphylococcus, Gemella, Jeotgalicoccus, Macrococcus, Salinicoccus, Nosocomiicoccus, Shimazuella, Thermoactinomyces, Turicibacter, Acidaminococcus, Acetonema, Anaerospora, Anaerovibrio, Centipeda, Dendrosporobacter, Desulfosporomusa, Dialister, Megamonas, Megasphaera, Rogosa, Mitsuokella, Negativicoccus, Pectinatus, Pelosinus, Propionispira, Propionispora, Psychrosinus, Quinella, Schwartzia, Selenomonas, Sporolituus, Sporomusa, Thermosinus, Veillonella, Zymophilus, Phascolarctobacterium, Succiniclasticum, Succinispira, Acetanaerobacterium, Acetivibrio, Acidaminobacter, Alkaliphilus, Anaerobacter, Anaerotruncus, Anoxynatronum, Bryantella, Butyricicoccus, Caldanaerocella, Caloramator, Caloranaerobacter, Caminicella, Candidatus Arthromitus, Clostridium, Coprobacillus, Dorea, Ethanologenbacterium, Faecalibacterium, Garciella, Guggenheimella, Hespellia, Linmingia, Natronincola, Oxobacter, Parasporobacterium, Sarcina, Soehngenia, Sporobacter, Subdoligranulum, Tepidibacter, Tepidimicrobium, Thermobrachium, Thermohalobacter, Tindallia, Acetobacterium, Alkalibaculum, Anaerofustis, Anaerovorax, Eubacterium, Mogibacterium, Pseudoramibacter, Lachnospira, Anaerospora, Carboxydothermus, Cryptanaerobacter, Dehalobacter, Desulfitobacterium, Desulfonispora, Desulfosporosinus, Desulfotomaculum, Pelotomaculum, Peptococcus, Syntrophobotulus, Thermincola, Thermoterrabacterium, Filifactor, Finegoldia, Fusibacter, Helcococcus, Peptostreptococcus, Tissierella, Syntrophomonad, Halanaerobia, Halobacteroidaceae, Thermoanaerobacteria, Entomoplasma, Mesoplasma, Spiroplasma, Anaeroplasma, Asteroleplasma, Erysipelothrix, Holdemania, Acholeplasma, Phytoplasma (Candidatus), Fusobacterium, Gemmatimonas, Nitrospira, Gemmata, Isosphaera, Pirellula, Planctomyces, Brocadia (candidatus), Kuenenia (candidatus), Scalindua (candidatus), Anammoxoglobus (candidatus), Jettenia (candidatus), Asticcacaulis, Brevundimonas, Caulobacter, Phenylobacterium, Kordiimonas, Parvularcula, Aurantimonas, Fulvimarina, Bartonella, Beijerinckia, Chelatococcus, Derxia, Methylocella, Afipia, Agromonas, Blastobacter, Bosea, Bradyrhizobium, Nitrobacter, Oligotropha, Photorhizobium, Rhodoblastus, Rhodopseudomonas, Brucella, Mycoplana, Ochrobactrum, Ancalomicrobium, Ancylobacter, Angulomicrobium, Aquabacter, Azorhizobium, Blastochloris, Devosia, Dichotomicrobium, Filomicrobium, Gemmiger, Hyphomicrobium, Labrys, Methylorhabdus, Pedomicrobium, Prosthecomicrobium, Rhodomicrobium, Rhodoplanes, Seliberia, Starkeya, Xanthobacter, Methylobacterium, Microvirga, Protomonas, Roseomonas, Methylocystis, Methylosinus, Methylopila, Aminobacter, Aquamicrobium, Defluvibacter, Hoeflea, Mesorhizobium, Nitratireductor, Parvibaculum, Phyllobacterium, Pseudaminobacter, Agrobacterium, Rhizobium, Sinorhizobium, Liberibacter (candidatus), Rhodobium, Ahrensia, Albidovulum, Amaricoccus, Antarctobacter, Catellibacterium, Citreicella, Dinoroseobacter, Haematobacter, Jannaschia, Ketogulonicigenium, Leisingera, Loktanella, Maribius, Marinosulfonomonas, Marinovum, Maritimibacter, Methylarcula, Nereida, Oceanibulbus, Oceanicola, Octadecabacter, Palleronia, Pannonibacter, Paracoccus, Phaeobacter, Pseudorhodobacter, Pseudovibrio, Rhodobaca, Rhodobacter, Rhodothalassium, Rhodovulum, Roseibacterium, Roseibium, Roseicyclus, Roseinatronobacter, Roseisalinus, Roseivivax, Roseobacter, Roseovarius, Rubrimonas, Ruegeria, Sagittula, Salipiger, Silicibacter, Staleya, Stappia, Sulfitobacter, Tetracoccus, Thalassobacter, Thalassobius, Thioclava, Yangia, Azospirillum, Dechlorospirillum, Defluvicoccus, Inquilinus, Magnetospirillum, Phaeospirillum, Rhodocista, Rhodospira, Rhodospirillum, Rhodovibrio, Roseospira, Skermanella, Thalassospira, Tistrella, Acetobacter, Acidicaldus, Acidiphilium, Acidisphaera, Acidocella, Acidomonas, Asaia, Belnapia, Craurococcus, Gluconacetobacter, Gluconobacter, Kozakia, Leahibacter, Muricoccus, Neoasaia, Oleomonas, Paracraurococcus, Rhodopila, Roseococcus, Rubritepida, Saccharibacter, Stella, Swaminathania, Teichococcus, Zavarzinia, Rickettsia, Orientia, Wolbachia, Aegyptianella, Anaplasma, Cowdria, Ehrlichia, Neorickettsia, Caedibacter, Holospora, Lyticum, Odyssella, Symbiotes, Tectibacter, Blastomonas, Citromicrobium, Erythrobacter, Erythromicrobium, Kaistobacter, Lutibacterium, Novosphingobium, Porphyrobacter, Sandaracinobacter, Sphingobium, Sphingomonas, Sphingopyxis, Zymomonas, Achromobacter, Alcaligenes, Bordetella, Pelistega, Sutterella, Taylorella, Burkholderia, Chitinimonas, Cupriavidus, Lautropia, Limnobacter, Pandoraea, Paucimonas, Polynucleobacter, Ralstonia, Thermothrix, Acidovorax, Aquabacterium, Brachymonas, Comamonas, Curvibacter, Delftia, Hydrogenophaga, Ideonella, Leptothrix, Limnohabitans, Pelomonas, Polaromonas, Rhodoferax, Roseateles, Sphaerotilus, Tepidimonas, Thiomonas, Variovorax, Collimonas, Duganella, Herbaspirillum, Herminiimonas, Janthinospirillum, Massilia, Naxibacter, Oxalobacter, Oxalicibacterium, Telluria, Hydrogenophilus, Tepidiphilus, Methylophilus, Methylobacillus, Methylovorax, Alysiella, Aquaspirillum, Catenococcus, Chromobacterium, Eikenella, Formivibrio, Iodobacter, Kingella, Microvirgula, Neisseria, Prolinoborus, Simonsiella, Vitreoscilla, Vogesella, Nitrosomonas, Nitrosospira, Gallionella, Spirillum, Azoarcus, Azonexus, Azospira, Azovibrio, Dechloromonas, Ferribacterium, Petrobacter, Propionivibrio, Rhodocyclus, Sterolibacterium, Thauera, Zoogloea, Acidithiobacillus, Thermithiobacillus, Aeromonas, Tolumonas, Anerobiospirillum, Ruminobacter, Succinimonas, Succinivibrio, Aestuariibacter, Agarivorans, Aliagarivorans, Alishewanella, Alteromonas, Bowmanella, Catenovulum, Glaciecola, Haliea, Marinimicrobium, Marinobacter, Marinobacterium, Microbulbifer, Saccharophagus, Salinimonas, Celerinatantimonads, Colwellia, Thalassomonas, Ferrimonas, Idiomarina, Moritella, Pseudoalteromonas, Algicola, Psychromonas, Shewanella, Cardiobacterium, Dichelobacter, Suttonella, Allochromatium, Amoebobacter, Chromatium, Halochromatium, Isochromatium, Lamprobacter, Lamprocystis, Marichromatium, Nitrosococcus, Pfennigia, Rhabdochromatium, Rheinheimera, Thermochromatium, Thioalkalicoccus, Thiobaca, Thiocapsa, Thiococcus, Thiocystis, Thiodictyon, Thioflavicoccus, Thiohalocapsa, Thiolamprovum, Thiopedia, Thiophaeococcus, Thiorhodococcus, Thiorhodovibrio, Thiospirillum, Alkalilimnicola, Alkalispirillum, Aquisalimonas, Arhodomonas, Ectothiorhodosinus, Ectothiorhodospira, Halorhodospira, Natronocella, Nitrococcus, Thioalkalispira, Thioalkalivibrio, Thiohalospira, Thiorhodospira, Granulosicoccus, Halothiobacillus, Thioalkalispira, Alishewanella, Alterococcus, Aquamonas, Aranicola, Arsenophonus, Azotivirga, Blochmannia, Brenneria, Buchnera, Budvicia, Buttiauxella, Cedecea, Citrobacter, Cronobacter, Dickeya, Edwardsiella, Enterobacter, Erwinia, Escherichia, Ewingella, Grimontella, Hafnia, Hamiltonella, Klebsiella, Kluyvera, Leclercia, Leminorella, Moellerella, Morganella, Obesumbacterium, Pantoea, Pectobacterium, Candidatus Phlomobacter, Photorhabdus, Plesiomonas, Pragia, Proteus, Providencia, Rahnella, Regiella, Raoultella, Salmonella, Samsonia, Serratia, Shigella, Sodalis, Tatumella, Trabulsiella, Wigglesworthia, Yokenella, Coxiella, Legionells, Crenothrix, Chitinophaga, Rhodothermus, Toxothrix, Methylomonas, Methylobacter, Methylococcus, Methylomicrobium, Methylosphaera, Methylocaldum, Alcanivorax, Uruburuia, Hahella, Carnimonas, Chromohalobacter, Cobetia, Halomonas, Portiera, Zymobacter, Litocolum, Balneatrix, Fundibacter, Marinomonas, Marinospirillum, Neptunomonas, Oceanospirillum, Oleiphilum, Saccharospirillum, Actinobacillus, Aggregatibacter, Haemophilus, Lonepinella, Pasteurella, Mannheimia, Phocoenobacter, Acinetobacter, Alkanindiges, Branhamella, Enhydrobacter, Moraxella, Paraperlucidibaca, Perlucidibaca, Psychrobacter, Azomonas, Azomonotrichon, Azorhizophilus, Azotobacter, Cellvibrio, Mesophilobacter, Pseudomonas, Rhizobacter, Rugamonas, Serpens, Salinisphaer, Francisella, Cycloclasticus, Hydrogenovibrio, Methylophaga, Piscirickettsia, Thioalkalimicrobium, Thiomicrospira, Achromatium, Beggiatoa, Leucothrix, Macromonas, Thiobacterium, Thiomargarita, Thioploca, Thiospira, Thiothrix, Aliivibrio, Allomonas, Beneckea, Enhydrobacter, Listonella, Lucibacterium, Photobacterium, Salinivibrio, Vibrio, Sinobactera, Frateuria, Luteimonas, Lysobacter, Nevskia, Pseudoxanthomonas, Rhodanobacter, Stenotrophomonas, Xanthomonas, Xylella, Algicola, Colwellia, Thalassomonas, Shewanella, Bdellovibrio, Micavibrio, Vampirovibrio, Desulfobacteraceae, Desulfobulbaceae, Desulfoarculaceae, Desulfovibrio, Bilophila, Lawsonia, Desulfohalobium, Desulfomonas, Desulfonatronovibrio, Desulfomicrobium, Desulfonatronum, Desulfurella, Hippe, Desulfuromonas, Desulfuromusa, Malonomonas, Pelobacter, Geoalkalibacter, Geobacter, Mixococcus, Stigmatella, Sorangium, Desulfacinum, Desulforhabdus, Syntrophobacter, Syntrophothermus, Thermaerobacter, Thermodesulforhabdus, Syntrophus, Smithella, Campylobacter, Arcobacter, Sulfurospirillum, Thiovulum, Helicobacter, Wolinella, Caminibacter, Lebetimonas, Nautilia, Nitratifractor, Nitratiruptor, Thioreductor, Borrelia, Brevinema, Cristispira, Spirochaeta, Spironema, Treponema, Brachyspira, Leptospira, Leptonema, Thermodesulfobacterium, Thermatoga, Verrucomicrobium, Prosthecobacter, and Akkermansia. Acetobacter sp.1 Achromobacter sp.1 Acidovorax sp.4 Acidovorax sp.1 ATCC 17978 (ABO13540)5 ATCC 17978 (ABO13540)5 Acinetobacter sp.3 Acinetobacter sp.1 Actinobacter sp.6 Actinomyces sp.1 Arthrobacter sp.1 49626, ref|ZP_03568303.1|5 Azoarcus sp. strain BH728 Azoarcus spp.9 ref|ZP_03110815.1|5 ref|YP_001486461.1|5 Bacillus sp.1 Bacillus sp. SG-1 (EDL63514)5 Bacillus sp. SG-1 (EDL63514)5 (ACB96131)5 (ACB96131)5 ATCC 15703, ref|YP_909356.1|5 DJO10A, ref|ZP_00120992.1|5 ref|ZP_03548131.1|5 Bordetella sp.1 USDA 110 (BAC53039)5 USDA 110 (BAC53039)5 USDA 110, ref|NP_769684.1|5 Bradyrhizobium sp. BTAi1, ref|YP_001220569.1|5 Bradyrhizobium sp. ORS278, ref|YP_001208056.1|5 Brevundimonas sp.12 Brevundimonas sp.3 STM815, ref|YP_001857126.1|5 Burkholderia sp.3 Capnocytophaga sp.1 NA1000 (ACL97137)5 NA1000 (ACL97137)5 Caulobacter sp.1 Cellulomonas sp.1 (ACE84205)5 (ACE84205)5 Cellvibrio sp.14 2588, ref|ZP_04357604.1|5 (AAM72443)5 (AAM72443)5 Chryseobacterium sp.1 Chryseobacterium sp.3 BAA-895, ref|YP_001452611.1|5 BAA-895, ref|YP_001455544.1|5 Citrobacter sp.1 ATCC 824, ref|NP_349544.1|5 NCIMB 8052, ref|YP_001308375.1|5 Okra, ref|YP_001780987.1|5 ref|ZP_02626830.2|5 ref|ZP_02079097.1|5 1402, ref|ZP_02429609.1|5 Clostridium sp. SS2/1, ref|ZP_02439410.1|5 Clostridium spp.15 25986, ref|ZP_01773331.1|5 34H, ref|YP_271045.1|5 Comamonas sp.1 Coryebacterium sp.1 Corynebacterium sp.3 Curtobacterium sp.1 Cyanothece sp. PCC 7425, ref|YP_002483742.1|5 DSM 11300 (ABF44161)5 DSM 11300 (ABF44161)5 Deleya sp.1 Dokdonella sp.3 Enterobacter sp.1 subsp.cloacae2 ATCC BAA-894, ref|YP_001436701.1|5 Enterobacter sp.3 Enterobacter sp.16 Enterobacter sp. 638 (ABP60470)5 Enterobacter sp. 638 (ABP60470)5 Erwinia sp.1 Erwinia-like sp.1 Escherichia sp.1 Flavobacteriales bacterium HTCC2170, ref|ZP_01105756.1|5 Flavobacterium sp.1 Frigoribacterium sp.12 UQM 2246, ref|ZP_02731927.1|5 Geobacter sp. FRC-32, ref|YP_002535550.1|5 Herbaspirillum sp.1 (ABX02684)5 (ABX02684)5 23779, ref|YP_001545781.1|5 IC16111 342 (ACI07402)5 342 (ACI07402)5 Klebsiella sp.1 Kluyvera sp.1 ref|ZP_02160368.1|5 Lactobacillus sp.1 Leptospirillum sp.5 Leptospirillum sp. Group II ‘5-way CG’, gb|EDZ37921.1|5 Leuconostoc sp.1 marine gamma HTCC2148, gb|EEB80372.1|5 Massilia sp.3 MAFF303099 (BAB54059)5 MAFF303099 (BAB54059)5 Mesorhizobium sp. GWS-SE-H10311 gb|ACF28618.1|5 ref|YP_502123.1|5 Bacterial endophytesReference gb|ABI17430.1|5 (ACL62186)5 (ACL62186)5 Methylobacterium sp.1 (AAU91441)5 (AAU91441)5 takaoensis11 Micrococcus sp.1 ATCC 23134, ref|ZP_01688989.1|5 Moraxella sp.6 (ABK70727)5 (ABK70727)5 1622, ref|YP_629504.1|5 X14 (ABE64325)5 X14 (ABE64325)5 Nb-255, ref|YP_318852.1|5 10152 (BAD60391)5 10152 (BAD60391)5 Nocardia sp.1 73102, ref|YP_001869999.1|5 ref|NP_484408.1|5 Paenibacillus sp.6 Paenibacillus sp.1 Paenibacillus sp. JDR-2 (EDS55035)5 Paenibacillus sp. JDR-2 (EDS55035)5 Pantoea sp.1 Pasteurella sp.1 ref|YP_002128524.1|5 Photobacterium sp.1 Phyllobacterium sp.1 Plantibacter sp.6 Polaribacter sp. 3-17, gb|ABS01329.1|5 Providencia sp.1 Pseudoalteromonas sp.5 Pseudoalteromonas sp. AS-11, dbj|BAB61726.1|5 (ABR85743)5 (ABR85743)5 1 (ABA76623)5 1 (ABA76623)5 (ABQ77146)5 (ABQ77146)5 (ACA72735)5 Pseudomonas sp.1 Pseudomonas sp.3 (AAZ34722)5 Psychrobacter sp.1 700755, ref|ZP_01254843.1|5 bv. ref|ZP_02293701.1|5 bv. KLH11, gb|EEE38433.1|5 HTCC2654, ref|YP_002689546.1|5 Rickettsia-like sp.1 ref|ZP_00958912.1|5 Roseovarius sp. TM1035, ref|ZP_01880909.1|5 (ACH74415)5 (ACH74415)5 (ACF66546)5 sp|Q684Q1.1|LUXS_SERMA5 emb|CAJ86499.1|5 Serratia sp.1 55 SB2B, ref|YP_928287.1|5 Shewanella sp.1 Shigella sp.1 WSM419, ref|YP_001327237.1|5 Sphingomonas sp. M3C203B- B12 Sphingomonas sp. SKA58 (EAT09931)5 Sphingomonas sp. SKA58 (EAT09931)5 Staphylococcus sp.1 Stenotrophomomonas sp.1 K279a, ref|YP_001972030.1|5 DW4/3-1, ref|ZP_01462709.1|5 LMG 18311, ref|YP_138642.1|5 4680, ref|NP_824495.1|5 Sulfitobacter sp. NAS-14.1, ref|ZP_00963622.1|5 Synechococcus sp. WH 5701 (EAQ76095)5 Synechococcus sp. WH 5701 (EAQ76095)5 Undibacterium sp.3 Variovorax sp.1 DG1235, gb|EDY84015.1|5 Vibrio sp.3 Vibrio sp.1 citri str. 306, ref|NP_642203.1|5 ref|YP_001903550.1|5 emb|CAA66459.1|5 ref|YP_201507.1|5 Xanthomonas sp.1 Yersinia sp.1
Reference Guide
Reference 1 Hurst, Christos J., et al. Reference 2 Hardoim, P. R., et al. (2012) PLoS ONE 7(2): e30438. Reference 3 Liu, Y., et al. (2013) Annals of Microbiology, 63(1), 71-79. Reference 4 Mano, H., et al. (2006) Microbes and Environment 21(2) 86-100 Reference 5 Sessitch, A. et al. (2012) MPMI 25(1) 28-36 Reference 6 Muhammad, N., et al. (2012) Endophytes E-COST FA1103 Working Group Meeting in Trento/S. Michele, Italy November 2012. (poster) Reference 7 Johnston-Monje D, Raizada MN (2011) PLoS ONE 6(6): e20396. Reference 8 Hurek, T., Reinhold-Hurek, B. (2003) J Biotechnol. 106(2-3): 169-78. Reference 9 Engelhard M., et al, (2000) Environ Microbiol. (2): 131-41. Reference 10 Okunishi, S., et al. (2005) Microbes and Environment 20(3) 168-177. Reference 11 Johnston-Monje, D., et al. (2013) BMC Plant Biology (submitted). Reference 12 Sessitch, A., et al. (2004) Canadian Journal of Microbiology 50:4. p: 239. Reference 13 Sessitch, A., et al. IJSEM May 2005 vol. 55 no. 3 1187-1192 Reference 14 Sessitch, A., et al. (2002) FEMS Microbiology Ecology 39: 23-32 Reference 15 Minamisawa K., et al. (2004) Appl Environ Microbiol. 70(5): 3096-102.; Reference 7 Reference 16 Seghers, D. (2004) APPLIED AND ENVIRONMENTAL MICROBIOLOGY 1475-1482 Reference 17 Bulgari, D., et al. (2009) The Journal of Microbiology p. 393-401 Reference 18 Verstraete 2004 Reference 19 AMANN R., FUCHS B. M. (2008): Single-cell identification in microbial communities by improved fluorescence in situ hybridization techniques. Nature reviews microbiology 6: 339-348 Reference 20 Chelius MK, Triplett EW (2001) The diversity of archaea and bacteria in association with the roots of Reference 21 Edwards U, Rogall T, Blocker H, Emde M, Bottger EC (1989) Isolation and direct complete nucleotide determination of entire genes - Characterisation of a gene coding for 16S- ribosomal RNA. Nucleic Acids Research 17: 7843-7853. Reference 22 Prischl, M., Hackl, E., Pastar, M., Pfeiffer, S. and Sessitsch A. (2012) Genetically modified Bt maize lines containing cry3Bb1, cry1A105 or cry1Ab2 do not affect the structure and functioning of root-associated endophyte communities. Appl Soil Ecol 54, 39-48. Reference 23 NAVEED, M., MITTER B., YOUSAF S., PASTAR M., AFZAL M., SESSITSCH A. 2014. The endophyte plant beneficial traits and colonization characteristics. Reference 24 Madi, L. and Henis, Y. (1989) Aggregation in factors involved in cell-to-cell adhesion. Reference 25 Rashid, M. H. and Kornberg, A. (2000) Inorganic polyphosphate is needed for swimming, swarming, and twitching motilities of Pseudomonas aeruginosa. 4885-4890. Reference 26 Djordjevic, D., Wiedmann, M. and McLandsborough, L. A. (2002) Microtiter plate assay for assessment of Reference 27 Medina, P. and Baresi, L. (2007) Rapid identification of gelatin and casein hydrolysis using TCA. Reference 28 Sarwar, M., M. Arshad, D. A. Martens and W. T. Jr. Frankenberger. 