The invention relates to polypeptides having the biological activity of latrotoxin receptors, and to nucleic acids encoding these polypeptides, and in particular to their use for finding active compounds for crop protection.
1. Polypeptide having the biological activity of a latrotoxin receptor and comprising an amino acid sequence which has at least 70% identity with a sequence of SEQ ID NO: 2 or SEQ ID NO: 4. 2. Polypeptide according to 3. Nucleic acid comprising a nucleotide sequence which encodes a polypeptide according to 4. Nucleic acid according to 5. Nucleic acid according to 6. Nucleic acid according to 7. Nucleic acid according to 8. DNA construct comprising a nucleic acid according to any of 9. Vector comprising a nucleic acid according to any of 10. Vector according to 11. Host cell containing a nucleic acid according to any of 12. Host cell according to 13. Host cell according to 14. Antibody which binds specifically to a polypeptide according to 15. Transgenic invertebrate containing a nucleic acid according to any of 16. Transgenic invertebrate according to 17. Transgenic progeny of an invertebrate according to 18. Method of producing a polypeptide according to (a) culturing of a host cell according to any of (b) expressing a nucleic acid according to any of (c) obtaining the polypeptide from the cell, the culture medium or the in vitro system. 19. Method of producing a nucleic acid according to any of (a) full chemical synthesis in a manner known per se, or (b) chemical synthesis of oligonucleotides, labelling of the oligo-nucleotides, hybridizing the oligonucleotides to DNA of a genomic library or cDNA library generated from insect genomic DNA or insect mRNA, respectively, selecting positive clones and isolating the hybridizing DNA from positive clones, or (c) chemical synthesis of oligonucleotides and amplification of the target DNA by means of PCR. 20. Method of producing a transgenic invertebrate according to 21. Method of finding novel active compounds for crop protection, in particular compounds which alter the properties of polypeptides according to (a) providing a host cell according to any of (b) culturing the host cell in the presence of a chemical compound or a mixture of chemical compounds, and (c) detecting altered properties. 22. Method of finding a chemical compound which binds to a polypeptide according to (a) bringing a polypeptide according to (b) determining the chemical compound which binds specifically to the polypeptide. 23. Method of finding a chemical compound which alters the expression of a polypeptide according to (a) bringing a host cell according to any of (b) determining the concentration of the polypeptide according to (c) determining the chemical compound which specifically affects the expression of the polypeptide. 24. Use of a polypeptide according to 25. Use of a modulator of a polypeptide according to
[0001] The invention relates to polypeptides having the biological activity of latrotoxin receptors and to nucleic acids encoding these polypeptides and, in particular, to their use for finding active compounds for crop protection. [0002] The poison of the black widow (Latrodectus mactans tredecimguttatus) contains a number of highly potent neurotoxins (Longenecker et al., 1970; Cull-Candy et al., 1973; Dulubova et al., 1996). The toxin from this group which has been studied most thoroughly is alpha-latrotoxin, which causes a massive neurotransmitter release at the nerve endings both in vertebrates and invertebrates (review in Rosenthal and Meldolesi, 1989). In insects, this leads to a rapid paralysis of the animal (Cull-Candy et al., 1973). [0003] Latrotoxin develops its action by two mechanisms which differ in principle (review in Henkel and Sankaranarayanan, 1999), a calcium-dependent and a calcium-independent mechanism. The calcium-independent mechanism requires a receptor in the membrane of the target cell. This receptor is either neurexin or latrophilin (review in Henkel and Sankaranarayanan, 1999). Latrophilin belongs to the class of the G-protein-coupled receptors. These receptors usually bind to intracellular signal proteins, the G-proteins. Activation of such a receptor by binding of an agonist on the outside of the cell leads to activation of one of these intracellular G-proteins, resulting in an activation of specific signal cascades within the cell. In the case of latrophilin in neurons, this then leads to a spontaneous neurotransmitter release (review in Henkel and Sankaranarayanan, 1999). [0004] Latrophilic exists in the form of different homologous proteins which can be formed by alternative splicing. Different homologous latrophilins can be expressed differently in different organs and tissues (Matsushita et al., 1999). [0005] To develop novel insecticides using latrophilin, two approaches can be pursued. Firstly, it is possible to search for agonists of latrophilin, i.e. for compounds which activate intracellular G-proteins following binding to latrophilin. Secondly, it is possible to search, in the presence of latrotoxin, for inhibitors of latrophilin activation. [0006] The present invention is therefore based in particular on the object of providing insect receptors to which alpha-latrotoxin can bind, and assay systems based thereon with a high throughput of test compounds (High Throughput Screening Assays; HTS Assays). [0007] The object is achieved by providing polypeptides having at least one biological activity of a latrotoxin receptor (latrophilin) and comprising an amino acid sequence having at least 70% identity, preferably at least 80% identity, particularly preferably at least 90% identity, very particularly preferably at least 95% identity, with