1992. Tryptophane- dependendent biosynthesis of auxin in soil. Reference 29 Feller et al., In: Meier U. (ed.) (2001): Growth stages of mono- and dicotyledonous plants. Federal Biological Research Center for Agriculture and Forestry, 2nd edition Reference 30 Mehta, S. and Nautiyal, C. S. (2001) An efficient method for screening phosphate solubilization bacteria. Reference 31 Rosado, A. S., De Azevedo, F. S., da Croz. D. W., Van Elas, J. D. and Seldin, L. (1998) Phenotypic and genetic diversity of rhizophere soil of different grasses. Reference 32 Schwyn, B. and Neilands, J. B. (1987) Universal chemical assay for the detection and determination of siderophores. Reference 33 Weaver, P. K., Wall, J. D. and Gest H. (1975) Characterization of Reference 34 Cappuccino, J. G. and Sherman, N. (1992) Biochemical activities of microorganisms. In USA. Reference 35 Liu, M. Gonzalez, J. E., Willis, L. B.,. and Walker, G. C. (1998) A Novel Screening Method for Isolating Exopolysaccharide deficient Mutants. Reference 36 Spiekermann, P., Rehm, B. H. A., Kalscheuer, R., Baumeister, D. and Steinbuchel, A. (1999) A sensitive, viable-colony staining method using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and other storage compounds. 73-80. Reference 37 Cha, C., Gao, P., Chen, Y. C., Shaw, P. D. and Farrand, S. K. (1998). Production of acyl- homoserine lactone quorum-sensing signals by gram-negative plant associated bacteria. Reference 38 Männistö, M. K. and Häggblom, M. M. (2006) Characterization of psychrotolerant heterotrophic bacteria from Finnish Lapland. Reference 39 Teather, R. M. and Wood, P. J. (1982) Use of congo red-polysacharide interactions in enumeration and characterization of cellulolytic bacteria in the bovine rumen. Reference 40 Chernin, L. S., Winson, M. K., Thompson, J. M., Haran, S., Bycroft, B. W., Chet, I., Williams, P. and Stewart, G. S. A. B. (1998) Chitinolytic activity in Substrate analysis and regulation by quorum sensing. Reference 41 Mateos, P. F., Jimenez-Zurdo, J. I., Chen, J., Squartini, A. S., Haack, S. K., Martinez-Molina, E., Hubbell, D. H. and Dazzo, F. B. (1992) Cell-associated pectinolytic and cellulolytic enzymes in Reference 42 Abarenkov, K., R. Henrik Nilsson, K.-H. Larsson, I. J. Alexander, U. Eberhardt, S. Erland, K. Høiland, R. Kjøller, E. Larsson, T. Pennanen, R. Sen, A. F. S. Taylor, L. Tedersoo, B. M. Ursing, T. Vrålstad, K. Liimatainen, U. Peintner, and U. Kõljalg. 2010. The UNITE database for molecular identification of fungi - recent updates and future perspectives. New Phytologist 186: 281-285. Reference 43 Dunn, R. R., N. Fierer, J. B. Henley, J. W. Leff, and H. L. Menninger. 2013. Home life: factors structuring the bacterial diversity found within and between homes. PLoS One 8:e64133. Reference 44 Edgar, R. C. 2013. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nature methods 10: 996-8. Reference 45 Fierer, N., J. W. Leff, B. J. Adams, U. N. Nielsen, S. T. Bates, C. L. Lauber, S. Owens, J. a. Gilbert, D. H. Wall, and J. G. Caporaso. 2012. Cross-biome metagenomic analyses of soil microbial communities and their functional attributes. Proceedings of the National Academy of Sciences Reference 46 Lundberg, D. S., S. Yourstone, P. Mieczkowski, C. D. Jones, and J. L. Dangl. 2013. Practical innovations for high-throughput amplicon sequencing. Nature methods 10: 999-1002. Reference 47 McDonald, D., M. N. Price, J. Goodrich, E. P. Nawrocki, T. Z. DeSantis, A. Probst, G. L. Andersen, R. Knight, and P. Hugenholtz. 2012. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME journal 6: 610-8. Reference 48 McGuire, K. L., S. G. Payne, M. I. Palmer, C. M. Gillikin, D. Keefe, S. J. Kim, S M. Gedallovich, J. Discenza, R. Rangamannar, J. a Koshner, A. L. Massmann, G. Orazi, A. Essene, J. W. Leff, and N. Fierer. 2013. Digging the New York City Skyline: soil fungal communities in green roofs and city parks. PloS one 8:e58020. Reference 49 Wang, Q., G. M. Garrity, J. M. Tiedje, and J. R. Cole. 2007. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Applied and environmental microbiology 73: 5261-7. Reference 50 Edgar, R. C. 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26: 2460-2461. Reference 51 Lundberg, D. S., S. L. Lebeis, S. H. Paredes, S. Yourstone, J. Gehring, S. Malfatti, J. Tremblay, A. Engelbrektson, V. Kunin, T. G. del Rio, R. C. Edgar, T. Eickhorst, R. E. Ley, P. Hugenholtz, S. G. Tringe, and J. L. Dangl. 2012. Defining the core root microbiome. Nature 488: 86-90. Reference 52 R Core Team. 2013. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. Reference 53 Massol-Deya A. A., Odelson D. A., Hickey R. F., Tiedje J. M. 1995. In: Molecular Microbial Ecology Manual. p289-296. Ed.: Akkermans A. D. L., Van Elsas J. D., De Bruijn F. J. Springer Netherlands. Reference 54 Wang K, Kang L, Anand A, Lazarovits G, Mysore KS. 2007. Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv. New Phytol. 174(1): 212-23. Reference 55 Rodriguez RJ, Henson J, Van Volkenburgh E, Hoy M, Wright L, Beckwith F, Kim YO, Redman RS. 2008. Stress tolerance in plants via habitat-adapted symbiosis. ISME J. Apr; 2(4): 404-16. AF226166 AF226167 AF226168 AF226169 AF226170 AF226171 AF226172 AF226173 AF226174 AF226175 AF226176 AF226177 AF226178 AF226179 AF226180 AF226181 AF226182 AF226183 AF226184 AF226185 AF226186 AF226187 AF226188 AF226189 AF226190 AF226191 AF226192 AF226193 AF226194 AF226195 AF226196 AF226197 AF226198 AF226199 AF226200 AF226201 AF226202 AF226203 AF226204 AF226205 AF226206 AF226207 AF226208 AF226209 AF226210 AF226211 AF226212 AF226213 AF226214 AF226215 AF226216 AF226217 AF226218 AF226219 AF226220 AF226221 AF226222 AF226223 AF226224 AF226225 AF226226 AF226227 AF226228 AF226229 AF226230 AF226231 AF226232 AF226233 AF226234 AF226235 AF226236 AF226237 AF226238 AF226239 AF226240 AF226241 AF226242 AF226243 AF226244 AF226245 AF226246 AF226247 AF226248 AF226249 AF226250 AF226251 AF226252 AF226253 AF226254 AF226255 AF226256 AF226257 AF226258 AF226259 AF226260 AF226261 AF226262 AF226263 AF226264 AF226265 AF226266 AF226267 AF226268 AF226269 AF226270 AF226271 AF226272 Allodus, Allomyces, Allosoma, Aloysiella, Alphitomyces, Alternaria, Alveolaria, Alysisporium, Amallospora, Amanita, Amanitella, Amanitopsis, Amastigis, Amastigosporium, Amaurascus, Amazonia, Amblyosporiopsis, Amblyosporium, Ameghiniella, Ameris, Amerodothis, Amerosporiella, Amerosporis, Amerosporium, Anierostege, Amoebochytrium, Amorphomyces, Amphichaeta, Amphichaete, Amphichaetella, Amphiciliella, Amphicytostroma, Amphididymella, Amphiernia, Amphinectria, Amphischizonia, Amphisphaeria, Amphorula, Ampullaria, Amylirosa, Amylis, Anaphysmene, Anaptychia, Anapyrenium, Anariste, Anatexis, Ancylistaceae, Ancylistes, Andreaea, Andreaeana, Anellaria, Anema, Angatia, Angelinia, Angiopoma, Angiopomopsis, Anhellia, Anisochora, Anisogramma, Anisomjces, Anisomyxa, Anisostomula, Anixia, Anixiopsis, Annularia, Anomomyces, Anomorpha, Anomothallus, Antenella, Antenellina, Antennulariella, Anthina, Anthomyces, Anthomyces, Anthomycetella, Anthostoma, Anthostomaria, Anthostomella, Anthostomellina, Anthracoderma, Anthracoidea, Anthracophyllum, Anthracothecium, Anthurus, Antromyces, Antromycopsis, Anzia, Aorate, Aphanascus, Aphanomyces, Aphanomycopsis, Aphanopeltis, Aphanostigme, Aphysa, Apiocarpella, Apiocrea, Apiognomonia, Apioporthe, Apioporthella, Apiorhynchostoma, Apiosphaeria, Apiospora, Apiosporella, Apiosporina, Apiosporina, Apiosporium, Apiosporopsis, Apiotrabutia, Apiotypa, Aplacodina, Aplanes, Aplopsora, Apocytospora, Apodachlya, Apodya, Aponectria, Aporhytisma, Aporophallus, Aposphaeria, Aposphaeriella, Aposphaeriopsis, Aposporella, Apostemidium, Appendicularia, Apyrenium, Arachniopsis, Arachniotus, Arachnium, Arachnomyces, Arachnopeziza, Araeospora, Araneomyces, Arcangelia, Arcangeliella, Arctomia, Arenaea, Areolaria, Argomycetella, Argopsis, Argynna, Armatella, Armillaria, Arnaudiella, Arrhenia, Arrhytidia, Arthonia, Arthoniactis, Arthoniae, Arthoniopsis, Arthotheliopsis, Arthothelium, Arthrinium, Arthrobotryella, Arthrobotrys, Arthrobotryum, Artlirobotryum, Arthropyrenia, Arthropyreniella, Arthrorhynchus, Arthrosporium, Articularia, Articulariella, Articulis, Asbolisia, Aschersonia, Aschersoniopsis, Ascobolaceae, Ascobolae, Ascobolus, Ascocalathium, Ascochyta, Ascochytella, Ascochytopsis, Ascochytula, Ascochytulina, Ascocorticium, Ascodesmis, Ascoidea, Ascoideaceae, Ascomycetella, Ascomycetes, Ascophanae, Ascophanus, Ascopolyporus, Ascosorus, Ascospora, Ascostratum, Ascotricha, Aseroe, Ashbia, Aspergillae, Aspergillopsis, Aspergillus, Aspergillus, Asperisporium, Aspidopyrenis, Aspidopyrenium, Aspidothea, Aspidothelium, Asporomyces, Asterella, Asteridiella, Asteridiellina, Asteridium, Asterina, Asterineae, Asterinella, Asteristium, Asterocalyx, Asteroconium, Asterodon, Asterodothis. Asterolibertia, Asteroma, Asteromassaria, Asteromella, Asteromidium, Asteromyxa, Asteronaevia, Asteronia, Asteropeltis, Asterophlyctis, Asterophora, Asteroporum, Asteropsis, Asterosporium, Asterostomella, Asterostomula, Asterostroma, Asterostromella, Asterothyrium, Asterothyrium, Astraeus, Astrocystis, Astrodochium, Astrosphaeriella, Astrotheliae, Astrothelium, Atichia, Atopospora, Atractiella, Atractilina, Atractina, Atractium, Atrichophytum, Auerswaldia, Auerswaldiella, Auerswaldiopsis, Aulacostroma, Aulaxina, Aulographella, Aulographis, Aulographum, Aureobasidium, Aureobasis, Auricularia, Auriculariaceae, Auriculariclla, Autoecomyces, Avettaea, Bacidia, Bactrexcipula, Bactridiopsis, Bactridium, Bactrosphaeria, Bactrospora, Baculospora, Baeodromus, Baeomyces, Baeumleria, Baggea, Bagnisiella, Bagnisiopsis, Bakeromyces, Bakerophoma, Balansia, Balansiella, Balansina, Balansiopsis, Balladyna, Balladynella, Balladynopsis, Balsamia, Balzania, Barclayella, Bargellinia, Barlaea, Barlaeina, Barssia, Bartalinia, Barya, Basiascella, Basiascum, Basidiella, Basidiobolus, Basdiobotrys, Basidiomycetes, Basidiophora, Basilocula., Basisporium, Battarina, Battarrea, Battarreopsis, Baunianniella, Baumiella, Beauveria, Beccariella, Beelia, Belonia, Belonidium, Beloniella. Belonioscypha, Belonioscyphella, Belonium, Bclonopeziza, Belonopsis, Belospora, Beltrania, Benguetia, Beniowskia, Berkelella, Berlesiella, Bertia, Bertiella, Bertiella, Biatora, Biatorella, Biatorellina, Biatorina, Bifusella, Bionectria, Bioporthe, Bioscypha, Biotyle, Bispora, Bisporella, Bivonella, Bizzozeria, Bizzozeriella, Blakeslea, Blasdalea, Blastenia, Blastocladia, Blastocladiaceae, Blastodendrum, Blastoderma, Blastodesmia, Blastomyces, Blastomycoides, Blastospora, Blastotrichum, Blennoria, Blennoriopsis, Blepharospora, Blodgettia, Bloxamia, Blumenavia, Blytridium, Bodinia, Boerlagella, Bolacotricha, Bolbitius, Boletinus, Boletogaster, Boletopsis, Boletus, Bolinia, Bolosphaera, Bombardia, Bombardiastrum, Bombardiella, Bombyliospora, Bommerella, Bonanseia, Bonia, Bonordeniella, Bonplandiella, Borenquenia, Bostrichonema, Bothrodiscus, Botrydiplis, Botryella, Botryochora, Botryoconis, Botryogene, Botryophoma, Botryorhiza, Botryosphaeria, Botryosphaerostroma, Botryosporium, Botryostroma, Botryotrichum, Botrysphaeris, Botrytidae, Botrytis, Bottaria, Boudiera, Boudierella, Bourdotia, Bovilla, Bovista, Bovistella, Bovistoides, Boydia, Brachyascus, Brachysporium, Brefeldiella, Bremia, Bremiella, Brencklea, Brenesiella, Bresadolella, Bresadolia, Bresadolina, Brevilegnia, Briardia, Briarea, Brigantiella, Briosia, Broomeia, Broomella, Brunchorstia, Bryophagus, Bryopogon, Bubakia, Buellia, Bulbothamnidium, Bulgaria, Bulgariaceae, Bulgariastrum, Bulgariella, Bulgariopsis, Bullaria, Bullera, Bulliardella, Burkardia, Burrillia, Butleria, Byssocallis, Byssochlamys, Byssocystis, Byssogene, Byssolecania, Byssoloma, Byssolomae, Byssolophis, Byssonectria, Byssotheciella, Cacosphaeria, Cadophora, Caenomyces, Caenothyrium, Caeoma, Calathiscus, Calcarisporium, Caldariomyces, Caldesia, Caldesiella, Calenia, Caleniae, Caliciaceae, Caliciopsis, Calicium, Calidion, Calliospora, Calloria, Calloriella, Calloriopsis, Calocera, Calocladia, Caloderma, Calogloeum, Calolepis, Calonectria, Calopactis, Calopeltis, Calopeziza, Calopeziza, Caloplaca, Calosphaeria, Calospora, Calosporella, Calostilbe, Calostilbella, Calostoma, Calothyriella, Calothyriolum, Calothyriopeltis, Calothyriopsis, Calothyris, Calothyriuni, Calotrichopsis, Calvatia, Calycella, Calycellina, Calycidium, Calyculosphaeria, Calyptospora, Calyptra, Calyptralegnia, Calyptronectri, Camarographium, Camarops, Camarosporellum, Camarosporium, Camarosporulum, Camarotella, Camillea, Cainpanella, Campbellia, Campoa, Campsotrichum, Camptomeris, Camptomyces, Camptosphaeria, Camptoum, Campylothelium, Candelaria, Candelariella, Candelospora, Candida, Cantharellus, Cantharomyces, Cantharosphaeria, Capillaria, Capnites, Capnodaria, Capnodiaceae, Capnodiastrum, Capnodiella, Capnodina, Capnodinula, Capnodiopsis, Capnodium, Capnophaeum, Capnostysanus, Capronia, Carestiella, Carlia, Carlosia, Carothecis, Carpenteles, Caryospora, Casaresia, Castagnella, Castoreum, Catabotrys, Catacauma, Catacaumella, Catastoma, Catathelasma, Catenaria, Catenularia, Catharinia, Catilla, Catillaria, Catinaria, Catinella, Catinula, Catocarpus, Caudella, Caudospora, Caudosporella, Cauloglossum Causalis, Celidium, Celtidea, Cenangella, Cenangina, Cenangiopsis, Ctfnangium, Cenococcum, Cephaliophora, Cephalodochium, Cephalomyces, Cephalosporiae, Cephalosporium, Cephalotelium, Cephalotheca, Cephalothecium, Cephalotrichum, Ccracea, Ceraeomyces, Cerastomis, Ceratocarpia, Ceratochaete, Ceratochaetopsis, Ceratocladium, Ceratomyces, Ceratomycetaceae, Ceratophoma, Ceratophorum, Ceratoporthe, Ceratopycnidium, Ceratopycnis, Ceratopycnium, Ceratosperma, Ceratosphaeria, Ceratosporella, Ceratosporium, Ceratostoma, Ceratostomella, Cercidospora, Cercoseptoria, Cercosphaerella, Cercospora, Cercosporella, Cercosporidium, Cercosporina, Cercosporiopsis, Cerebella, Cerillum, Ceriomyces, Cerion, Ceriophora, Ceriospora, Ceriosporella, Cerocorticium, Cerotelium, Cesatiella, Cetraria, Ceuthocarpum, Ceuthodiplospora, Ceuthosira, Ceuthospora, Ceuthosporella, Chaconia, Chaenoderma, Chaenotheca, Chaetalysis, Chaetasbolisia, Chaetaspis, Chaetasterina, Chaetobasidiella, Chaetobasis, Chaetobotrys, Chaetoccratostoma, Chaetoceris, Chaetocladiae, Chaetocladium, Chaetoconidium, Chaetoconis, Chaetocrea, Chaetocytostroma, Chaetodiplis, Chaetodiplodia, Chaetodiplodina, Chaetodiscula, Chaetolentomita, Chaetomastia, Chaetomella, Chaetomeris, Chaetomidium, -Chaetomium, Chaetomyces, Chaetopcltiopsis, Chaetopeltis, Chaetopeltopsis, Chaetophiophoma, Chaetophoma, Chaetophomella, Chaetoplaca, Chaetoplea, Chaetopsis, Chaetopyrena, Chaetopyrenis, Chaetosclerophonia, Chaetoscypha, Chaetosira, Chaetospermum, Chaetosphaeria, Chaetosphaeronema, Chaetosphaeropsis, Chaetosticta, Chaetostigme, Chaetostigmella, Chaetostroma, Chaetostroma, Chaetostromella, Chaetostylum, Chaetotheca, Chaetothyrina, Chaetothyriolum, Chaetothyriopsis, Chaetothyrium, Chaetotrichum, Chaetozythia, Chaetyllis, Chalara, Chalaropsis, Chalcosphaeria, Chamonixia, Chantransiopsis, Charcotia, Charonectria, Charrinia, Cheilaria, Cheilymenia, Chelisporium, Chevaliera, Chevalieropsis, Chiajea, Chiastospora, Chiloella, Chilomyces, Chilonectria, Chiodectae, Chiodectum, Chiroconium, Chiromycella, Chiromyces, Chiropodium, Chitonia, Chitoniella, Chitonomyces, Chitonospora, Chlamydaleurosporia, Chlamydomucor, Chlamydomyces, Chlamydopus, Chlamydosporium, Chloridium, Chlorocaulum, Chlorodothis, Chloropeltis, Chlorophyllum, Chlorospleniella, Chlorosplenium, Chlorospora, Chnoopsora, Choanophora, Choanophorae, Choeromyces, Chondrogaster, Chondropodiella, Chondropodium, Choriactis, Chorostate, Chorostella, Chroinocrea, Chromocreopsis, Chromocytospora, Chromosporium, Chromotorula, Chrysella, Chrysocelis, Chrysocyclus, Chrysomyces, Chrysomyxa, Chrysopsora, Chrysothrix, Chrysotrichaceae, Chytridiaceae, Chytridiae, Chytridiales, Chytridium, Ciboria, CicadomyceSi Cicinnobella, Cicinnobolus, Cidaris, Ciferria, Ciliaria, Ciliciocarpus, Ciliciopodiuin, Ciliciopus, Ciliella, Ciliochora, Ciliofusa, Ciiiofusarium, Ciliomyces, Ciliophora, Ciliospora, Ciliosporella. Cintractia, Cionothrix, Circinastruni, Circinella, Circinotrichum, Cirromyces, Cirsosia, Cirsosiella, Citromyccs, Cladobotryum, Cladochaete, Cladochytriae, Cladochytrium, Cladoderris, Cladographium, Cladonia, Cladoniaceae, Cladorhinum, Cladosphaeria, Cladosporium, Cladosterignia, Cladotrichum, Clarkeinda, Clasterosporium, Clathrella, Clathridium, Clathrococcum, Clathrogaster, Clathroporina, Clathrospora, Clathrotrichum, Clathrus, Claudopus, Claussenomyces, Claustula, Clavaria, Clavariaceae, Clavariopsis, Clavariopsis, Claviceps, Clavogaster, Clavularia, Clavulinopsis, Cleistophoma, Cleistosoma, Cleistosphaera, Cleistotheca, Cleistothecopsis, Clematomyces, Cleptomyces, Clidiomyces, Cliniconidium, Clinterium, Clintoniella, Cliostomum, Clistophoma, Clistosoma, Clistosphaera, Clistotheca, Clistothecopsis, Clithris, Clitocybe, Clitopilus, Clonostachyopsis, Clonostachys, Closteraleurosporia, Closterosporia, Clypeochorella, Clypeodiplodina, Clypeolella, Clypeolina, Clypeolina, riypeolopsis, Clypeolum, Clypeoporthc, Clypeoporthella, Clypeopycnis, Clypcoseptoria, Clypeosphaeria, Clypeostignia, Clypeostroma, Clypeothecium, Clypeotrabutia, Coccidiascus, Coccidiodes, Coccidomyces, Coccidophthora, Cocciscia, Coccobotrys, Coccocarpia, Coccochora, Coccochorella, Coccodiella, Coccodinium, Coccodiscus, Coccodothella, Coccodothis, Coccoidea, Coccoidella, Coccomycella, Coccomyces, Coccomycetella, Cocconia, Cocconiopsis, Coccopeziza, Coccophacidium, Coccospora, CoccosporeIla, Coccosporium, Coccostroma, Coccostromopsis, Coccotrema, Coelographium, Coelomyces, Coelomycidium, Coelosphaeria, Coemansia, Coemansiella, Coenogonium, Coleodictyospora, Coleodictys, Coleonaema, Coleophoma, Coleopuccinia, Coleosporium, Coleroa, Collacystis, Collema, Collemaceae, Collemis, CoUemodes, Collemopsidium, Colletomanginia, Colletotrichella, Colletotrichopsis, Colletotrichum Collodochium, Collonaema, Collonaemella, Collybia, Collyria, Colpoma, Coipomella, Columnophora, Columnothyrium, Colus, Combea, Comesia, Comoclathris, Complectoria, Compsomyces, Confervales, Conida, Conidiascus, Conidiobolus, Coniella, Coniocarpum, Coniochaeta, Coniocybe, Coniodictyum, Coniophora, Coniophorella, Conioscypha, Coniosporium, Coniothecium, Coniothyrella, Coniothjriella, Coniothyrina, Coniothyrimila, Coniothyriopsis, Coniothyriopsis, Coniothyris, Coniothyrium, Conoplea, Conostroma, Conotheciella, Conotrema, Constantinella, Cookeina, Cookella, Copelandia, Copranophilus, Coprinopsis, Coprinus, Coprolepa, Cora, Corallodendrum, Corallomyces, Coraliomycetella, Cordana, Cordelia, Cordierites, Corditubera, Cordyceps, Corella, Coremiella, Coremium, Coreomyces, Corethromyces, Corethropsis, Cornicularia, Corniculariella, Cornucopiella, Cornuella, Cornularia, Corollium, Corollospora, Coronella, Coronophora, Coronophorella, Coronotelium, Corticium, Cortinarius, Corymbomyces, Coryne, Corynelia, Coryneliaceae, Coryneliella, Corynespora, Corynetes, Coryneum, Coscinaria, Coscinopeltis, Cosmariospora, Coutinia, Couturea, Crandallia, Craterellus, Craterocolla, Creomelanops, Creonectria, Creosphaeria, Creothyrium, Crepidotus, Criella, Crinula, Crinula, Criserosphaeria, Cristulariella, Crocicreas, Crocynia, Cronartium, Crossopsora, Crotone, Crotonocarpia, Crucibulum, Crumenula, Cryphonectria, Cryptascus, Cryptica, Cryptobasidium, Cryptoceuthospora, Cryptocline, Cryptococcus, Cryptocoryneum, Cryptoderis, Cryptodiaporthe, Cryptodidymosphaeria, Cryptodiscus, Cryptoleptosphaeria, Cryptomela, Cryptomycella, Cryptomyces, Cryptomycina, Cryptonectriopsis, Cryptopeltis, Cryptopeltosphaeria, Cryptopezia, Cryptophaella, Cryptophallus, Cryptoporus, Cryptopus, Cryptorhynchella, Cryptorhynchella, Cryptosphaerella, Cryptosphaeria, Cryptosphaerina, Cryptospora, Cryptosporella, Cryptosporina, Cryptosporiopsis, Cryptosporium, Cryptostictella, Cryptostictis, Cryptothecium, Cryptothele, Cryptothelium, Cryptovalsa, Ctenoderma, Ctenomyces, Cubonia, Cucurbidotliis, Cucurbitaria, Cucurbitariella, Cudonia, Cudoniella, Cutininghaniella, Cunninghamia, Curreya, Curreyella, Cuticularia, Cutomyces, Cyanobaeis, Cyanocephalum, Cyanochyta, Cyanoderma, Cyanophomella, Cyanospora, Cyathicula, Cyathus, Cycloconium, Cycloderma, Cyclodomus, Cyclodothis, Cyclographa, Cyclomyces, Cycloschizella, Cycloschizum, Cyclostoniella, Cyclotheca, Cyclothyrium, Cylindrina, Cylindrium, Cylindrocarpum, Cylindrocephalum, Cylindrocladium, Cylindrocolla, Cylindrodendrum, Cylindrophora, Cylindrosporelia, Cylindrosporium, Cylindrothyrium, Cylindrotrichum, Cylomyces, Cyniatella, Cyphelium, Cyphella, Cyphellomyces, Cyphellopycnis, Cyphina, Cyphospilea, Cystingophora, Cystodendrum, Cystolobis, Cystomyces, Cystophora, Cystopsora, Cystopus, Cystospora, Cystotelium, Cystotheca, Cystothyrium, Cystotricha, Cytidia, Cytodiplospora, Cytogloeum, Cytonaema, Cytophoma, Cytoplacosphaeria, Cytoplea, Cytosphaera, Cytospora, Cytosporella, Cytosporina, Cytosporium, Cytostaganis, Cytostaganospora, Cytotriplospora, Cyttaria, Cyttariaceae, Dacrymycella, Dacryobolus, Dacryodochium, Dacryomitra, Dacryomyces, Dacryomycetaceae, Dacryopsella, Dacryopsis, Dactylaria, Dactylella, Dactylina, Dactylium, Dactylomyces, Dactylosporium, Daedalea, Daldinia, Daleomyces, Dangeardia, Dangeardiella, Darbishirella, Darluca, Darlucis, Darwiniella, Dasybolus, Dasypezis, Dasyphthora, Dasypyrena, Dasyscypha, Dasyscyphae, Dasyscyphella, Dasysphaeria, Dasyspora, Dasysticta, Dasystictella, Davincia, Davinciella, Davisiella, Dearnessia, Debaryella, Debaryoniyces, Deconica, Delacourea, Delastria, Delastriopsis, Delitschia, Delitschiella, Delortia, Delphinella, Delpinoella, Delpontia, Dematiaceae, - Dematium, Dendrocladium, Dendrocyphella, Dendrodochium, Dendrodomus, Dendroecia, Dendrogaster, Dendrographa, Dendrographium, Dendrophoma, Dendrosphaera, Dendrostilbella, Dendrothele, Dendryphiella, Dendryphium, Dermatea, Dermateaceae, Dermatella, Dermatina, Dermatiscum, Dermatocarpae, Dermatocarpum, Dermatodothis, Dermophyta, Desmazierella, Desmella, Desmidiospora, Desmopatella, Desmotascus, Detonia, Deuteromycetes, Dexteria, Diabole, Diachora, Diachorella, Dialhypocrea, Dialonectria, Diaphanium, Diaporthe, Diaporthella, Diaporthopsis, Diarthonis, Diathryptum, Diatractium, Diatrype, Diatrypella, :Dibaeis, Dibelonis, Diblastospermella, Diblepharis. Dicaeoma, Dicarpella, Dichaena, Dichaenopsis, Dichaetis, Dichirinia, Dichlaena, Dichlamys, Dichomera, Dichomyces, Dichoporis, Dichosporium, Dichostereum, Dichothrix, Dichotomella, Dichotonium, Dicoccum, Dicollema, Dicranidium, Dicranophora, Dictyobole, Dictyocephalus, Dictyochaeta, Dictyochora, Dictyochorella, Dictyodothis, Dictyographa, Dictyolus, DictyomoUis, Dictyonella, Dictyonema, Dictyonia, Dictyopeltineae, Dictyopeltis, Dictyophora, Dictyorinis, Dictyosporium, Dictyothyriella, Dictyothyrina, Dictyothyrium, Dictyuchus, Dicyma, Didothis, Didymaria, Didymariopsis, Didymascella, Didymascella, Didymascina, Didymascus, Didymella, Didymellina, Didymellopsis, Didymobotryopsis, Didymobotrys, Didymobotryum, Didymochaete, Didymochlamys, Didymochora, Didymocladium, Didymocoryne, Didymopsamma, Didymopsis, Didymopsora, Didymosphaeria, Didymosporiella, Didymosporina, Didymosporis, Didymosporium, Didymostilbe, Didymothozetia, Didymotricha, Didymotrichum, Diedickea, Diedickella, Dielsiella, Dietelia, Digraphis, Dilophia, Dilophospora, Dimargaris, Dimeriella, Dimeriellopsis, Dimerina, Dimerinopsis, Dimeriopsis, Dimerisma, Dimerium, Dimeromyces, Dimerosporiella, Dimerosporina, Dimerosporiopsis, Dimerosporium, Dimorphomyces, Dinemasporiella, Dinemasporiopsis, Dinemasporis, Dinemasporium, oecomyces, oranotropis, orchidium, phaeis, phaeostica, phanis, phanosticta, phloeis, plocarpa, plocarpum, ploceras, plochora, plochorella, plocladium, plococcium, plocryptis, plocystis, plodascus, ploderma, plodia, plodiella, plodina, plodinis, plodiopsis, plodothiorella, plogramma, ploidium, plomyces, plonaevia, ploospora, plopeltis, plopeltis, plopeltopsis, plophlyctis, plophysa, ploplacis, ploplacosphaeria, ploplenodomopsis, ploplenodomus, plorhinotrichum, ploschistes, plosclerophoma, plosphaerella, plosporis, plosporium, plostephanus, plotheca, plotomma, plozythia, plozythiella, porina, pyrenis, rina, rinae, rinaria, rinastrum, saeta, scella, scellaceae, scellae, scina, sciseda, scocera, scochora, scocolla, scocyphella, scodiaporthe, scodothis, scofusarium, scogloeum, scomycella, scomycopsella, scomycopsis, scosia, scosiella, scosphaerina, scosporella, scosporiella, scosporiopsis, scosporium, scostroma, scostromella, scotheciella, scothecium, Discozythia, Discula, Disculina, Disperma, Dispira, Dissophora, Distichomyces, Dithelopsis, Dithozetia, Ditiola, Ditopella, Ditremis, Ditylis, Doassansia, Doassansiopsis, Doratomyces, Dothichiza, Dothichloe, Dothiclypeolum, Dothidasteris, Dothidasteroma, Dothidasteromella, Dothidea, Dothideaceae, Dothideae, Dothideales, Dothidella, Dothideodiplodia, Dothideopsella, Dothideovalsa, Dothidina, Dothidotthia, Dothiopsis, Dothiora, Dothiorae, Dothiorellina, Dothiorina, Dothisphaeropsis, Dothithyriella, Dothophaeis, Drepanoconis, Drepanopeziza, Drepanospora, Dubiomyces, Ductifera, Dufourea, Duplicaria, Duportella, Durandia, Durandiomyces, Durella, Dussiella, Dyslachnum, Dyslecanis, Dysrhynchis, Dysticta, Dystictina, Earlea, Ecchyna, Eccilia, Echidnodella, Echidnodes, Echinobotryum, Echinodontium, Echinodothis, Echinophallus, Echinothecium, Echusias, Ectinomyces, Ectosphaeria, Ectosticta, Ectostroma, Ectotrichophytum, Ectrogella, Eichleriella, Eidamella, Elachopeltis, Elaeodema, Elaphomyces, Elaphomycetaceae, Elasmomyces, Elateromyces, Eleutheris, Eleutheromycella, Eleutheromyces, Eleutherosphaera, Ellisiella, Ellisiodothis, Elmeria, Elmerina, Elmerococcum, Elsinoae, Elsinoe, Emericella, Empusa, Empusaceae, Enantiothamnus, Enarthromyces, Encephalographa, Enchnoa, Enchnosphaeria, Encoelia, Encoeliella, Endobasidium, Endoblastoderma, Endobotrya, Endobotryella, Endocalyx, Endocarpum, Endocena, Endocladis, Endococcus, Endoconidiophora, Endoconidium, Endocoryneum, Endocycia, Endodermophytum, Endodesmia, Endodothella, Endodothiora, Endogloea, Endogonaceae, Endogone, Endogonella, Endomyces, Endomycetaceae, Endophragmia, Endophyllachora, Endophylloides, Endophyllum, Endoscypha, Endospora, Endostigme, Endothia, Endothiella, Endoxyla, Endoxylina, Endyllium, Englerodothis, Engleromyces, Englerula, Englerulaceae, Englerulaster, Enterodictyum, Enterostigma, Enthallopycnidium, Entodesmium, Entoleuca, Entoloma, Entomopatella, Entomophthora, Entomosporium, Entonaema, Entopeltis, Entophlyctis, Entorhiza, Entosordaria, Entyloma, Eocronartium, Eolichen, Eomycenella, Eosphaeria, Eoterfezia, Ephebae, Ephebe, Ephebeia, Ephelidium, Ephelina, Epheliopsis, Epheliopsis, Ephelis, Epibotrys, Epichloe, Epiclinium, Epicoccum, Epicorticium, Epicymatia, Epicyta, Epidermidophyton, Epidermophytum, Epidochiopsis, Epidochium, Epigloea, Epilichen, Epinectria, Epipeltis, Epiphora, Epiphyma, Epipolaeum, Episoma, Episphaerella, Epistigme, Epithele, Epochnium, Eremascus, Eremotheca, Eremothecella, Eremothecium, Erikssonia, Erinella, Erioderma, Eriomene, Eriomenella, Eriomycopsis, Eriopeziza, Eriosphaeria, Eriospora, Eriosporangium, Eriosporella, Eriosporina, Eriothyrium, Erostella, Erostrotheca, Erysiphaceae, Erysiphe, Erysiphella, Erysiphopsis, Erysiphopsis, Erythrocarpum, Euacanthe, Euantennaria, Eubelonis, Eucantharomyces, Euchaetomella, Eucorethromyces, Eucyphelis, Eudarluca, Eudimeriolum, Euhaplomyces, Eumela, EumoUisiae, Eumonoecomyces, Eupelte, Eupropolella, Eupropolis, Eurotiaceae, Eurotiella, Eurotiopsis, Eurotium, Euryachora, Eurychasma, Eurytheca, Eustictidae, Euthryptum, Eutorula, Eutorulopsis, Eutypa, Eutypella, Eutypopsis, Euzodiomyces, Everhartia, Evernia, Everniopsis, Exarmidium, Exascaceae, Exascus, Excioconis, Excipula, Excipulaceae, Excipularia, Excipulella, Excipulina, Exidia, Exidiopsis, Exilospora, Exobasidiopsis, Exobasidium, Exogone, Exophoma, Exosporella, Exosporina, Exosporina, Exosporium, Exotrichum, Fabraea, Fairmania, Fairmaniella, Falcispora, Farlowiella, Farriola, Farysia, Favillea, Favolus, Fernsjonia, Fenestella, Feracia, Ferrarisia, Filoboletus, Fimetaria, Fioriella, Fischerula, Fistulina, Fistulinella, Flageoletia, Flaminia, Flammula, Fleischeria, Fleischhakia, Floccomutinus, Fomes, Fominia, Forssellia, Fouragea, Fracchiaea, Fragosoa, Fragosoella, Fragosphaeria, Friesula, Frommea, Fuckelia. Fuckelina, Fulininaria, Fumago, Fumagopsis, Fumagospora, Fusariella, Fusarium, Fusella. Fusicladiella, Fusicladium, Fusicoccum, Fusicolla, Fusidium, Fusisporella, I Fusoma, Gaillardiella, Galactinia, Galera, Gallowaya, Galziiiia, Gambleola, Gamonaemella, Gamospora, Gamosporella, Ganoderma, Gastroboletus, Gautieria, Geaster, Geasteroides, Geasteropsis, Geisleria, Gelatinosporis, Gelatinosporium, Geminispora, Genabea, Genea, Geoglossae, Geoglossum, Geolegnia, Geopora, Geopyxis, Geotrichum, Gerwasia, Gibbera, Gibberella, Gibberidea, Gibellia, Gibellina, Gibellula, Gibsonia, Gilletia, Gilletiella, Gillotia, Giulia, Glaziella, Glenospora, Gliobotrys, Gliocephalis, Gliocladium, Gliocladochium, Gliomastix, Glischroderma, Globaria, Globulina, Gloeocalyx, Gloeocephala, Gloeocystidium, Gloeodes, Gloeoglossum, Gloeopeniophora, Gloeopeziza, Gloeoporus, Gloeosoma, Gloeosphaera, Gloeosporidiella, Gloeosporidina, Gloeosporidium, Gloeosporiella, Gloeosporina, Gloeosporiopsis, Gloeosporium, Gloeothele, Glomerella, Glomerula, Glomerularia, Glomus, Gloniella, Gloniopsis, Glonium, Glossodium, Glutinium, Glycophila, Glyphis, Glypholecia, Gnomonia, Gnomoniella, Gnomonina, Gnomoniopsis, Godfrinia, Godronia, Godroniella, Godroniopsis, Gomphidius, Gomphillus, Gonapodya, Gonatobotrys, Gonatobotrytae, Gonatobotryum, Gonatorhodis, Gonatorhodum, Gongromeriza, Gongylia, Gonisporium, Gonisporiuni, Gonohymenia, Gonolecania, Gonothecis, Gonothecium, Gonyella, Gonytrichum, Goplana, Gorgoniceps, Grallomyces. Grammothele, Grandinia, Grandiniella, Granularia, Graphidaceae, Graphidae, Graphidium, Graphina, Graphinella, Graphiola, Graphiolaceae, Graphiopsis, Graphiothecium, Graphis, Graphium, Graphyllium, Griggsia, Griphosphaerella, Griphosphaeria, Griphosphaerioma, Groveola, Grubyella, Gueguenia, Guelichia, Guepinia, Guignardia, Guignardiella, Guillermondia, Giiillermondia, Guttularia, Guttularia, Gyalecta, Gyalectae, Gymnascaceae, Gymnascales, Gymnascus, Gymnoconia, Gymnoderma, Gymnodochium, Gymnoglossum, GymnograpHa_Gyninomyces, Gymnopeltis, Gymnosporangium, Gymnotelium, Gyrocephalus, Gyroceras, GyrocoUema, Gyrocratera, Gyrodon, Gyromitra, Gyrophora, Gyrophorae, Gyrophragmium, Gyrostomum, Gyrostroma, H Habrostictis, Hadotia, Hadronema, Hadrotrichum, Haematomma, Haematomyces, Haematomyxa, Hainesia, Halbania, Halbaniella, Halbanina, Halobyssus, Halonia, Halstedia, Hamaspora, Hamasporella, Hansenia, Hanseniospora, Hansenula, Hapalocystis, Hapalophragmium, Hapalosphaeria, Haplaria, Haplariella, Haplariopsis, Haplariopsis, Haplobasidium, Haplodothella, Haplodothis, Haplographium, Haplolepis, Haplomela, Haplomyces, Haplopeltineae, Haplopeltis, Haplophyse, Haplopyrenula, Haplopyxis, Haploravenelia, Haplosporangium, Haplosporella, Haplosporidium, Haplosporium, Haplostroma, Haplotheciella, Haplothecium, Haplothelium, Haplotrichum, Haplovalsaria, Haraea, Hariotia, Hariotula, Harknessia, Harknessiella, Harpagomyces, Harpidium, Harpocephalum, Harpochytrium, Harpographium, Harposporella, Hartiella, Hartigiella, Harziella, Hassea, Hebeloma, Helicia, Helicobasidium, Helicobasis, Helicocephalum, Helicodendrum, Helicodesmus, Helicogloea, Helicoma, Helicomyces, Helicopsis, Helicosporangium, Helicosporium, Helicostilbe, Helicostylum, Helicotrichum, Helicoum, Heliomyces, Heliscus, Helminthocarpum, Helminthophana, Helminthosphaeria, Helminthosporium, Helolachnum, Helostroma, Helotiaceae, Helotiae, Helotiopsis, Helotium, Helvella, Helvellaceae, Helvellae, Hemidothis, Hemigaster, Hemiglossum, Hemileia, Hemileiopsis, Hemisphaeriaceae, Hemispora, Hendersonia, Hendersoniella, Hendersonina, Hendersoninula, Hendersoniopsis, Hendersonula, Henningsia, Henningsiella, Henningsina, Henningsomyces, Henriquesia, Heppia, Heppiae, Heptameria, Heptasporium, Hercospora, Hericium, Hermatomyces, Herpobasidium, Herpocladiella, Herpocladium, Herpomyces, Herpothrix, Herpotrichia, Herpotrichiella, Herpotrichiopsis, Heterobasidium, Heterobotrys, Heterobotrys, Heterocarpum, Heterocephalum, Heteroceras, Heterochaete, Heterochaetella, Heterochlamys, Heterodea, Heterodothis, Heteromyces, Heteronectria, Heteropatella, Heteropera, Heterophracta, Heteroplegma, Heterosphaeria, Heterosporium, Hetcrotcxtus, Hexagonella, Hexagonia, Heydenia, Heydeniopsis, Hiatula, Himantia, Hippoperdum, Hirneola, Hirneolina, Hirsutella, Hirundinaria, Histoplasma, Hobsonia, Hoehneliella, Hoehnelogaster, Hoehnelomyces, Holcomyces, Holocoenis, Holocyphis, Holothelis, Holstiella, Holwaya, Holwayella, Homopsella, Homostegia, Hormiactella, Hormiactina, Hormiactis, Honiiisciopsis, Hormiscium, Horniococcus, Hormodendrum, Hormomyces, Hormonema, Hormopeltis, Hormosperma, Hormothecium, Hormylium, Hueella, Humaria, Humariella, Humarina, Husseya, Hyalasterina, Hyalinia, Hyaloceras, Hyalocrea, Hyalocurreya, Hyalodema, Hyaloderma, Hyalodermella, Hyalodictyum, Hyalodothis, Hyalomeliolina, Hyalopeziza, Hyalopsora, Hyalopus, Hyaloria, Hyaloscypha, Hyalosphaera, Hyalotexis, Hyalotheles. Hyalothyris, Hydnaceae, Hydnangium, Hydnobolites, Zll Hydnochaete, Hydnochaete, Hydnocystis, Hydnodon, Hydnofomes, Hydnotrya, Hydnotryopsis, m Hydnum, Hydraeomyces, Hydrogera, Hydroncctria, Hydrophilomyces, Hydrophora, Hydrothyria, Hygrophorus, Hymenella, Hymenobactrum. Hynienoboliis, Hymenochaete, Hymenogaster, li Hymenogastraceae, Hymenogramme, Hymenopsis, Hymenoscypha, Hymenula, Hyperomyxa, Hyperphyscia, Hyperus, Hypha, Hyphaster, Hyphochytriinii, Hyphoderma, Hyphodiscus, Hypholoma, Hyphoscypha, Hyphosoma, Hyphostereum, Hypocapnodium, Hypocelis, Hypocenia, Hypochnaceae, Hypochnus, Hypocopra, Hypocrea, Hypocreaceae, Hypocrella, Hypocreodendrum, Hypocreophis, Hypocreopsis, Hypoderma, Hypodermella, Hypodermellina, Hypodermina, Hypodermina, Hypodermium, Hypodermopsis, Hypogloeum, Hypolyssus, Hypomyces, Hypomycopsis. Hyponectria, Hypoplegma, Hypoplegma, Hypospila, Hypospilina, Hypostegium, Hypostigine, Hypoxylina, Hypoxylopsis, Hypoxylum, Hysterangium, Hysteriaceae, Hysteridiuiii, Hysterium, Hysteroglonium, Hysterographium, Hysteromyxa, Hystcropatella, Hysteropeltella, Hysteropeziza, Hysteropezizella, Hysteropsis, Hysteropsis, Hysterostegiella, Hysterostoma, Hysterostomella, Hysterostomina, Icmadophila, Idiomyces, Ijuhya, Ileodictyum, Illosporium, Indiella, Ingaderia, Inocybe, Inocyclus, Inzengaea, lotidea, Irene, Irenina, Irenopsis, Iridionia, Irpex, Isaria, Isariella, Isariopsis, Ischnostroma, Isipinga, Isoachlya, Isomunkia, Isomyces, Isothea, Isthmospora, Itajahya, Ithyphallus, Jaapia, Jackya, Jaczewskia, Jaczewskiella, Jaffuela, Jahniella, Jainesia, Janospora, Janseella, Jansia, Japonia, Jaraia, Jattaea, Jenmania, Johansonia, Jola, Jonaspis, Julella, K Kabatia, Kabatiella, Kalchbrennera, Kalmusia, Karschia, Karstenia, Karstenula, Kawakamia, Keissleria, Keissleriella, Keisslerina, Keithia, Kellermannia, Kerminicola, Khekia, Kickxella, Kirschsteinia, Kirschsteiniella, Klastospora, Klebahnia, Kleidiomyces, Kmetia, Kneiffia, Koerberia, Konenia, Konradia, Koordersiella, Kordyana, Kordyanella, Kretschmaria, Kriegeria, Kriegeriella, Kuehneola, KuUhemia, Kunkelia, Kuntzeomyces, Kupsura, Kusanoa, Kusanobotrys, Kusanoopsis, Laaseoniyces, Laboulbenia, Laboulbeniaceae, Laboulbeniales, Labrella, Labridium, - accocephalum. Lacellina, Lachnaster, Lachnea, Lachnella, Lachnellula, Lachnocaulum, Lachnocladium, Lachnodochium, Lachnum, Lactaria, Lactariopsis, Lactarius, Laestadia, Laestadiella, Lagena, Lagenidiopsis, Lagenidium, Lageniformia, Lagerheimia, Lagynodella, Lahmia, Lambertella, Lambottiella, Lambro, Lamia, Lamprospora, Lamyella, Langloisula, Lanomyces, Lanopila, Lanzia, Laquearia, Laschia, Lasiella, Lasiobelonis, Lasiobelonium, Lasiobolus, Lasiobotrys, Lasiodiplodia, Lasionectria, Lasiophoma, Lasiosordaria, Lasiosphaera, Lasiosphaeria, Lasiosphaeris, Lasiostemma, Lasiostictis, Lasiostroma, Lasiothyrium, Lasmenia, Lasmeniella, Latrostium, Latzelia, Laurera, Lauterbachiella, Leandria, Lecanactidae, Lecanactis, Lecania, Lecaniascus, Lecanidion, Lecaniopsis, Lecanora, Lecanorae, Lecanosticta, Lecidea, Lecideaceae, Lecideae, Lecideopsella, Lecideopsis, Lecidopyrenopsis, Lecioglyphis, Leciographa, Leciophysma, Lecithium, Lecopyrenopsis, Leeina, Leiosepium, Leiosphaerella, Lelujn, Lemalis, Lembosia, Lembosiella, Lembosina, Lembosiodothis, Lembosiopsis, Lemmopsis, Lemonniera, Lempholemma, Lentinus, Lentodiopsis, Lentodium, Lentomita, Lentomitella, Lenzites, Leotia, Leotiella, Lepidella, Lepidocollema, Lepidogium, Lepidoleptogium, Lepiota, Lepolichen, Lepraria, Leprieurina, LeprocoUema, Leptascospora, Lepteutypa, Leptinia, Leptobelonium, Leptochlamys, Leptocoryneum, Leptocrca, Leptodermella, Leptodothiora, Leptodothis, Leptogidium, Leptogiopsis, Leptogium, Leptoglossum, Leptographium, Leptolegnia, Leptomassaria, Leptomelanconium, Leptomeliola, Leptomitae, Leptomitus, Leptonia, Leptopeltella, Leptopeltina, Leptopeltis, Leptopeziza, Leptophacidium, Leptophoma, Leptophyma, Leptopuccinia, Leptorhaphis, Leptosacca, Leptosillia, Leptosphaerella, Leptosphaeria, Leptosphaeropsis, Leptosphaerulina, Leptospora, Leptosporella, Leptosporium, Leptosporopsis, Leptostroma, Leptostromaceae, Leptostromella, Leptothyrella, Leptothyrina, Leptothyrium, Leptotrema, Leptotrichum, Leptoxyphium, Letendraea, Letharia, Lethariopsis, Leucangium, Lcucobolites, Leucoconis, Leucoconius, Leucocrea, Leucocytospora, Leucodochium, Leucogaster, Leucopaxillus, Leucopezis, Leucophleps, Leucophomopsis, Leucostoma, Leucothyridium, Leveillella, Leveillina, Leveillinopsis, Leveillula, Levieuxia, Libertella, Libertiella, Libertina, Lichenoconium, Lichenopeltella, Lichenophoma, Lichenosticta, Lichenyllium, Lichina, Lichinae, Lichinella, Lichinodium, Lichtheimia, Licopolia, Ligniella, Ligniera, Lilliputia, Limacinia, Limacinia, Limaciniella, Limaciniopsis, Limnaeomyces, Lindauella, Lindauomyccs, Lindauopsis, T, indrothia, Linearistroma, Linhartia, Linkiclla, T. inoboliis, Linocarpum, Linochora, Linochorella, Linodochium, Linospora, IIT Linostoma, Linostomella, Linostroma, Linotexis, Lipospora, Lisea, Lisiella, Listeromyces, Lithoecea, Lithographa, Lithothelium, Litschaueria, Lituaria, Lizonia, Lizoniella, Lloydiella, Lobaria, Lobarina, Locellina, Loculistroma, Lo jkania, Lonchospermella, Longia, ZZl Longoa, Lopadiopsis, Lopadium, Lopadostoma, Lopharia, Lophidiopsis, Lopliidium, Lophiella, Lophionema, Lophiosphaera, Lophiostoma, Lophiostomaceae, Lophiotrema, Lophiotricha, Lophium, Lophodermella, I. ophodermellina, T, ophoderniina, Lophodermium, Lophodermopsis, ill Lophophytum, Loramyces, Loranthomyces, Ludwigiella, Lulworthia, Lycogalopsis, Lycoperdaceae, Lycoperdales, Lycoperdellon, Lycoperdopsis, Lycoperdum, Lyonella, Lysospora, Lysurus, M Macalpinia, Macbridella, Macowaniella, Macowanites, Macrobasis, Macrochytrium, Macroderma, Macrodiaporthe, Macrodiplis, Macrodiplodia, Macrodiplodiopsis, Macrophoma, Macrophomella, Macrophomina, Macrophomopsis, Macroplodiella, Macropodia, Macroseptoria, Macrospora, Macrosporium, Macrostilbum, Madurella, Magnusia, Magnusiella, Magnusiomyces, Maireella, Malacodermis, Malacosphaeria, Malassezia, Malbranchea, Malmeomyces, Mamiana, Mamianella, Manginia, Manginula, Manilaea, Mapea, Marasniiopsis, Marasmius, Maravalia, Marchalia, Marchaliella, Marcosia, Maronea, Marsonia, Marsoniella, Marsonina, Martellia, Martensella, Martindalia, Martinella, Massalongia, Massalongiella, Massalongina, Massaria, Massariella, Massariellops, Massarina, Massarinula, Massariopsis, Massariovalsa, Masseea, Masseella, Massospora, Mastigocladium, Mastigonema, Mastigonetrum, Mastigosporella, Mastigosporium, Mastodia, Mastomyces, Matruchotia, Mattirolia, Matula, Maublancia, Mauginiella, Maurodothella, Maurodothis, Maurya, Maxillospora, Mazos-a, Mazzantia, Alazzantiella, Medeolaria, Medusomyces, Medusulina, Megalonectria, Megalopsora, Megaloseptoria, Megalospora, Melachroia, Melampsora, Melampsoraceae, Melampsorella, Melampsoridium, Melampsoropsis, Melampydium, Melanconiaceae, Melanconiales, Melanconiella, Melanconiopsis, Melanconis, Melanconium, Melanidium, Melanobasidium, Melanobasis, Melanobotrys, Melanochlamys, Melanodiscus, Melanogaster, Melanographium, Melanomma, Melanomyces, Melanoplaca, Melanops, Melanopsamma, Melanopsammella, Melanopsammina, Melanopsammopsis, Melanopsichium, Melanosphaeria, Melanospora, Alelanosporopsis, Melanostroma, Melanotaenium, Melanotheca, Melasmia, Melaspilea, Melastiza, Melchiora, Meliola, Meliolaster, Meliolidium, Meliolina, Meliolinopsis, Melioliphila, Meliolopsis, Melittosporiella, Melittosporiopsis, Melittosporis, Melittosporium, Melogramma, li\Melomastia, Melophia, Memnoniella, Mendogia, Menezesia, Menispora, Menoidea, Merarthonis, Meria, Meringosphaeria, Merismatium, Merismella, Merodontis, Merophora, Meroplacis, Merorinis, Merostictina, Merostictis, Merrilliopeltis, Merulius, Mesniera, Mesobotrys, Mesonella, Mesophellia, Mesopsora, Metabotryum, Metacapnodium, Metachora, Metacoleroa, Metadothella, Metameris, Metanectria, Metasphaeria, Metathyriella, Methysterostomella, Metraria, Michenera, Micranthomyces, Micrascus, Microbasidium, Microcallis, Microcera, Microclava, Microcyclella, Microcyclus, Microdiplodia, Microdiscula, Microdiscus, Microdochium, Microdothella, Microglaena, Microgloeum, Microglossum, Micrographa, Micromastia, Micromyces, Micromycopsis, Micromyriangium, Micronectria, Micronectriella, Micronectriopsis, Micronegeria, Micropeltaceae, Micropeltella, Micropeltis, Micropeltopsis, Micropera, Microperella, Microphiale, Microphiodothis, Micropodia, Micropsalliota, Micropuccinia, Micropyrenula, Microscypha, Microspatha, Microsphaera, Microsphaeropsis, Microsporella, Microsporum, Microstelium, Microsticta, Microstroma, Microthecium, Microthelia, Microtheliopsis, Microthyriaceae, Microthyriales, Microthyrieae, Microthyriella, Microthyriolum, Microthyris, Microthyrites, Microthyrium, Microtyle, Microtypha, Microxyphium, Microxyphiella, Micula, Midotiopsis, Midotis, Milesia, Milesina, Milowia. Mindemella, Minksia, Mitochytridium, Mitochytrium, Mitopeitis, Mitosporium, Mitromyces, Mitrula, Mitruliopsis, Miyabella, Miyagia, Miyakeaniyces, Miyoshia, Miyoshiella, Moelleriella, Moelleroclavus, Moellerodiscus, Moeszia, Moesziella, Mohortia, Molleriella, Molliardia, Mollisia, MoUisiaceae, Mollisiella, MoUisiopsis, Monacrosporium, Monascaceae, Monascostroma, Monascus, Monilia, Moniliaceae, Moniliales, Moniliopsis, Monilochaetes, Monoblastia, Monoblepharidaceae, Monoblephariopsis, Monoblepharis, Monochaetia, Monoecomyces, Monogrammia, Monographella, Monographus, Monopodium, Monopus, Monopycnis, Monorhiza, Monorhizina, Monospora, Monosporella, Monosporidium, Monosporiella, Monosporium, Monostichella, Monotospora, Monotrichum, Montagnellina, Montagnina, Montagnites, Montagnula, Montemartinia, Montoyella, Morchella, Morenella, Morenina, Morinia, Moriola, Moriolae, Mortierella, Mortierellae, Moschomyces, Moutoniella, Muchmoria, Muciporus, Mucor, Mucoraceae, Mucorae, Mucronella, Mucronoporus, Mucrosporium, Muellerella, Muiaria, Muiogone, Multipatina, Munkia, Munkiella, Munkiodothis, Murashkinskija, Mutinus, Mycaureola, Myceliophthora, Myceloderma, Mycelophagus, Mycena, Mycenastrum, Mycobacidia, Mycobacillaria, Mycobilimbia, Mycoblastus, Mycocalicium, Mycocitrus, Mycocladus, Mycodendrum, Mycoderma, Mycogala, Mycogone, Mycolangloisia, Mycolecidea, Mycolecis, Mycomalus, Mycophaga, Mycopharus, Mycoporaceae, Mycoporellum, Mycoporis, Mycoporum, Mycopyrcmila, Mycorhynchella, Mycorhynchus, Hi Mycosphaerella, MycosphaercUopsis, Mycosticta, Mycosyrinx, j\Iycotorula, Mycovellosiella, Myelosperma, Myiocoprella, Myiocoprum, Mylittopsis, Myriadoporus, Myriangella, Myriangiaceae, Myriangiae, Myriangina, Myrianginella, Myriangiopsis, Myriangium, Myridium, Myriellina, Myrillium, Myrioblepharis, Myriococcum, Myrioconium, Myrioconiuni, Myriogenis, Myriogenospora, Myriolecis, Myriophysa, Myriophysella, Myriopyxis, Alyriostigina, Myrmaeciella, Myrmaecium, Myrmecocystis, Myrotheciella, Myrothecium, Mystrosporium, Mytilidium, Myxasterina, Myxocyclus, Myxodictyum, Myxodiscus, Myxofusicoccum, Myxolibertella, Alyxomycidium, Myxomyriangis, Myxomyriangium, Myxonema, Myxophacidiella, Myxophacidiuni, Myxormia, Myxosporella, Myxosporina, Myxosporium, Myxotheca, Myxothecium, Myxothyrium, Myxotrichella, Myxotrichum, Myzocytium, Nadsonia, Naegelia, Naeg-eliella, Naemacyclus, Naematelia, Naemosphaera, Nacmosphaerella, Naemospora, Naetrocymbe, Naevia, Naeviella, Napicladium, Napomyces, Naucoria, Naumovia, Necator, Necium, Nectaromyccs, Nectria, Nectriella, Nectriella, Nectrioidaceae, Nectriopsis, Negeriella Nemastroma, Nematogonium, Nematospora, Nematosporangium, Nematostigma, Neinatostoma, Nematothecium, Nemozythiella, Neoarcangelia, Neobarclaya, Neobulgaria, Neocosmospora, Neofabraea, Neohendersonia, Neohenningsia, Neoheppia, Neohoehnelia, Neokeissleria, Neolamya, Neolecta, Neoniichclia, Neoncctria, Neopatella, Neopeckia, Neophoma, Neoplacosphaeria, Neoravenelia, Neorehmia, Neosaccardia, Neoskofitzia, Neosphaeropsis, Neostomella, Neotrichophytum, Neotrotteria, Neottiella, Neottiopezis, Neottiospora, Neottiosporella, Neottiosporis, Neovcnturia, Neovossia, Neozimmermannia, Nephlyctis, Nephroma, Nephromium, Nephromopsis, Nephrospora, Ncpotatiis, Nesolechia, Nidula, Nidularia, Nidulariaceae, Nielsenia, Niesslella, Niesslia, Nigropogon, Nigrosphaeria, Nigrospora,, Niorma, Niptera, Nitschkea. Nodulisphaeria, Nolanea, Nomuraea, Normandina, Norrlinia, Nostotheca, Notarisiella, Nothodiscus, Nothoravenelia, Nothospora, Nothostroma, Nowakowskia, Nowakowskiella, Nowellia, Nozcniia, Nummularia, Nyctalis, Nylanderiella, Nynianomyces, Nyssopsora, Nyssopsorella, Obelidium, Ocellaria, Ocellularia, Ochrolechia, Ochropsora, Octaviana, Odontia, Odontoschi/uin, Odontotrema, Odontotrcinella, Odontura, Oedemium, Oedocephalum, Oedomyces, Ohleria, Ohleriella, Oidiopsis, Oidium, Oleina, Oleinis, Oligostroina, Olivea, Ollula, Olpidiaceae, Olpidiae, Olpidiaster, Olpdiopsis, Olpidium, Olpitrichum, Ombrophila, Omphalia, Omphalospora, Oncopodium, Oncospora, Ontotelium, Onygena, Onygenaceae, Oomyces, Oospora, Oosporidca, Oothecium, Oothecium, Opeasterina, Opeasterinella, Opegrapha, Opethyrium, Ophiobolus, Ophiocapnis, Ophiocapnodium, Ophiocarpella, Ophioceras, Ophiochaeta, Ophiocladium, Ophiodictyum, Ophiodothella, Ophiodothis, Ophiogloea, Ophiognomonia, Ophiomassaria, Ophiomeliola, Ophionectria, Ophiopeltis, Ophiosphaerella, Ophiosphaeria, Ophiostoma, Ophiostomella, Ophiotexis, Ophiotrichum, Oplothecium, Oraniella, Orbicula, Orbilia, Orbiliopsis, Orcadia, Ordonia, Orinathoidium, Orphniospora, Oropogon, Orthoscypha, Oscarbrefeldia, Ostenfeldiella, Ostreionella, Ostreium, Ostropa, Ostropae, Oswaldia, Oswaldina, Otidea, Otidella, Otthia, Otthiella, Oudemansiella, Ovularia, Oxydothis, Ozonium, Pachybasidiella, Pachybasium, Pachydiscula, Pachypatella, Pachyphiale, Pachyphloeus, Pachyrhytisma, Pachyspora, Pachytrichum, Pactilia, Paecilomyces, Paepalopsis, Paidania, Palawania, Palawaniella, Pampolysporium, Panaeolus, Pannaria, Pannariae, Panus, Papularia, Papulospora, Parabotryum, Paracapnodium, Paracesatiella, Paracudonia, Paracytospora, Paradidymella, Paradiplodia, Paralaestadia, Paramazzantia, Paranectria, Paranthostomella, Parapeltella, Parasclerophoma, Parasitella, Parasphaeria, Paraspora, Parasterina, Parastigmatea, Parathalle, Paratheliae, Parathelium, Parendomyces, Parenglerula, Parmelia, Parmeliaceae, Parmeliae, Parmeliella, Parmeliopsis, Parmentaria, Parmularia, Parmulariella, Parmulina, Parmulineae, Parodiella, Parodiellina, Parodiopsis, Paropsis, Paryphedria, Passalora, Passeriniella, Passerinula, Patellaria, Patellariaceae, Patellea, Patellina, Patellinae, Patellonectria, Patinella, Patouillardia, Patouillardiella, Patouillardina, Pauahia, Paulia, Paurocotylis, Paxillus, Paxina, Pazschkea, Pazschkella, Peccania, Peckia, Peckiella, Pedilospora, Pellicularia, Pellionella, Pelodiscus, Peloronectria, Peltaster, Peltella, Peltidea, Peltidium, Peltigera, Peltigeraceae, Peltigerae, Peltigeromyces, Peltistroma, Peltosoma, Peltosphaeria, Peltostroma, Peltostromella, Pemphidium, Penicilliopsis, Penicillium, Peniophora, Peniophorina, Penomyces, Pentagenella, Penzigia, Perforaria, Periaster, Peribotryuin, Perichlamys, Pericladium, Pericoccis, Periconia, Periconiella, Pericystis, Peridermium, Peridoxylum, Periola, Periolopsis, Perischizum, Perisporiaceae, Perisporiales, Ierisporiella, Perisporina, Perisporiopsis, Ierisporiopsis, Perisporium, Peristemma, Peristomium, Perizomatium, Perizomella, Peroneutypa, Peroneutypella, Peronoplasmopara, Peronospora, Peronosporaceae, Peronosporae, Perrotia, Perrotiella, Persooniella, Pertusaria, Pertusariae, Pestalozzia. Pestalozziella, Pestalozzina, Petasodes, Petelotia, Petractis, Petrakia, Petrakiella, Peyritschiella, Peyritschiellaceae, Peyronelia, Peziotrichum, Peziza, Pezizaceae, Pezizae, Pezizales, Pezizella, Pezizellaster, Z Pezolepis, Pezoloma, Pezomela, Phacenula, Phacidiaceae, Phacidiales, Phacidiella, Phacidina, Phacidiostroma, Phacidium, Phacopsis, Phacopsora, Phaeangella, Phaeangium, Phaeapiospora, Phaeaspis. Phaeharziella, Phaeidium, Phaeisaria, Phaeisariopsis, Phaeobotryosphaeria, Phaeobotryum, Phaeocapnodinula, Phaeochora, Phaeochorella, Phaeociboria, Ihaeoclavulina, Phaeoconis, Phaeocreopsis, Phaeocryptopus, Phaeocyphella, Phaeocytostroma, Phaeoderris, Phaeodiaporthe, Phaeodimeriella, Phaeodimeris, Phaeodiscula, Phaeodomus, Phaeodothiopsis, Phaeodothis, Phaeofabraea, Phaeoglossum, Phaeographina, Phaeographis, Phacoliygrocybe, Phaeolabrella, Phaeolimacium, Phaeomacropus, Phaeomarasniius, Phaeomarsonia, Phaeomarssonia, Phaeomeris, Ihaeoiiionostichella, Phaeopeltis, Phaeopeltis, Phaeopeltium, Phaeopeltosphaeria, Phaeopezia, Phaeophacidium, Phaeophleospora, Phaeophomatospora, Phaeophomopsis, Phaeopolynema, Phaeopterula, Phaeoradulum, Phaeorhytisma, Phaeosaccardinula, Phaeoschiffnerula, Phaeoscutella, Phaeoseptoria, Phaeosperma, Phaeosphaerella, Phaeosphaeria, Phaeospora, Phaeosporis, Phaeostigme, Phaeostigme, Phaeostilbella, Phaeothrombis, Phaeotrabutiella, Phaeotrema, Phaeotremella, Phaeotrype, Phallaceae, Phallobata, Phallogaster, Phallus, Phalodictyum, Phalostauris, Phalothrix, Phanerascus, Phanerococcus, Phanerocorynelia, Phanerocorynenm, Phaneroniyces, Phanosticta, Phanotylium, Pharcidia, Pharcidiella, Pharcidiopsis, Phellorina, Phellostroma, Phialea, Phialophoi-a, IMiillipsia, PhiUipsiella, Philocopra, Philonectria, Phlebia, Phlebophora, Phleboscyphus, Phlegmophiale, Phleogena, Phleospora, Phloeoconis, Phloeopeccania, Phlocophthora, Phlocosporella, Phlocosporina, Phlyctaena, Phlyctaeniella, Phlyctella, Phlyctidia, Phlyctidium, Phlyctis, Phlyctochytrium, riioenicostronia, Pholiota, Pholiotella, Phoma, Phomaceae, Phomachora, Phomales, Phomatospora, Phomatosporopsis, Phomopsina, Phomopsis, Phomyces, Phorcys, Phragmidiella, Phragmidium, Phragmocalosphaeria, Phragmocapnias, Phragmocarpella, Phraginocauma, Phragmodochium, Phragmodothella, Phragmodothidea, Phragmodothis, Phragmonaevia, Phragmopeltis, Phragmopyxine, Phragmopyxis, Phragmoscutella, Phragmosperma, Phragniotelium, Phragmothele, Phragmothyriella, Phragmothyrium, Phragmotrichum, Phthora, Phycascus, Phycodiscis, Phycomyces, Phycomycetes, Phycopsis, Phyllachora, Phyllachorae, Phyllachorella, Phyllactinia, Phylliscidium, Phylliscum, Phyllobathelium, Phylloblastia, Phyllobrassia, Phyllocarbon, Phyllocelis, Phyllocelis, Phyllocrea, Phylloedia, Phyllomyces, Phyllonochaeta, Phyllophthalmaria Phylloporina, Phylloporis, Phylloporthe, Phylloporus, Phyllopsora, Phyllopsorae, Phyllosticta, Phyllostictina, Phyllotremella, Phymatodiscus, Phymatosphaeria, Phymatotrichum, Physalacria, Physalospora, Physalosporella, Physalosporina, Physcia, Physciaceae, Physcidia, Physma, Physmatomyces, Physoderma, Physopella, Physospora, Physosporella, Phytophthora, Pichia, Picoa, Piersonia, Piggotia, Pila, Pilacre, Pilacrella, Pilaira, Pileolaria, Pilgeriella, Pilidiel]a, Pilidium, Piline, Pilobolae, Pilobolus, Pilocratera, Pilophorum, Pilosace, Pilula, Piniina, Pinoyella, Pionnotes, Piptocephalis, Piptostoma, Piptostomum, Pirella, Piricauda, Piricularia, Piringa, Pirobasidium, Pirogaster, Pirostoma, Pirostomella, Pirostomella, Pirottaea, Pisolithus, Pisomyxa, Pistillaria, Pithomyces, Pitya, Pityella, Placasterella, Placidiopsis, Placodiplodia, Placodothis, Placographa, Placonema, Placonemina, Placopeziza, Placophomopsis, Placosoma, Placosphaerella, Placosphaeria, Placostroma, Placothelium, Placothyrium, Plactogene, llacuntium, Placynthium, Plaiorhabdus, Plagiostigme, riagiostoma, Ilagiostomella, Magiostroniella, Ilagiotrema, Plasmodiophora, Plasmodiophoraceae, Plasmopara, Plasmophagus, liatycarpiuni, Platychora, Platygloea, riatypcltella, Ilatysticta, Platystomum, Plearthonis, Plectania, Plectodiscella, Plectonaemella, Plectopeltis, Plectophoma, Plectophomella, Plectophomopsis, Plectosira, Plectosphaera, Plectosphaerella, Plectospira, Plectothrix, Plenodomus, Plenophysa, Plenotrichum, Plenozythia, Pleochaeta, Pleochroma, Ileococcum, Pleoconis, Pleocouturea, Pieocyta, Pleodothis, Pleogibberella, Pleoglonis, Pleolecis, Pleolpidium, Pleomassaria, Pleomeliola, Pleomelogramma, Ileomeris, Pleomerium, Pleonectria, Pleopatella, Pleophalis, Pleophragiiiia, Pleopyrenis, Pleoravenelia, Pleorinis, Pleoscutula, Pleosphaeria, Pleosphaeropsis, Pleosphaeropsis, Pleosphaerulina, Pleospilis, Pleospora, Pleosporopsis, Pleostictis, Pleostomella, Pleotrachelus, Plcurage, Pleurascus, Pleuroceras, Pleurocolla, Pleurocybe, Pleurocytospora, Pleurodiscula, Pleuronaema, Pleurophoma, Pleurophomella, Pleurophomopsis, Pleuroplaconema, Pleuroplacosphaeria, Pleurostoma, Pleurostomella, Pieurothecium, Pleurotheliopsis, Pleurothyriella, Pleurothyrium, Pleurotrema, Pleurotus, Plicaria, PHcariella, Plochmopeltideila, Plochmopeltineae, Plochmopeltis, Ploettnera, Plowrightia, Plowrightiella, Iluriporus, Pluteolus, Pluteus, Pocillum, Pocosphaeria, Podaleuris, Podaxon, Podocapsa, Podocapsium, Podochytrium, Podocrea, Podonectria, Podophacidium, Podoplaconema, Podosordaria, Podosphaera, Podospora, Podosporiella, Podosporium, Podostictina, Podostroma, Podostroma, Podoxyphium, Poecilosporium, Polhysterium, Polioma, Poliomella, Poliotelium, Polyascomyces, Polyblastia, Polyblastiopsis, Polycarpella, Polychaetella, Polychaetum, Polychaetum, Polychidium, Polyclypeolum, Polycoccum, Polycyclina, Polycyclus, Polydesmus, Polygaster, Polylagenochromatia, Polymorphomyccs, Polynema, Polyopeus, Polyphagus, Polyplocium, Polyporaceae, Polyporus, Iolyrhina, Polyrhizum, Polysaccopsis, Polysaccum, Polyscytalum, Polyspora, Polysporidium, Polystictus, Polystigma, Polystigmina, Polystomella, Polystomellaceae, Polystomelleae, Polystroma, Polythelis, Polythelis, Polythrincium, Polythyrium, Polytrichia, Pompholyx, Poria, Porina, Porinopsis, Porocyphus, Poronia, Poropeltis, Poroptyche, Porostigme, Porothelium, Porphyrosoma, Porterula, Pragmopara, Preussia, Prillieuxia, Prillieuxina, Pringsheimia, Prismaria, Pritzeliella, Proabsidia, Prolisea, Promycetes, Pronectria, Prophytroma, Propolidium, Propolina, Propoliopsis, Propolis, Prospodium, Prosthecium, Prosthemiella, Prosthemium, Protascus, Protasia, Proteomyces, Protoachlya, Protoblastenia, Protocalicium, Protococcales, Protocoronis, Protocoronospora, Protodontia, Protoglossum, Protohydnum, Protomerulius, Protomyces, Protomycetaceae, Protomycopsis, Protopeltis, Protoscypha, Protoscypha, Protostegia, Protothyrium, Protoventuria, Protubera, Psalidosperma, Psalliota, Psammina, Psathyra, Psathyrella, Pseudacolium, Pseuderiospora, Pseudoabsidia, Pseudobalsamia, Pseudobeltrania, Pseudocamptoum, Pseudocenangium, Pseudocercospora, Pseudocytospora, Pseudodiaporthe, Pseudodichomera, Pseudodictya, Pseudodimerium, Pseudodimeriujn, Pseudodiplodia, Pseudodiscosia, Pseudodiscula, Pseudofumago, Pseudogaster, Pseudogenea, Pseudographis, Pseudographium, Pseudoguignardia, Pseudohaplis, Pseudohaplosporella, Pseudohelotium, Pseudoheppia, Pseudohydnotrya, Pseudolachnea, Pseudolecanactis, Pseudolembosia, Pseudolizonia, Pseudolpidiopsis, Pseudolpidium, Pseudomassaria, Pseudombrophila, Pseiidomelasniia, Pseudomeliola, Pseudomicrocera, Pseudomonilia, Pseudomycoderma, Pseudonectria, Pseudoparmelia, Pseudoparodia, Pseudoparodiella, Pseudopatella, Pseudopatellina, Pseudoperis, Pseudoperisporium, Pseudoperonospora, Pseudopeziza, Pseudophacidium, Pseudophoma, Pseudophomopsis, Pseudophyllachora, Pseudophysalospora, Pseudopityella, Pseudoplasmopara, Pseudoplea, Pseudoplea, Pseudoplectania, Pseudopleospora, Pseudopolystigmina, Pseudopuccinia, Pseudopyrenula, Pseudorhynchia, Pseudorhytisma, Pseudosaccharomyces, Pseudosclerophoma, Pseudoseptoria, Pseudosphaerella, Pseudosphaeria, Pseudostegia, Pseudostictis, Pseudothiopsella, Pseudothis, Pseudothyridaria, Pseudotrochila, Pseudotryblidium, Pseudotrype, Pseudotthia, Pseudotthiella, Pseudovalsa, Pseudovularia, Pseudozythia, Psilocybe, Psiloglonium, Psilonia, Psilopezia, Psilospora, Psilosporina, Psilothecium, Psora, Psorella, Psoroglaena, Psorographis, Psoroma, Psoromaria, Psorotheciella, Psorotheciopsis, Psorotichia, Psyllidomyces, Pteridiospora, Pteromyces, Pterophyllus, Pterula, Pterygiopsis, Pterygium, Ptychographa, Ptychopeltis, Puccinia, Pucciniaceae, Pucciniales, Pucciniastrum, Pucciniopsis, Pucciniosira, Pucciniospora, Pucciniostele, Puiggariella, Puiggarina, Pullularia, Pulparia, Pulveraria, Punctillum, Pustularia, Puttemannsia, Puttemannsiella, Pycnidiella, Pycnidiostroma, Pycnis, Pycnocarpum, Pycnochytrium, Pycnoderma,. Pycnodothis, Pycnographa, Pycnomma, Pycnopeltis, Pycnosporium, Pycnostemma, Pycnostroma, Pycnostysanus, Pycnothyrium, Pyrertastrum, Pyrenidiae, Pyrenidium, Pyreniella, Pyrenobotrys, Pyrenochaeta, Pyrenochaetina, Pyrenocollema, Pyrenodiscus, Pyrenomyxa, Pyrenopezis, Pyrenopeziza, Pyrenopezizae, Pyrenopezizopsis, Pyrenophora, Pyrenopolyporus, Pyrenopsidae, Pyrenopsidium, Pyrenopsis, Pyrenostigme, Pyrenothamnia, Pyrenotheca, Pyrenothrix, Pyrenotrichum, Pyrenotrochila, Pyrenula, Pyrenulae, Pyrenyllium, Pyrgidium, Pyrgillus, Pyrhosorus, Pyronema, Pyronemella, Pythiae, Pythiocystis, Pythiogeton, Pythiomorpha, Pythiopsis, Pythium, Pyxidiophora, Pyxine, Quaternaria, Queletia, Questiera, Rabenhorstia, Rachisia, Raciborskiella, Kaciborskioiiiyces, Racodium, Radaisella, Radulum, Ramalina. Ramalodium, Ramonia, Ramosiella, Ramsbottomia, Ramularia, Ramulariopsis, Raniulariospora, Ramularisphaerclla, Ramulaspera, Rainulispora, Ranojevicia, Ravenelia, Ravenelula, Readerella, Rebentischia, Reessia, Rehniiella, Rehmiellopsis, Rehmiodothis, Rehmiomyces, Reinkella, “lC Resticularia, Reyesiella, Rhabdium, Rhabdocline, Rhabdogloeopsis, Rhabdogloeum, Rhabdopsora, Rhabdospora, Rhabdostroma, Rhabdostromella, Rhabdostromellina, Rhabdostromina, Rhabdothyrella, Rhabdothyrium, Rhachomyces, Rhacodiella, Rhacodium, Rhacophyllus, Rhadinomyces, Rhagadolobium, Rhagadostoma, Rhamphoria, Rhamphospora, Rhaphidisegestria, Rhaphidocyrtis, Rhaphidophora, Rhaphidopyris, Rhaphidospora, Rhaphidyllis, Rheumatopeltis, Rhinocladium, Rhinotrichum, Rhipidium, Rhipidocarpum, Rhizalia, Rhizidiocystis, Rhizidiomyces, Rhizidium, Rhizina, Rhizinae, Rhizocalyx, Rhizocarpum, Rhizoclosmatium, Rhizoctonia, Rhizogene, Rhizohypha, Rhizomorpha, Rhizomyces, Rhizomyxa, Rhizophidium, Rhizophlyctis, Rhizophoma, Rhizopogon, Rhizopus, Rhizosphaera, Rhizosphaerella, Rhizotexis, Rhizothyrium, Rhodobolites, Rhodochytrium, Rhodocybe, Rhodomyces, Rhodopaxillus, Rhodoseptoria, Rhodosticta, Rhodothrix, Rhodotorula, Rhodotus, Rhombostilbella, Rhopalidium, Rhopalocystis, Rhopalomyces, Rhopographella, Rhopographina, Rhopographus, Rhymbocarpus, Rhynchodiplodia, Rhynchomelas, Rhynchomeliola, Rhynchomyces, Rhynchomyces, Rhynchonectria, Rhynchophoma, Rhyncophoromyces, Rhynchophorus, Rhynchosphaeria, Rhynchosporium, Rhynchostoma, Rhynchostomopsis, Rhyparobius, Rhysotheca, Rhytidenglerula, Rhytidhysterium, Rhytidopeziza, Rhytisma, Rhytismella, Riccoa, Richonia, Rickia, Rickiella, Riessia, Rimbachia, Rinia, Rinodina, Robergea, Robertomyces, Robillardia, Robledia, Roccella, Roccellae, Roccellaria, Roccellina, Roccellographa, Rodwaya, Roesleria, Roestelia, Rollandina, Romellia, Rosellinia, Rosenscheldia, Rosenscheldiella, Rostkovites. Rostrella, Rostronitschkea, Rostrosphaeria, Rostrupia, Rotaea, Rotularia, Roumegueria, Roumegueriella, Roussoella, Rozella, Rozites, Ruhlandlella, Russula, Rutstroemia, Sabourauditcs, Saccardaea, Saccardia, Saccardiae, Saccardinula, Saccardoella, Saccardomyces, Saccharomyces, Saccharomycetaceae, Saccharomycodes, Saccharomycopsis, Saccoblastia, Saccobolus, Saccomyces, Saccothecium, Sachsia, Sacidium, Sagediopsis, Sagiolechia, Saitomyces, Samarospora, Sampaioa, Santiella, Saprolegnia, Saprolegniaceae, Saprolegniae, Sapromyces, Sarcinella, Sarcinodochium, Sarcinomyces, Sarcographa, Sarcographina, Sarcomyces, Sarcophoma, Sarcopodium, Sarcopyrenia, Sarcoscypha, Sarcosphaera, Sarcosoma, Sarcotrochila, Sarcoxylum, Sarophorum, Sartorya, Scaphidium, Scelobelonium, Scenomyces, Sceptromyces, Schenckiella, Schiffnerula, Schin/.ia, Scliinzinia, Schismatomma, Schistodes, Schistophorum, Schizachora, Schizacrospernnim, Schizocapnodium, Schizonella, Schizoparme, Schizopelte, Schizophyllum, Schizosaccharis, Schizosaccharomyces, Schizospora, Schizostege, Schizostoma, Schizothyrella, Schizothyrioma, Schizothyrium, Schizotrichum, Schizoxylum, Schneepia, Schoenbornia, Schroeterella, Schroeteria, Schroeteriaster, Schulzeria, Schwanniomyces, Schweinitziella, Sciodothis, Scirrhia, Scirrhiachora, Scirrhiella, Scirrhiopsis, Scirrhodothis, Scirrhophragma, Sclerangium, Sclerochaeta, Sclerochaetella, Sclerococcum, Sclerocystis, Sclerodcpsis, Scleroderma, Scleroderris, Sclerodiscus, Sclerodothiorella, Sclerodothis, Sclerographis, Sclerographium, Scleromeris, Sclerophoma, Sclerophomella, Sclerophomina, Sclerophytum, Scleroplea, Scleroplella, Scleropycnium, Sclerosphaeropsis, Sclerospora, Sclerostagonospora, Sclerotelium, Sclerotheca, Sclerothyrium, Sclerotinia, Sclerotiomyces, Sclerotiopsis, Sclerotium, Scodellina, Scolecactis, Scoleciocarpus, Scolecobasis, Scolecoccoidea, Scolecodothis, Scolecodothopsis, Scoleconectria, Scolecopeltidella, Scolecopeltidium, Scolecopeltis, Scolecopeltium, Scolecopeltopsis, Scolecosporiella, Scolecotrichum, Scolecozythia, Scoliciosporium, Scolionema, Scopinella, Scopophoma, Scoptria, Scopularia, Scopulariopsis, Scorias, Scoriomyces, Scortechinia, Scutellinia, Scutellum, Scutula, Scutularia, Scutellinia, Scutelliniae, Scyphospora, Scyphostroma, Scytopezis, Sebacina, Secotium, Seismosarca, Selenophoma, Selenophomopsis, Selenotila, Selinia, Semigyalecta, Sepedonium, Septobasidium, Septochora, Septocladia, Septocylindrium, Septocyta, Septocytella, Septodothideopsis, Septogloeum, Septoideum, Septomazzantia, Septomyxa, Septonema, Septopatella, Septorella, Septoria, Septoriella, Septoriopsis, Septorisphaerella, Septosporium, Septothyrella, Septotrullula, Sepultaria, Setchellia, Setella, Seuratia, Seynesia, Seynesiola, Seynesiopsis, Shearia, Shiraia, Shropshiria, Sigmatomyces, Sigmoidomyces, Sillia, Simblum, Simonyella, Siphonaria, Siphula, Sirentyloma, Sirexcipula, Sirexcipulina, Siridiella, Siridina, Siridium, Sirobasidium, Sirococcus, Sirocyphis, Sirodesmium, Sirodiplospora, Sirodochiella, Sirodothis, Sirogloea, Sirolegniella, Sirolpidium, Siropatella, Sirophoma, Siroplaconema, Siroplaconema, Siroscyphella, Siroscyphellina, Sirosperma, Sirosphaera, Sirospora, Sirosporium, Sirostromella, Sirothecium, Sirothyriella, Sirothyrium, Sirozythia, Sirozythiella, Sistotrema, Skepperia, Skepperiella, Skierkia, Skottsbergiella, Smeringomyces, Solanella, Solenia, Solenodonta, Solenoplea, Solenopsora, Solorina, Solorinella, Sommerstorffia, Sordaria, Sorica, Sorodiscus, Sorokinia, Sorolpidium, Sorosphaera, Sorosporium, Sorothelia, Sparassis, Spathularia, Spegazzinia, Spegazzinula, Spermatoloncha, Spennodennia, Spennophthora, Sphacelia, Sphaceliopsis, Sphacelotheca, Sphaerella, Sphaerellothecium, Sphaeriaceae, Sphaeriales, Sphaericeps, Sphaeridium, Sphaeriostromella, Sphaeriothyrium, Sphaerita, Sphaerobolus, Sphaerocista, Sphaerocolla, Sphaerocreas, Sphaeroderma, Sphaerodermella, Sphaerodes, Sphaerodothis, Sphaerognomonia, Sphaerographium, Sphaeromyces, Sphaeronema, Sphacronemella, Sphaeronemina, Sphaeronemopsis, Sphaeropezia, Sphaerophoma, Sphaerophoropsis, Sphaerophorus, Sphaerophragmium, Sphaeropsis, Sphaerosoma, Sphaerospora, Sphaerosporium, Sphaerostilbe, Sphaerostilbella, Sphaerotheca, Sphaerothyrium, Sphaerulina, Sphaleromyces, Spheconisca, Sphenospora, Sphinctrina, Sphinctrinopsis, Spicaria, Spicularia, Spilodochium, Spilomium, Spilomyces, Spilonema, Spilopezis, Spilopodia, Spilosticta, Spinalia, Spinellus, Spira, Spiralia, Spirechina, Spirogramma, Spirographa, Spirogyrales, Spirospora, Spolverinia, Spondylocladium, Spongospora, Sporendonema, Sporhelminthiuni, Sporobolomyces, Sporoclema, SporoctcJmorpha, Sporocybe, Sporocystis, Sporoderma, Sporodesmium, Sporodictyum, Sporodinia, Sporodiniopsis, Sporomega, Sporomyxa, Sporonema, Sporophlyctis, Sporophysa, Sporopodium, Sporormia, Sporormiella, Sporoschisma, Sporostachys, Sporotrichella, Sporotrichum, Spragueola, Spumatoria, Squamotubera, Stachybotryella, Stachybotrys, Stachylidium, Stagonopatella, Stagonopsis, Stagonospora, Stagonosporopsis, Stagonostroma, Stagonostromella, Staheliomyces, Stalagmites, Stamnaria, Starbaeckia, Starbaeckiella, Staurochaeta, Stauronema, Staurophoma, Staurothele, Steganopycnis, Steganosporium, Stegasphaeria, Stegastroma, Stegia, Stegopeziza, Stegopezizella, Stegophora, Stegothyrium, Steinera, Stella, Stemmaria, Stemphyliomma, Stemphyliopsis, Stemphyliopsis, Stemphylium, Stenocarpella, Stenocybe, Stephanoma, Stephanospora, Stephanotheca, Stephensia, Stereocaulum, Stereochlamys, Stereocrea, Stereolachnea, Stereostratum, Stereum, Sterigmatocystis, Sterile Mycelia, Stevensea, Stevensiella, Stevensula, Stichodothis, Stichomyces, Stichopsora, Stichospora, Sticta, Stictae, Stictidaceae, Stictina, Stictinae, Stictis, Stictochorella, Stictochorellina, Stictoclypeolum, Stictopatella, Stictophacidium, Stictostroma, Stigeosporium, Stigmatea, Stigmateae, Stigmatella, Stigmatodothis, Stigmatomyces, Stigmatopeltis, Stigmatophragmia, Stigmatopsis, Stigme, Stigmella, Stigmina, Stigmochora, Stigmopeltella, Zld Stigmopeltis, Stigmopsis, Stilbaceae, Stilbella, Stilbochalara, Stilbocrea, Stilbodendrum, Stilbohypoxylon, Stilbomyces, Stilbonectria, Stilbopeziza, Stilbospora, Stilbothamnium, Stilbum, Stirochaete, Stomatogene, Stomiopeltella, Stomiopeltis, Strasseria, Streptotheca, Streptothrix, Strickeria, Strigula, Strigulae, Strobilomyces, Stromatiiiia, Stromatographium, Stroinatostysanus, troninc, Stropharia, Strossmayera, Strumella, Strumellopsis, Stuartclla, Stylina, Stylobates, Stylonectria, Stypella, Stypinella, Stysanopsis, Stysanus, Subiilariella, Subulicola, Succinaria, Suilliis, Sydowia, Sydowiella, Sydowina, Sydowinula, Symphaeophyma, Symphaster, Symphyosira, Symplectromyces, Synalissa, Synarthonia, Syncarpella, Syncephalastrum, Syncephalidae, Syncephalis, Synchactophagus. Synchytriaceae, Synchytrium, Syncsiella, Synesiopeltis, Synglonium, Synnematium, Synomyces, Synostomella, Synpeltis, Synsporium, Syntexis, Synthctospora, Systremma, Systrcmmopsis, Syzygitcs, Taeniophora, Tang!clla, Tapellaria, Tapesia, . Taphridium, Taphrina, Tarichiuni, Tarzetta, Tassia, Teichospora, Teichosporella, Telcutospora, Telimena, Tcloconia, Tclospora, Tcphrosticta, reratomyces, Teratonema, Teratosperma, Teratosphaeria, Terfezia, Terfeziopsis, Termitaria, Testicularia, Testudina, Tetrachia, Tetrachytriuin, Tetracium, Tetracladium, Tetracoccosporis, Tetracoccosporium, Tetramyxa, Tetraploa, Thalassoascus, Tlialassomyces, Thallochaete, Thalloedema, Thamnidium, Thamnocephalis, Thamnolia, Thamnomyces, Thaxteria, Thaxteriella, Thecaphora, Thcciopcltis, Thecopsora, Thecostroma, Thecotheus, Theissenia, Theissenula, Thelebolus, Thelenidia, Thelephora, Thelephoraceae, Thelidiopsis, Thelidium, Thelis, Thelocarpum, Theloporus, Thelopsis, Theloschistes, Thelospora, Thelotrema, Thermoidium, Thernioniyccs, Thermutis, Therrya, Thielavia, Thielaviopsis, Tholurna, Thoracella, Thozetia, Thrauste, Thraustotheca, Thrombium. Thuemenella, Thwaitesiella, Thyrea, Thyriascus, Thyridaria, Thyridella, Thyridium, Thyrinula, Thyriopsis, Thyriostoma, Thyriostroiiia, Thyrococciim, Thyrodochium, Thyronectria, Thyronectroidea, Thyrosoma, Thyrospora, Thyrostroma, Thyrostromella, Thyrsidiella, Thyrsidina, Thyrsidium, Thysanopyxis, Thysanothecium, Tiarospora, Tiarosporella, Tichospora, Tichosporella, Ti Tichothecium, Tieeheniella, TilachlidioDsis. Tilachlidium, Tilletia, Tilletiaceae, Tilotus, Tirmania, Titaea, Titaeospora, Titaeosporina, Titanella, Titania, Tibodasia, Togninia, Tolypomyria, Tolyposporella, Tolyposporium, Tomasiella, Tomentellina, Tonduzia, Toninia, Topospora, Torrendia, Iorrcndiclla, Torrubiella, Torscllia, Torula, Torula, Torulina, Toruloidea, Torulopsis, Torulospora, Toxosporium, Trabuticlla, Trachysphaera, Trachyspora, Tracbysporella, Trachythyriolum, Trachyxylaria, Tracya, Tracyella, Trailia, Trailia, Trametes, Tranzschelia, Traversoa, Treleasia, Treleasiella, Trematophoma, Trematosphaerella, Trematosphaeria, Trematosphaeriopsis, Trematosphaeris, Treinatovalsa, Tremella, Tremellaceae, Tremellales, Tremellidium, Tremellodendrum, Tremellodon, Tremellogaster, Tremellopsis, Tremotylium, Treubiomyces, Triactella, Tricella, Trichaegum, Trichaleurina, Trichaleuris, Tricharia, Tricharia, Trichaster, Trichasterina, Trichobacidia, Trichobelonium, Trichobotrys, Trichochora, Trichococcinus, Trichocladium, Trichocollonema, Trichocoma, Trichoconis, Trichocrea, Trichoderma, Trichodiscula, Trichodochium, Trichodothis, Trichodytes, Trichofusarium, Trichoglossum, Trichohleria, Tricholoma, Trichomerium, Trichonectria, Trichopelteae, Trichopeltella, Trichopeltina, Trichopeltis, Trichopeltium, Trichopeltopsis, Trichopeltula, Trichopeltulum, Trichophila, Trichophyma, Trichophytum, Trichopsora, Trichoscypha, Trichoseptoria, Trichosperma, Trichospermella, Trichosphaerella, Trichosphaeria, Trichosporina, Trichosporium, Trichosterigma, Trichostronia, Trichothallus, Tricliotheca, Trichothecium, Trichothelium, Trichothyriaceae, Trichothyriella, Trichothyriopsis, Trichothyrium, Trichotrema, Trichurus, Tridens, Triglyphium, Trigonosporium, Trimmatostroma, Trimmatothele, Trinacrium, Triphragmiopsis, Triphragmium, Triplicaria, Tripospermum, Tripospora, Triposporina, Triposporium, Trochila, Trochodium, Trogia, Tromcra, Troposporella, Troposporium, i Trotteria, Trotterula, Trullula, Tryblidaria, Tryblidiaceae, Tryblidiella, Tryblidiopsis, Tryblidiopycnis, Tryblidis, Tryblidium, Tryblis, Trypetheliae, Trypethelium, Tubaria, Tuber, Tuberaceae, Tuberales, Tubercularia, Tuberculariaceae, Tiibcrcularielia, Tiibcrculariopsis, Tubercularis, Tuberculina, Tuberculis, Tubeufia, Tuburcinia, Tulasnella, Tylophilus, Tylophorella, Tylophorum, Tylostoma, Tympanis, Tympanopsis, Typhula, Typhulochaeta, Tyridiomyces, U Ulcodolliclla, Ulcodothis, Uleomyccs, Uleopeltis, Uleothyrium, Ulocolla, Umbilicaria, Uncigera, Uncinula, Underwoodia, Unguicularia, Unguiculariopsis, Uredinopsis, Uredo, Urnula, Urobasidium, Uroconis, Urocystis, Lrohcndersonia, Uromyces, Uromycladium, Uromycopsis, Urophiala, . Urophlyctis, Uropolystigma, Uropyxis, Urospora, Urosporella, Urosporium, Usnea, Usneae, Ustilaginaceae, Ustilaginales, Ustilaginodes, Ustilago, Ustilagopsis, Ustulina, Valdensia, Valetoniella, Valsa, Valsaria, Valsella, Valseutypella, Valsonectria, Vanderystiella, Varicellaria, Varicosporium, Vasculomyces, Vaucheriales, yi Velloziella, Velutaria, Venturia, U Venturiella, Vermicularia, Vermiculariella, Verpa, Verrucaria, Verrucariaceae, Verrucariae, Verrucaster, Verticicladium, Verticilliae, Verticillidochium, Verticilliopsis, Verticillis, Verticillium, Vestergrenia, Vialaea, Vibrissea, Virgaria, Vittadinula, Vivianella, Vizella, Voeltzknowiella, Volkartia, Volutena, Volutellaria, Volutellis, Volutellopsis, Volutellops!s, Volutina, Volvaria, Volvariella, Volvoboletus, Vouauxiella, W Wageria, Wallrothiella, Wardina, Wardomyces, Wawelia, Wecsea, Wegelina, Weinmannodora, Wentiomyces, Wettsteinina, Wiesnerina, Wiesneriomyces, Willeya, Williopsis, Winterella, Winterina, Winteromyces, Wojnowicia, Wolkia, Woodiella, Woronina, Woroninae, Woroninella, Wynnea, Wynnella, Xanthocarpia, Xanthopsora, Xanthopyrenia, Xanthoria, Xenodochus, Xenodomus, Xenogloea, Xenolophium, Xenomeris, Xenomyces, Xenonectria, Xenopeltis, Xenopus, Xenosphaeria, Xenosporella, Xenosporium, Xenostele, Xenostroma, Xenothccium, Xerotus, Xiphomyces, Xylaria, Xylariodiscus, Xylobotryum, Xyloceras, Xylocladium, Xylocrea, Xyloglyphis, Xylogramma, Xylographa, Xyloma. Xylopodium, Xyloschistes, Xyloscbizuin, Xylostroma, Xystozukalia, Yatesula, Yoshinagaia, Yoshinagamyces, Yoshinagella, Ypsilonia, Zaghouania, Zahlbrucknerella, Zignoella, Zimmermanniella, Zodiomyces, Zonosporis, Zoophagus, Zopfia, Zopfiella, Zukalia, Zukalina, Zukaliopsis, Zukaliopsis, Zygochytrium, Zygodesmella, Zygodesmus, Zygorhizidium, Zygosaccharis, Zygosaccharomyces, Zygosporium, Zythia, and Zythiaceae. GROWTH MEDIA Common media for the growth of microbes bacteria Microbe Type Media Organisms Bacteria Nutrient Peptone Agar Heterotrophic bacteria MacConkey Agar + myo-inositol + Carbenicillin J agar Bacillus sp. and other firmicutes N-poor Medium Aerobic heterotrophic N2-fixing (LGT) bacteria Yeast Mannitol Agar Rhizobium sp. King's B medium Pseudomonas sp. SC medium Fastidious bacteria R2A agar Oligotrophic bacteria Tryptic Soy Agar Heterotrophic bacteria Fungi Cormeal agar Fungi Glucose-Yeast extract Selective enumeration of yeasts agar + tetracyclin and moulds. Potato-Dextrose agar Yeasts and molds Sabouraud Agar Yeasts, molds and aciduric microorganisms V8 Agar Malt Dextrose Agar Identification of yeasts and moulds Czapek's medium Fungi and Mold SPT agar Antibiotics Generic name Brand names Common uses Mechanism of action Aminoglycosides Amikacin Amikin Infections caused by Gram- Binding to the bacterial 30S ribosomal Gentamicin Garamycin negative bacteria, such as subunit (some work by binding to the Kanamycin Kantrex 50S subunit), inhibiting the translocation Neomycin Neo-Fradin[3] of the peptidyl-tRNA from the A-site to Netilmicin Netromycin the P-site and also causing misreading of Tobramycin Nebcin Effective against Aerobic mRNA, leaving the bacterium unable to Paromomycin Humatin bacteria (not synthesize proteins vital to its growth. obligate/facultative anaerobes) and tularemia. Spectinomycin Trobicin Gonorrhea Ansamycins Geldanamycin Experimental, as antitumor Herbimycin antibiotics Rifaximin, Xifaxan Travelers diarrhea caused streptomycin by Carbacephem Loracarbef Lorabid Discontinued prevents bacterial cell division by inhibiting cell wall synthesis. Carbapenems Ertapenem Invanz Bactericidal for both Gram- Inhibition of cell wall synthesis Doripenem Doribax positive and Gram-negative Imipenem/Cilastatin Primaxin organisms and therefore Meropenem Merrem useful for empiric broad- spectrum antibacterial coverage. (Note MRSA resistance to this class.) Cephalosporins (First generation) Cefadroxil Duricef Good coverage against Same mode of action as other beta- Cefazolin Ancef Gram-positive infections. lactam antibiotics: disrupt the synthesis Cefalotin or Keflin of the peptidoglycan layer of bacterial Cefalothin cell walls. Cefalexin Keflex Cephalosporins (Second generation) Cefaclor Distaclor Less Gram-positive cover, Same mode of action as other beta- Cefamandole Mandol improved Gram-negative lactam antibiotics: disrupt the synthesis Cefoxitin Mefoxin cover. of the peptidoglycan layer of bacterial Cefprozil Cefzil cell walls. Cefuroxime Ceftin, Zinnat (UK) Cephalosporins (Third generation) Cefixime Suprax Improved coverage of Same mode of action as other beta- Cefdinir Omnicef, Cefdiel Gram-negative organisms, lactam antibiotics: disrupt the synthesis Cefditoren Spectracef except Pseudomonas. of the peptidoglycan layer of bacterial Cefoperazone Cefobid Reduced Gram-positive cell walls. Cefotaxime Claforan cover. Cefpodoxime Vantin Ceftazidime Fortaz Ceftibuten Cedax Ceftizoxime Cefizox Ceftriaxone Rocephin Cephalosporins (Fourth generation) Cefepime Maxipime Covers pseudomonal Same mode of action as other beta- infections. lactam antibiotics: disrupt the synthesis of the peptidoglycan layer of bacterial cell walls. Cephalosporins (Fifth generation) Ceftaroline Teflaro Used to treat MRSA Same mode of action as other beta- fosamil lactam antibiotics: disrupt the synthesis of the peptidoglycan layer of bacterial cell walls. Ceftobiprole Zeftera Used to treat MRSA Same mode of action as other beta- lactam antibiotics: disrupt the synthesis of the peptidoglycan layer of bacterial cell walls. Glycopeptides Teicoplanin Targocid (UK) Active against aerobic and inhibiting peptidoglycan synthesis Vancomycin Vancocin anaerobic Gram-positive Telavancin Vibativ bacteria including MRSA; Vancomycin is used orally for the treatment of Lincosamides Clindamycin Cleocin Serious staph-, pneumo-, Bind to 50S subunit of bacterial Lincomycin Lincocin and streptococcal infections ribosomal RNA thereby inhibiting in penicillin-allergic protein synthesis patients, also anaerobic infections; clindamycin topically for acne Lipopeptide Daptomycin Cubicin Gram-positive organisms Bind to the membrane and cause rapid depolarization, resulting in a loss of membrane potential leading to inhibition of protein, DNA and RNA synthesis Macrolides Azithromycin Zithromax, Streptococcal infections, inhibition of bacterial protein Sumamed, syphilis, upper respiratory biosynthesis by binding reversibly to the Xithrone tract infections, lower subunit 50S of the bacterial ribosome, Clarithromycin Biaxin respiratory tract infections, thereby inhibiting translocation of Dirithromycin Dynabac mycoplasmal infections, peptidyl tRNA. Erythromycin Erythocin, Lyme disease Erythroped Roxithromycin Troleandomycin Tao Telithromycin Ketek Pneumonia Spiramycin Rovamycine Mouth infections Monobactams Aztreonam Azactam Same mode of action as other beta- lactam antibiotics: disrupt the synthesis of the peptidoglycan layer of bacterial cell walls. Nitrofurans Furazolidone Furoxone Bacterial or protozoal diarrhea or enteritis Nitrofurantoin Macrodantin, Urinary tract infections Macrobid Oxazolidonones Linezolid Zyvox VRSA Protein synthesis inhibitor; prevents the initiation step Posizolid Phase II clinical trials Radezolid Phase II clinical trials Torezolid Phase II clinical trials Penicillins Amoxicillin Novamox, Wide range of infections; Same mode of action as other beta- Amoxil penicillin used for lactam antibiotics: disrupt the synthesis Ampicillin Principen streptococcal infections, of the peptidoglycan layer of bacterial Azlocillin syphilis, and Lyme disease cell walls. Carbenicillin Geocillin Cloxacillin Tegopen Dicloxacillin Dynapen Flucloxacillin Floxapen (Sold to European generics Actavis Group) Mezlocillin Mezlin Methicillin Staphcillin Nafcillin Unipen Oxacillin Prostaphlin Penicillin G Pentids Penicillin V Veetids (Pen- Vee-K) Piperacillin Pipracil Penicillin G Pfizerpen Temocillin Negaban (UK) Ticarcillin Ticar Penicillin combinations Amoxicillin/clavulanate Augmentin The second component prevents Ampicillin/sulbactam Unasyn bacterial resistance to the first Piperacillin/tazobactam Zosyn component Ticarcillin/clavulanate Timentin Polypeptides Bacitracin Eye, ear or bladder Inhibits isoprenyl pyrophosphate, a infections; usually applied molecule that carries the building blocks directly to the eye or of the peptidoglycan bacterial cell wall inhaled into the lungs; outside of the inner membrane[5] Colistin Coly-Mycin-S rarely given by injection, Interact with the Gram-negative Polymyxin B although the use of bacterial outer membrane and intravenous colistin is cytoplasmic membrane. It displaces experiencing a resurgence bacterial counter ions, which destabilizes due to the emergence of the outer membrane. They act like a multi drug resistant detergent against the cytoplasmic organisms. membrane, which alters its permeability. Polymyxin B and E are bactericidal even in an isosmotic solution. Quinolones Ciprofloxacin Cipro, Ciproxin, Urinary tract infections, inhibit the bacterial DNA gyrase or the Ciprobay bacterial prostatitis, topoisomerase IV enzyme, thereby Enoxacin Penetrex community-acquired inhibiting DNA replication and Gatifloxacin Tequin pneumonia, bacterial transcription. Levofloxacin Levaquin diarrhea, mycoplasmal Lomefloxacin Maxaquin infections, gonorrhea Moxifloxacin Avelox Nalidixic acid NegGram Norfloxacin Noroxin Ofloxacin Floxin, Ocuflox Trovafloxacin Trovan Withdrawn Grepafloxacin Raxar Withdrawn Sparfloxacin Zagam Withdrawn Temafloxacin Omniflox Withdrawn Sulfonamides Mafenide Sulfamylon Urinary tract infections Folate synthesis inhibition. They are Sulfacetamide Sulamyd, Bleph- (except sulfacetamide, used competitive inhibitors of the enzyme 10 for eye infections, and dihydropteroate synthetase, DHPS. Sulfadiazine Micro-Sulfon mafenide and silver DHPS catalyses the conversion of Silver Silvadene sulfadiazine, used topically PABA (para-aminobenzoate) to sulfadiazine for burns) dihydropteroate, a key step in folate Sulfadimethoxine Di-Methox, synthesis. Folate is necessary for the cell Albon to synthesize nucleic acids (nucleic acids Sulfamethizole Thiosulfil Forte are essential building blocks of DNA Sulfamethoxazole Gantanol and RNA), and in its absence cells Sulfanilimide cannot divide. (archaic) Sulfasalazine Azulfidine Sulfisoxazole Gantrisin Trimethoprim- Bactrim, Septra Sulfamethoxazole (Co- trimoxazole) (TMP-SMX) Sulfonamidochrysoidine Prontosil (archaic) Tetracyclines Demeclocycline Declomycin Syphilis, chlamydial inhibiting the binding of aminoacyl- Doxycycline Vibramycin infections, Lyme disease, tRNA to the mRNA-ribosome complex. Minocycline Minocin mycoplasmal infections, They do so mainly by binding to the 30S Oxytetracycline Terramycin acne rickettsial infections, ribosomal subunit in the mRNA Tetracycline Sumycin, *malaria *Note: Malaria is translation complex. Achromycin V, caused by a protist and not a Steclin bacterium. Drugs against mycobacteria Clofazimine Lamprene Antileprotic Dapsone Avlosulfon Antileprotic Capreomycin Capastat Antituberculosis Cycloserine Seromycin Antituberculosis, urinary tract infections Ethambutol Myambutol Antituberculosis Ethionamide Trecator Antituberculosis Inhibits peptide synthesis Isoniazid I.N.H. Antituberculosis Pyrazinamide Aldinamide Antituberculosis Rifampicin Rifadin, mostly Gram-positive and Binds to the β subunit of RNA (Rifampin in US) Rimactane mycobacteria polymerase to inhibit transcription Rifabutin Mycobutin Mycobacterium avium complex Rifapentine Priftin Antituberculosis Streptomycin Antituberculosis As other aminoglycosides Others Arsphenamine Salvarsan Spirochaetal infections (obsolete) Chloramphenicol Chloromycetin meningitis, MRSA, topical Inhibits bacterial protein synthesis by use, or for low cost internal binding to the 50S subunit of the treatment. Historic: typhus, ribosome cholera. Gram-negative, Gram-positive, anaerobes Fosfomycin Monurol Acute cystitis in women Inactivates enolpyruvyl transferase, thereby blocking cell wall synthesis Fusidic acid Fucidin Metronidazole Flagyl Infections caused by Produces toxic free radicals that disrupt anaerobic bacteria; also DNA and proteins. This non-specific amoebiasis, trichomoniasis, mechanism is responsible for its activity Giardiasis against a variety of bacteria, amoebae, and protozoa. Mupirocin Bactroban Ointment for impetigo, Inhibits isoleucine t-RNA synthetase cream for infected cuts (IleRS) causing inhibition of protein synthesis Platensimycin Quinupristin/Dalfopristin Synercid Thiamphenicol Gram-negative, Gram- A chloramphenicol analog. May inhibit positive, anaerobes. widely bacterial protein synthesis by binding to used in veterinary medicine. the 50S subunit of the ribosome Tigecycline Tigacyl Indicated for complicated skin/skin structure infections and complicated intra-abdominal infections. ||Teeth discoloration.|| Tinidazole Tindamax protozoan infections Fasigyn Trimethoprim Proloprim, Urinary Tract Infections Trimpex TRANSGENIC PLANTS Event Company Description Patent Potato ATBT04-6, Monsanto Colorado potato beetle resistant ATBT04-27, Company potatoes produced by inserting ATBT04-30, the cry3A gene from ATBT04-31, ATBT04-36, SPBT02-5, SPBT02-7 Potato BT6, BT10, Monsanto Colorado potato beetle resistant BT12, BT16, Company potatoes produced by inserting BT17, BT18, the cry3A gene from BT23 Potato EH92-527-1 BASF Plant Altered starch composition, Science increased amylopectin to amylose ratio, through the introduction of a fragment of the potato granule- bound starch synthase encoding gene (gbss) in the anti-sense orientation. The nptIIgene was also introduced as a selectable marker for identifying transformed plants. Potato RBMT15-101, Monsanto Colorado potato beetle and potato SEMT15-02, Company virus Y (PVY) resistant potatoes SEMT15-15 produced by inserting the cry3A gene from Tenebrionis) and the coat protein encoding gene from PVY. Potato RBMT21-129, Monsanto Colorado potato beetle and potato RBMT21-350, Company leafroll virus (PLRV) resistant RBMT22-082 potatoes produced by inserting the cry3A gene from and the replicase encoding gene from PLRV. Rice CL121, CL141, BASF Inc. Tolerance to the imidazolinone CFX51 herbicide, imazethapyr, induced by chemical mutagenesis of the acetolactate synthase (ALS) enzyme using ethyl methanesulfonate (EMS). Rice IMINTA-1, BASF Inc. Tolerance to imidazolinone US IMINTA-4 herbicides induced by chemical 20070028318 mutagenesis of the acetolactate A1 synthase (ALS) enzyme using sodium azide. Rice LLRICE06, Aventis Glufosinate ammonium herbicide WO LLRICE62 CropScience tolerant rice produced by inserting a 2001083818 modified phosphinothricin A2 acetyltransferase (PAT) encoding gene from the soil bacterium Rice LLRICE601 Bayer Glufosinate ammonium herbicide US CropScience tolerant rice produced by inserting a 20080289060 (Aventis modified phosphinothricin A1 CropScience acetyltransferase (PAT) encoding (AgrEvo)) gene from the soil bacterium Rice PWC16 BASF Inc. Tolerance to the imidazolinone herbicide, imazethapyr, induced by chemical mutagenesis of the acetolactate synthase (ALS) enzyme using ethyl methanesulfonate (EMS). Soybean A2704-12, Bayer Glufosinate ammonium herbicide A2704-21, CropScience tolerant soybean produced by A5547-35 (Aventis inserting a modified CropScience phosphinothricin acetyltransferase (AgrEvo)) (PAT) encoding gene from the soil bacterium Soybean A5547-127 Bayer Glufosinate ammonium herbicide CropScience tolerant soybean produced by (Aventis inserting a modified CropScience phosphinothricin acetyltransferase (AgrEvo) (PAT) encoding gene from the soil bacterium Soybean BPS-CV127-9 BASF Inc. The introduced csr1-2 gene from Arabidopsis thaliana encodes an acetohydroxyacid synthase protein that confers tolerance to imidazolinone herbicides due to a point mutation that results in a single amino acid substitution in which the serine residue at position 653 is replaced by asparagine (S653N). Soybean DP-305423 DuPont High oleic acid soybean produced by Pioneer inserting additional copies of a portion of the omega-6 desaturase encoding gene, gm-fad2-1resulting in silencing of the endogenous omega-6 desaturase gene (FAD2-1). Soybean DP356043 DuPont Soybean event with two herbicide Pioneer tolerance genes: glyphosate N- acetlytransferase, which detoxifies glyphosate, and a modified acetolactate synthase (ALS) gene which is tolerant to ALS-inhibitng herbicides. Soybean G94-1, G94-19, DuPont High oleic acid soybean produced by G168 Canada inserting a second copy of the fatty Agricultural acid desaturase (GmFad2-1) Products encoding gene from soybean, which resulted in “silencing” of the endogenous host gene. Soybean GTS 40-3-2 Monsanto Glyphosate tolerant soybean variety Company produced by inserting a modified 5- enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene from the soil bacterium Soybean GU262 Bayer Glufosinate ammonium herbicide CropScience tolerant soybean produced by (Aventis inserting a modified CropScience phosphinothricin acetyltransferase (AgrEvo)) (PAT) encoding gene from the soil bacterium Soybean MON87701 Monsanto Resistance to lepidopteran pests of Company soybean including velvetbean caterpillar ( and soybean looper ( Soybean MON87701 × Monsanto Glyphosate herbicide tolerance U.S. Pat. No. 8,455,198 MON89788 Company through expression of the EPSPS B2 encoding gene from strain CP4, and resistance to lepidopteran pests of soybean including velvetbean caterpillar ( and soybean looper ( Cry1Ac encoding gene from Soybean MON89788 Monsanto Glyphosate-tolerant soybean Company produced by inserting a modified 5- enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding aroA (epsps) gene from Soybean OT96-15 Agriculture & Low linolenic acid soybean U.S. Pat. No. 7,632,985 Agri-Food produced through traditional cross- B2 Canada breeding to incorporate the novel trait from a naturally occurring fan1gene mutant that was selected for low linolenic acid. Soybean W62, W98 Bayer Glufosinate ammonium herbicide CropScience tolerant soybean produced by (Aventis inserting a modified CropScience phosphinothricin acetyltransferase (AgrEvo)) (PAT) encoding gene from the soil bacterium Squash CZW-3 Asgrow Cucumber mosiac virus (CMV), U.S. Pat. No. 6,337,431 (USA); zucchini yellows mosaic (ZYMV) B1 Seminis and watermelon mosaic virus Vegetable Inc. (WMV) 2 resistant squash (Canada) ( inserting the coat protein (CP) encoding sequences from each of these plant viruses into the host genome. Squash ZW20 Upjohn Zucchini yellows mosaic (ZYMV) U.S. Pat. No. 6,337,431 (USA); and watermelon mosaic virus B1 Seminis (WMV) 2 resistant squash Vegetable Inc. ( (Canada) inserting the coat protein (CP) encoding sequences from each of these plant potyviruses into the host genome. Beet GTSB77 Novartis Glyphosate herbicide tolerant sugar Seeds; beet produced by inserting a gene Monsanto encoding the enzyme 5- Company enolypyruvylshikimate-3-phosphate synthase (EPSPS) from the CP4 strain of Beet H7-1 Monsanto Glyphosate herbicide tolerant sugar U.S. Pat. No. 7,335,816 Company beet produced by inserting a gene B2 encoding the enzyme 5- enolypyruvylshikimate-3-phosphate synthase (EPSPS) from the CP4 strain of Beet T120-7 Bayer Introduction of the PPT- CropScience acetyltransferase (PAT) encoding (Aventis gene from CropScience (AgrEvo)) bacteria. PPT normally acts to inhibit glutamine synthetase, causing a fatal accumulation of ammonia. Acetylated PPT is inactive. Tobacco C/F/93/08-02 Societe Tolerance to the herbicides National bromoxynil and ioxynil by dExploitation incorporation of the nitrilase gene des Tabacs et from Allumettes Tobacco Vector 21-41 Vector Reduced nicotine content through US Tobacco Inc. introduction of a second copy of the 20050072047 tobacco quinolinic acid A1 phosphoribosyltransferase (QTPase) in the antisense orientation. The NPTII encoding gene from was introduced as a selectable marker to identify transformants. Wheat AP205CL BASF Inc. Selection for a mutagenized version of the enzyme acetohydroxyacid synthase (AHAS), also known as acetolactate synthase (ALS) or acetolactate pyruvate-lyase. Wheat AP602CL BASF Inc. Selection for a mutagenized version of the enzyme acetohydroxyacid synthase (AHAS), also known as acetolactate synthase (ALS) or acetolactate pyruvate-lyase. Wheat BW255-2, BASF Inc. Selection for a mutagenized version BW238-3 of the enzyme acetohydroxyacid synthase (AHAS), also known as acetolactate synthase (ALS) or acetolactate pyruvate-lyase. Wheat BW7 BASF Inc. Tolerance to imidazolinone herbicides induced by chemical mutagenesis of the acetohydroxyacid synthase (AHAS) gene using sodium azide. Wheat MON71800 Monsanto Glyphosate tolerant wheat variety U.S. Pat. No. Company produced by inserting a modified 5- 6,689,880 enolpyruvylshikimate-3-phosphate synthase (EPSPS) encoding gene from the soil bacterium Wheat SWP965001 Cyanamid Selection for a mutagenized version Crop of the enzyme acetohydroxyacid Protection synthase (AHAS), also known as acetolactate synthase (ALS) or acetolactate pyruvate-lyase. Wheat Teal 11A BASF Inc. Selection for a mutagenized version of the enzyme acetohydroxyacid synthase (AHAS), also known as acetolactate synthase (ALS) or acetolactate pyruvate- lyase. 2-(thiocyanatomethylthio)-benzothiazole, 2-phenylphenol, 8-hydroxyquinoline sulfate, ametoctradin, amisulbrom, antimycin, Ampelomyces quisqualis, azaconazole, azoxystrobin, bicarbonates, biphenyl, bismerthiazol, bitertanol, bixafen, blasticidin-S, borax, Bordeaux mixture, boscalid, bromuconazole, bupirimate, calcium polysulfide, captafol, captan, carbendazim, carboxin, carpropamid, carvone, chloroneb, chlorothalonil, chlozolinate, Coniothyrium minitans, copper hydroxide, copper octanoate, copper oxychloride, copper sulfate, copper sulfate (tribasic), cuprous oxide, cyazofamid, cyflufenamid, cymoxanil, cyproconazole, cyprodinil, dazomet, debacarb, diammonium ethylenebis-(dithiocarbamate), dichlofluanid, dichlorophen, diclocymet, diclomezine, dichloran, diethofencarb, difenoconazole, difenzoquat ion, diflumetorim, dimethomorph, dimoxystrobin, diniconazole, diniconazole-M, dinobuton, dinocap, diphenylamine, dithianon, dodemorph, dodemorph acetate, dodine, dodine free base, edifenphos, enestrobin, epoxiconazole, ethaboxam, ethoxyquin, etridiazole, famoxadone, fenamidone, fenarimol, fenbuconazole, fenfuram, fenhexamid, fenoxanil, fenpiclonil, fenpropidin, fenpropimorph, fentin, fentin acetate, fentin hydroxide, ferbam, ferimzone, fluazinam, fludioxonil, flumorph, fluopicolide, fluopyram, fluoroimide, fluoxastrobin, fluquinconazole, flusilazole, flusulfamide, flutianil, flutolanil, flutriafol, fluxapyroxad, folpet, formaldehyde, fosetyl, fosetyl-aluminium, fuberidazole, furalaxyl, furametpyr, guazatine, guazatine acetates, GY-81, hexachlorobenzene, hexaconazole, hymexazol, imazalil, imazalil sulfate, imibenconazole, iminoctadine, iminoctadine triacetate, iminoctadine tris(albesilate), ipconazole, iprobenfos, iprodione, iprovalicarb, isoprothiolane, isopyrazam, isotianil, kasugamycin, kasugamycin hydrochloride hydrate, kresoxim- methyl, mancopper, mancozeb, mandipropamid, maneb, mepanipyrim, mepronil, mercuric chloride, mercuric oxide, mercurous chloride, metalaxyl, mefenoxam, metalaxyl-M, metam, metam-ammonium, metam-potassium, metam-sodium, metconazole, methasulfocarb, methyl iodide, methyl isothiocyanate, metiram, metominostrobin, metrafenone, mildiomycin, myclobutanil, nabam, nitrothal-isopropyl, nuarimol, octhilinone, ofurace, oleic acid (fatty acids), orysastrobin, oxadixyl, oxine-copper, oxpoconazole fumarate, oxycarboxin, pefurazoate, penconazole, pencycuron, penflufen, pentachlorophenol, pentachlorophenyl laurate, penthiopyrad, phenylmercury acetate, phosphonic acid, phthalide, picoxystrobin, polyoxin B, polyoxins, polyoxorim, potassium bicarbonate, potassium hydroxyquinoline sulfate, probenazole, prochloraz, procymidone, propamocarb, propamocarb hydrochloride, propiconazole, propineb, proquinazid, prothioconazole, pyraclostrobin, pyrametostrobin, pyraoxystrobin, pyrazophos, pyribencarb, pyributicarb, pyrifenox, pyrimethanil, pyroquilon, quinoclamine, quinoxyfen, quintozene, Reynoutria sachalinensis extract, sedaxane, silthiofam, simeconazole, sodium 2-phenylphenoxide, sodium bicarbonate, sodium pentachlorophenoxide, spiroxamine, sulfur, SYP-Z071, SYP-Z048, tar oils, tebuconazole, tebufloquin, tecnazene, tetraconazole, thiabendazole, thifluzamide, thiophanate-methyl, thiram, tiadinil, tolclofos-methyl, tolylfluanid, triadimefon, triadimenol, triazoxide, tricyclazole, tridemorph, trifloxystrobin, triflumizole, triforine, triticonazole, validamycin, valifenalate, valiphenal, vinclozolin, zineb, ziram, zoxamide, Trichoderma spp., (RS)-N-(3,5-dichlorophenyl)-2-(methoxymethyl)-succinimide, 1,2-dichloropropane, 1,3-dichloro-1,1,3,3-tetrafluoroacetone hydrate, 1-chloro-2,4-dinitronaphthalene, 1-chloro-2- nitropropane, 2-(2-heptadecyl-2-imidazolin-1-yl)ethanol, 2,3-dihydro-5-phenyl-1,4-dithi-ine 1,1,4,4- tetraoxide, 2-methoxyethylmercury acetate, 2-methoxyethylmercury chloride, 2-methoxyethylmercury silicate, 3-(4-chlorophenyl)-5-methylrhodanine, 4-(2-nitroprop-1-enyl)phenyl thiocyanateme, ampropylfos, anilazine, azithiram, barium polysulfide, Bayer 32394, benodanil, benquinox, bentaluron, benzamacril; benzamacril-isobutyl, benzamorf, binapacryl, bis(methylmercury) sulfate, bis(tributyltin) oxide, buthiobate, cadmium calcium copper zinc chromate sulfate, carbamorph, CECA, chlobenthiazone, chloraniformethan, chlorfenazole, chlorquinox, climbazole, cyclafuramid, cypendazole, cyprofuram, decafentin, dichlone, dichlozoline, diclobutrazol, dimethirimol, dinocton, dinosulfon, dinoterbon, dipyrithione, ditalimfos, dodicin, drazoxolon, EBP, ESBP, etaconazole, etem, ethirim, fenaminosulf, fenapanil, fenitropan, 5-fluorocytosine and profungicides thereof, fluotrimazole, furcarbanil, furconazole, furconazole-cis, furmecyclox, furophanate, glyodine, griseofulvin, halacrinate, Hercules 3944, hexylthiofos, ICIA0858, isopamphos, isovaledione, mebenil, mecarbinzid, metazoxolon, methfuroxam, methylmercury dicyandiamide, metsulfovax, milneb, mucochloric anhydride, myclozolin, N-3,5- dichlorophenyl-succinimide, N-3-nitrophenylitaconimide, natamycin, N-ethylmercurio-4- toluenesulfonanilide, nickel bis (dimethyldithiocarbamate), OCH, phenylmercury dimethyldithiocarbamate, phenylmercury nitrate, phosdiphen, picolinamide UK-2A and derivatives thereof, prothiocarb; prothiocarb hydrochloride, pyracarbolid, pyridinitril, pyroxychlor, pyroxyfur, quinacetol; quinacetol sulfate, quinazamid, quinconazole, rabenzazole, salicylanilide, SSF-109, sultropen, tecoram, thiadifluor, thicyofen, thiochlorfenphim, thiophanate, thioquinox, tioxymid, triamiphos, triarimol, triazbutil, trichlamide, urbacid, XRD-563, and zarilamide, IK-1140. POPULAR FUNGICIDES Crop Popular Fungicides Used Corn Syngenta Maxim Quattro (mefenoxam, fludioxonil, azoxystrobin & thiabendazole; systemic action, “cleans up surface and internal pathogens”; targeted at Fusarium, broad spectrum); Monsanto Acceleron: DC-309 (metalaxyl), DC-509 (ipconazole), DX-709 (trifloxystrobin); BASF: Stamina (pyraclostrobin), Stamina F3 (pyraclostrobin, triticonazole, metalaxyl) Soybean Monsanto Acceleron: DX-109 (pyraclostrobin), DX-309 (metalaxyl), Bayer EverGol Energy (prothioconazole, metalaxyl & penflufen); Wheat BASF: Charter F2 (triticonazole, metalaxyl), Stamina (pyraclostrobin), Stamina F3 (pyraclostrobin, triticonazole, metalaxyl), Charter (triticonazole); Syngenta Dividend (difenoconazole); 4-CPA; 4-CPB; 4-CPP; 2,4-D; 3,4-DA; 2,4-DB; 3,4-DB; 2,4-DEB; 2,4-DEP; 3,4-DP; 2,3,6-TBA; 2,4,5- T; 2,4,5-TB; acetochlor, acifluorfen, aclonifen, acrolein, alachlor, allidochlor, alloxydim, allyl alcohol, alorac, ametridione, ametryn, amibuzin, amicarbazone, amidosulfuron, aminocyclopyrachlor, aminopyralid, amiprofos-methyl, amitrole, ammonium sulfamate, anilofos, anisuron, asulam, atraton, atrazine, azafenidin, azimsulfuron, aziprotryne, barban, BCPC, beflubutamid, benazolin, bencarbazone, benfluralin, benfuresate, bensulfuron, bensulide, bentazone, benzadox, benzfendizone, benzipram, benzobicyclon, benzofenap, benzofluor, benzoylprop, benzthiazuron, bicyclopyrone, bifenox, bilanafos, bispyribac, borax, bromacil, bromobonil, bromobutide, bromofenoxim, bromoxynil, brompyrazon, butachlor, butafenacil, butamifos, butenachlor, buthidazole, buthiuron, butralin, butroxydim, buturon, butylate, cacodylic acid, cafenstrole, calcium chlorate, calcium cyanamide, cambendichlor, carbasulam, carbetamide, carboxazole chlorprocarb, carfentrazone, CDEA, CEPC, chlomethoxyfen, chloramben, chloranocryl, chlorazifop, chlorazine, chlorbromuron, chlorbufam, chloreturon, chlorfenac, chlorfenprop, chlorflurazole, chlorflurenol, chloridazon, chlorimuron, chlornitrofen, chloropon, chlorotoluron, chloroxuron, chloroxynil, chlorpropham, chlorsulfuron, chlorthal, chlorthiamid, cinidon-ethyl, cinmethylin, cinosulfuron, cisanilide, clethodim, cliodinate, clodinafop, clofop, clomazone, clomeprop, cloprop, cloproxydim, clopyralid, cloransulam, CMA, copper sulfate, CPMF, CPPC, credazine, cresol, cumyluron, cyanatryn, cyanazine, cycloate, cyclosulfamuron, cycloxydim, cycluron, cyhalofop, cyperquat, cyprazine, cyprazole, cypromid, daimuron, dalapon, dazomet, delachlor, desmedipham, desmetryn, di-allate, dichlobenil, dichloralurea, dichlormate, dichlorprop, dichlorprop-P, diclofop, diclosulam, diethamquat, diethatyl, difenopenten, difenoxuron, difenzoquat, diflufenican, diflufenzopyr, dimefuron, dimepiperate, dimethachlor, dimethametryn, dimethenamid, dimethenamid-P, dimexano, dimidazon, dinitramine, dinofenate, dinoprop, dinosam, dinoseb, dinoterb, diphenamid, dipropetryn, diquat, disul, dithiopyr, diuron, DMPA, DNOC, DSMA, EBEP, eglinazine, endothal, epronaz, EPTC, erbon, esprocarb, ethalfluralin, ethametsulfuron, ethidimuron, ethiolate, ethofumesate, ethoxyfen, ethoxysulfuron, etinofen, etnipromid, etobenzanid, EXD, fenasulam, fenoprop, fenoxaprop, fenoxaprop- P, fenoxasulfone, fenteracol, fenthiaprop, fentrazamide, fenuron, ferrous sulfate, flamprop, flamprop-M, flazasulfuron, florasulam, fluazifop, fluazifop-P, fluazolate, flucarbazone, flucetosulfuron, fluchloralin, flufenacet, flufenican, flufenpyr, flumetsulam, flumezin, flumiclorac, flumioxazin, flumipropyn, fluometuron, fluorodifen, fluoroglycofen, fluoromidine, fluoronitrofen, fluothiuron, flupoxam, flupropacil, flupropanate, flupyrsulfuron, fluridone, flurochloridone, fluroxypyr, flurtamone, fluthiacet, fomesafen, foramsulfuron, fosamine, furyloxyfen, glufosinate, glufosinate-P, halosafen, halosulfuron, haloxydine, haloxyfop, haloxyfop-P, hexachloroacetone, hexaflurate, hexazinone, imazamethabenz, imazamox, imazapic, imazapyr, imazaquin, imazethapyr, imazosulfuron, indanofan, indaziflam, iodobonil, iodomethane, iodosulfuron, ioxynil, ipazine, ipfencarbazone, iprymidam, isocarbamid, isocil, isomethiozin, isonoruron, isopolinate, isopropalin, isoproturon, isouron, isoxaben, isoxachlortole, isoxaflutole, isoxapyrifop, karbutilate, ketospiradox, lactofen, lenacil, linuron, MAA, MAMA, MCPA, MCPA-thioethyl, MCPB, mecoprop, mecoprop-P, medinoterb, mefenacet, mefluidide, mesoprazine, mesosulfuron, mesotrione, metam, metamifop, metamitron, metazachlor, metazosulfuron, metflurazon, methabenzthiazuron, methalpropalin, methazole, methiobencarb, methiozolin, methiuron, methometon, methoprotryne, methyl bromide, methyl isothiocyanate, methyldymron, metobenzuron, metobromuron, metolachlor, metosulam, metoxuron, metribuzin, metsulfuron, molinate, monalide, monisouron, monochloroacetic acid, monolinuron, monuron, morfamquat, MSMA, naproanilide, napropamide, naptalam, neburon, nicosulfuron, nipyraclofen, nitralin, nitrofen, nitrofluorfen, norflurazon, noruron, OCH, orbencarb, ort/zo-dichlorobenzene, orthosulfamuron, oryzalin, oxadiargyl, oxadiazon, oxapyrazon, oxasulfuron, oxaziclomefone, oxyfluorfen, parafluron, paraquat, pebulate, pelargonic acid, pendimethalin, penoxsulam, pentachlorophenol, pentanochlor, pentoxazone, perfluidone, pethoxamid, phenisopham, phenmedipham, phenmedipham-ethyl, phenobenzuron, phenylmercury acetate, picloram, picolinafen, pinoxaden, piperophos, potassium arsenite, potassium azide, potassium cyanate, pretilachlor, primisulfuron, procyazine, prodiamine, profluazol, profluralin, profoxydim, proglinazine, prometon, prometryn, propachlor, propanil, propaquizafop, propazine, propham, propisochlor, propoxycarbazone, propyrisulfuron, propyzamide, prosulfalin, prosulfocarb, prosulfuron, proxan, prynachlor, pydanon, pyraclonil, pyraflufen, pyrasulfotole, pyrazolynate, pyrazosulfuron, pyrazoxyfen, pyribenzoxim, pyributicarb, pyriclor, pyridafol, pyridate, pyriftalid, pyriminobac, pyrimisulfan, pyrithiobac, pyroxasulfone, pyroxsulam, quinclorac, quinmerac, quinoclamine, quinonamid, quizalofop, quizalofop-P, rhodethanil, rimsulfuron, saflufenacil, S-metolachlor, sebuthylazine, secbumeton, sethoxydim, siduron, simazine, simeton, simetryn, SMA, sodium arsenite, sodium azide, sodium chlorate, sulcotrione, sulfallate, sulfentrazone, sulfometuron, sulfosulfuron, sulfuric acid, sulglycapin, swep, TCA, tebutam, tebuthiuron, tefuryltrione, tembotrione, tepraloxydim, terbacil, terbucarb, terbuchlor, terbumeton, terbuthylazine, terbutryn, tetrafluron, thenylchlor, thiazafluron, thiazopyr, thidiazimin, thidiazuron, thiencarbazone-methyl, thifensulfuron, thiobencarb, tiocarbazil, tioclorim, topramezone, tralkoxydim, tri- allate, triasulfuron, triaziflam, tribenuron, tricamba, triclopyr, tridiphane, trietazine, trifloxysulfuron, trifluralin, triflusulfuron, trifop, trifopsime, trihydroxytriazine, trimeturon, tripropindan, tritac tritosulfuron, vernolate and xylachlor. DB, 2,4-DEP, dichlorprop, fenoprop, IAA, IBA, naphthaleneacetamide, α-naphthaleneacetic acid, 1- naphthol, naphthoxyacetic acid, potassium naphthenate, sodium naphthenate, 2,4,5-T; cytokinins such as 2iP, benzyladenine, kinetin, zeatin; defoliants such as calcium cyanamide, dimethipin, endothal, ethephon, merphos, metoxuron, pentachlorophenol, thidiazuron, tribufos; ethylene inhibitors such as aviglycine, 1-methylcyclopropene; ethylene releasers such as ACC, etacelasil, ethephon, glyoxime; gibberellins such as gibberellins, gibberellic acid; growth inhibitors such as abscisic acid, ancymidol, butralin, carbaryl, chlorphonium, chlorpropham, dikegulac, flumetralin, fluoridamid, fosamine, glyphosine, isopyrimol, jasmonic acid, maleic hydrazide, mepiquat, mepiquat, piproctanyl, prohydrojasmon, propham, 2,3,5-tri-iodobenzoic acid; morphactins such as chlorfluren, chlorflurenol, dichlorflurenol, flurenol; growth retardants such as chlormequat, daminozide, flurprimidol, mefluidide, paclobutrazol tetcyclacis, uniconazole; growth stimulators such as brassinolide, forchlorfenuron, hymexazol; and unclassified plant growth regulators such as benzofluor, buminafos, carvone, ciobutide, clofencet, cloxyfonac, cyanamide, cyclanilide, cycloheximide, cyprosulfamide, epocholeone, ethychlozate, ethylene, fenridazon, heptopargil, holosulf, inabenfide, karetazan, lead arsenate, methasulfocarb, prohexadione, pydanon, sintofen, triapenthenol, and trinexapac. Antibiotic insecticides such as allosamidin and thuringiensin; macrocyclic lactone insecticides such as spinosad, spinetoram, and other spinosyns including the 21-butenyl spinosyns and their derivatives; avermectin insecticides such as abamectin, doramectin, emamectin, eprinomectin, ivermectin and selamectin; milbemycin insecticides such as lepimectin, milbemectin, milbemycin oxime and moxidectin; arsenical insecticides such as calcium arsenate, copper acetoarsenite, copper arsenate, lead arsenate, potassium arsenite and sodium arsenite; biological insecticides such as modulating oostatic factor, insecticides such as Cry1Ab, Cry1Ac, Cry1F, Cry1A.105, Cry2Ab2, Cry3A, mir Cry3A, Cry3Bb1, Cry34, Cry35, and VIP3A; botanical insecticides such as anabasine, azadirachtin, d-limonene, nicotine, pyrethrins, cinerins, cinerin I, cinerin II, jasmolin I, jasmolin II, pyrethrin I, pyrethrin II, quassia, rotenone, ryania and sabadilla; carbamate insecticides such as bendiocarb and carbaryl; benzofuranyl methylcarbamate insecticides such as benfuracarb, carbofuran, carbosulfan, decarbofuran and furathiocarb; dimethylcarbamate insecticides dimitan, dimetilan, hyquincarb and pirimicarb; oxime carbamate insecticides such as alanycarb, aldicarb, aldoxycarb, butocarboxim, butoxycarboxim, methomyl, nitrilacarb, oxamyl, tazimcarb, thiocarboxime, thiodicarb and thiofanox; phenyl methylcarbamate insecticides such as allyxycarb, aminocarb, bufencarb, butacarb, carbanolate, cloethocarb, dicresyl, dioxacarb, EMPC, ethiofencarb, fenethacarb, fenobucarb, isoprocarb, methiocarb, metolcarb, mexacarbate, promacyl, promecarb, propoxur, trimethacarb, XMC and xylylcarb; dinitrophenol insecticides such as dinex, dinoprop, dinosam and DNOC; fluorine insecticides such as barium hexafluorosilicate, cryolite, sodium fluoride, sodium hexafluorosilicate and sulfluramid; formamidine insecticides such as amitraz, chlordimeform, formetanate and formparanate; fumigant insecticides such as acrylonitrile, carbon disulfide, carbon tetrachloride, chloroform, chloropicrin, para- dichlorobenzene, 1,2-dichloropropane, ethyl formate, ethylene dibromide, ethylene dichloride, ethylene oxide, hydrogen cyanide, iodomethane, methyl bromide, methylchloroform, methylene chloride, naphthalene, phosphine, sulfuryl fluoride and tetrachloroethane; inorganic insecticides such as borax, calcium polysulfide, copper oleate, mercurous chloride, potassium thiocyanate and sodium thiocyanate; chitin synthesis inhibitors such as bistrifluoron, buprofezin, chlorfluazuron, cyromazine, diflubenzuron, flucycloxuron, flufenoxuron, hexaflumuron, lufenuron, novaluron, noviflumuron, penfluoron, teflubenzuron and triflumuron; juvenile hormone mimics such as epofenonane, fenoxycarb, hydroprene, kinoprene, methoprene, pyriproxyfen and triprene; juvenile hormones such as juvenile hormone I, juvenile hormone II and juvenile hormone III; moulting hormone agonists such as chromafenozide, halofenozide, methoxyfenozide and tebufenozide; moulting hormones such as α-ecdysone and ecdysterone; moulting inhibitors such as diofenolan; precocenes such as precocene I, precocene II and precocene III; unclassified insect growth regulators such as dicyclanil; nereistoxin analogue insecticides such as bensultap, cartap, thiocyclam and thiosultap; nicotinoid insecticides such as flonicamid; nitroguanidine insecticides such as clothianidin, dinotefuran, imidacloprid and thiamethoxam; nitromethylene insecticides such as nitenpyram and nithiazine; pyridylmethylamine insecticides such as acetamiprid, imidacloprid, nitenpyram and thiacloprid; organochlorine insecticides such as bromo-DDT, camphechlor, DDT, pp′-DDT, ethyl-DDD, HCH, gamma-HCH, lindane, methoxychlor, pentachlorophenol and TDE; cyclodiene insecticides such as aldrin, bromocyclen, chlorbicyclen, chlordane, chlordecone, dieldrin, dilor, endosulfan, endrin, HEOD, heptachlor, HHDN, isobenzan, isodrin, kelevan and mirex; organophosphate insecticides such as bromfenvinfos, chlorfenvinphos, crotoxyphos, dichlorvos, dicrotophos, dimethylvinphos, fospirate, heptenophos, methocrotophos, mevinphos, monocrotophos, naled, naftalofos, phosphamidon, propaphos, TEPP and tetrachlorvinphos; organothiophosphate insecticides such as dioxabenzofos, fosmethilan and phenthoate; aliphatic organothiophosphate insecticides such as acethion, amiton, cadusafos, chlorethoxyfos, chlormephos, demephion, demephion-O, demephion-S, demeton, demeton-O, demeton-S, demeton-methyl, demeton-O- methyl, demeton-S-methyl, demeton-S-methylsulphon, disulfoton, ethion, ethoprophos, IPSP, isothioate, malathion, methacrifos, oxydemeton-methyl, oxydeprofos, oxydisulfoton, phorate, sulfotep, terbufos and thiometon; aliphatic amide organothiophosphate insecticides such as amidithion, cyanthoate, dimethoate, ethoate-methyl, formothion, mecarbam, omethoate, prothoate, sophamide and vamidothion; oxime organothiophosphate insecticides such as chlorphoxim, phoxim and phoxim-methyl; heterocyclic organothiophosphate insecticides such as azamethiphos, coumaphos, coumithoate, dioxathion, endothion, menazon, morphothion, phosalone, pyraclofos, pyridaphenthion and quinothion; benzothiopyran organothiophosphate insecticides such as dithicrofos and thicrofos; benzotriazine organothiophosphate insecticides such as azinphos-ethyl and azinphos-methyl; isoindole organothiophosphate insecticides such as dialifos and phosmet; isoxazole organothiophosphate insecticides such as isoxathion and zolaprofos; pyrazolopyrimidine organothiophosphate insecticides such as chlorprazophos and pyrazophos; pyridine organothiophosphate insecticides such as chlorpyrifos and chlorpyrifos-methyl; pyrimidine organothiophosphate insecticides such as butathiofos, diazinon, etrimfos, lirimfos, pirimiphos-ethyl, pirimiphos-methyl, primidophos, pyrimitate and tebupirimfos; quinoxaline organothiophosphate insecticides such as quinalphos and quinalphos-methyl; thiadiazole organothiophosphate insecticides such as athidathion, lythidathion, methidathion and prothidathion; triazole organothiophosphate insecticides such as isazofos and triazophos; phenyl organothiophosphate insecticides such as azothoate, bromophos, bromophos-ethyl, carbophenothion, chlorthiophos, cyanophos, cythioate, dicapthon, dichlofenthion, etaphos, famphur, fenchlorphos, fenitrothion fensulfothion, fenthion, fenthion-ethyl, heterophos, jodfenphos, mesulfenfos, parathion, parathion-methyl, phenkapton, phosnichlor, profenofos, prothiofos, sulprofos, temephos, trichlormetaphos-3 and trifenofos; phosphonate insecticides such as butonate and trichlorfon; phosphonothioate insecticides such as mecarphon; phenyl ethylphosphonothioate insecticides such as fonofos and trichloronat; phenyl phenylphosphonothioate insecticides such as cyanofenphos, EPN and leptophos; phosphoramidate insecticides such as crufomate, fenamiphos, fosthietan, mephosfolan, phosfolan and pirimetaphos; phosphoramidothioate insecticides such as acephate, isocarbophos, isofenphos, methamidophos and propetamphos; phosphorodiamide insecticides such as dimefox, mazidox, mipafox and schradan; oxadiazine insecticides such as indoxacarb; phthalimide insecticides such as dialifos, phosmet and tetramethrin; pyrazole insecticides such as acetoprole, ethiprole, fipronil, pyrafluprole, pyriprole, tebufenpyrad, tolfenpyrad and vaniliprole; pyrethroid ester insecticides such as acrinathrin, allethrin, bioallethrin, barthrin, bifenthrin, bioethanomethrin, cyclethrin, cycloprothrin, cyfluthrin, beta-cyfluthrin, cyhalothrin, gamma-cyhalothrin, lambda-cyhalothrin, cypermethrin, alpha- cypermethrin, beta-cypermethrin, theta-cypermethrin, zeta-cypermethrin, cyphenothrin, deltamethrin, dimefluthrin, dimethrin, empenthrin, fenfluthrin, fenpirithrin, fenpropathrin, fenvalerate, esfenvalerate, flucythrinate, fluvalinate, tau-fluvalinate, furethrin, imiprothrin, metofluthrin, permethrin, biopermethrin, transpermethrin, phenothrin, prallethrin, profluthrin, pyresmethrin, resmethrin, bioresmethrin, cismethrin, tefluthrin, terallethrin, tetramethrin, tralomethrin and transfluthrin; pyrethroid ether insecticides such as etofenprox, flufenprox, halfenprox, protrifenbute and silafluofen; pyrimidinamine insecticides such as flufenerim and pyrimidifen; pyrrole insecticides such as chlorfenapyr; tetronic acid insecticides such as spirodiclofen, spiromesifen and spirotetramat; thiourea insecticides such as diafenthiuron; urea insecticides such as flucofuron and sulcofuron; and unclassified insecticides such as AKD-3088, closantel, crotamiton, cyflumetofen, E2Y45, EXD, fenazaflor, fenazaquin, fenoxacrim, fenpyroximate, FKI-1033, flubendiamide, HGW86, hydramethylnon, IKI-2002, isoprothiolane, malonoben, metaflumizone, metoxadiazone, nifluridide, NNI-9850, NNI-0101, pymetrozine, pyridaben, pyridalyl, Qcide, rafoxanide, rynaxypyr, SYJ-159, triarathene and triazamate. Biological: Chemical: avermectin nematicides, such as abamectin; carbamate nematicides, such as, aldicarb, thiadicarb, carbofuran, carbosulfan, oxamyl, aldoxycarb, ethoprop, methomyl, benomyl, alanycarb; and organophosphorus nematicides, such as, fenamiphos, fensulfothion, terbufos, fosthiazate, dimethoate, phosphocarb, dichlofenthion, isamidofos, fosthietan, isazofos ethoprophos, cadusafos, terbufos, chlorpyrifos, dichlofenthion, heterophos, isamidofos, mecarphon, phorate, thionazin, triazophos, diamidafos, fosthietan and phosphamidon (WO 2012/140212 A2) Nematophagous fungi useful herein include, but are not limited to, Arthrobotrys spp., for example, example, spp., for example, example, spp., for example, Pochonia spp., for example, Nematophagous bacteria useful herein include, but are not limited to, obligate parasitic bacteria, opportunistic parasitic bacteria, rhizobacteria, parasporal Cry protein-forming bacteria, endophytic bacteria and symbiotic bacteria. In particular embodiments, the biocontrol agent can be a bacteria species selected from Actinomycetes spp., Agrobacterium spp., Allorhizobium spp., Arthrobacter spp., Alcaligenes spp., Aureobacterium spp., Azobacter spp., Azorhizobium spp., Azospirillium spp., Beijerinckia spp., Bradyrhizobium spp., Burkholderia spp., Chromobacterium spp., Clavibacter spp., Clostridium spp., Comomonas spp., Corynebacterium spp., Curtobacterium spp., Desulforibtio spp., Enterobacter spp., Flavobacterium spp., Gluconobacter spp., Hydrogenophage spp., Klebsiella spp., Methylobacterium spp., Phyllobacterium spp., Phingobacterium spp., Photorhabdus spp., Rhizobium spp., Serratia spp., Stenotrotrophomonas spp., Xenorhadbus spp. Variovorax spp., Pasteuria spp., Pseudomonas spp., and Paenibacillus spp.