a sequence of SEQ ID NO: 2 or SEQ ID NO: 4 over a length of at least 20, preferably at least 25, particularly preferably at least 30 consecutive amino acids, and very particularly preferably over their full length. [0008] The degree of identity of the amino acid sequences is preferably determined using the program GAP from the program package GCG, Version 9.1, with standard settings (Devereux et al., 1984). [0009] The term “polypeptides” as used in the present context not only relates to short amino acid chains which are usually referred to as peptides, oligopeptides or oligomers, but also to longer amino acid chains which are usually referred to as proteins. It encompasses amino acid chains which can be modified either by natural processes, such as post-translational processing, or by chemical prior-art methods. Such modifications may occur at various sites and repeatedly in a polypeptide, such as, for example, on the peptide backbone, on the amino acid side chain, on the amino and/or the carboxyl terminus. For example, they encompass acetylations, acylations, ADP-ribosylations, amidations, covalent linkages to flavins, haem-moieties, nucleotides or nucleotide derivatives, lipids or lipid derivatives or phosphatidy-linositol, cyclizations, disulphide bridge formations, demethylations, cystine formations, formylations, gamma-carboxylations, glycosylations, hydroxylations, iodinations, methylations, myristoylations, oxidations, proteolytic processings, phosphorylations, selenoylations and tRNA-mediated amino acid additions. [0010] The polypeptides according to the invention may exist in the form of “mature” proteins or parts of larger proteins, for example as fusion proteins. They can furthermore exhibit secretion or leader sequences, pro-sequences, sequences which allow simple purification, such as multiple histidine residues, or additional stabilizing amino acids. [0011] The polypeptides according to the invention need not constitute complete receptors, but may also be fragments thereof, as long as they still have at least one biological activity of the complete receptors. Polypeptides which, compared to receptors consisting of the polypeptides according to the invention having an amino acid sequence of SEQ ID NO: 2 or SEQ ID/NO: 4 have an activity which is increased or reduced by 50%, are still considered to be in accordance with the invention. The polypeptides according to the invention need not be deducible from Drosophila melanogaster receptors. Polypeptides which are also considered as being in accordance with the invention are those which correspond to receptors of, for example, the following invertebrates, or fragments thereof which can still exert the biological activity of these receptors: insects, nematodes, arthropods, molluscs. [0012] In comparison to the corresponding region of naturally occurring receptors, the polypeptides according to the invention can have deletions or amino acid substitutions, as long as they still exert at least one biological activity of the complete receptors. Conservative substitutions are preferred. Such conservative substitutions comprise variations in which one amino acid is replaced by another amino acid from the following group: [0013] 1. small aliphatic residues, non-polar or of little polarity: Ala, Ser, Thr, Pro and Gly; [0014] 2. polar negatively charged residues and their amides: Asp, Asn, Glu and Gln; [0015] 3. polar positively charged residues: His, Arg and Lys; [0016] 4. large aliphatic non-polar residues: Met, Leu, Ile, Val and Cys; and [0017] 5. aromatic residues: Phe, Tyr and Trp. [0018] Preferred conservative substitutions are shown in the list below:
[0019] The term “biological activity of a latrotoxin receptor” as used in the present context means binding of latrotoxin to the receptor. [0020] A preferred embodiment of the polypeptides according to the invention is a Drosophila melanogaster receptor which has the amino acid sequence of SEQ ID NO: 2, or SEQ ID NO: 4. [0021] The present invention also provides nucleic acids which encode the polypeptides according to the invention. [0022] The nucleic acids according to the invention are, in particular, single-stranded or double-stranded deoxyribonucleic acids (DNA) or ribonucleic acids (RNA). Preferred embodiments are fragments of genomic DNA which may contain introns, and cDNAs. [0023] A preferred embodiment of the nucleic acids according to the invention is a cDNAs having the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3. [0024] Nucleic acids which hybridize under stringent conditions with the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 are likewise included in the present invention. [0025] The term “to hybridize” as used in the present context describes the process during which a single-stranded nucleic acid molecule undergoes base pairing with a complementary strand. Starting from the sequence information disclosed herein, this allows, for example, DNA fragments to be isolated from insects other than Drosophila melanogaster which encode polypeptides with the biological activity of receptors. [0026] Preferred hybridization conditions are given below: [0027] Hybridization solution: 6X SSC/0% formamide, preferred hybridization solution: 6X SSC/25% formamide. [0028] Hybridization temperature: 34° C., preferred hybridization temperature: 42° C. [0029] Wash step 1: 2X SSC at 40° C., [0030] Wash step 2: 2X SSC at 45° C.; preferred wash step 2: 0.6X SSC at 55° C.; particularly preferred wash step 2: 0.3X SSC at 65° C. [0031] The present invention furthermore encompasses nucleic acids which have at least 70% identity, preferably at least 80% identity, particularly preferably at least 90% identity, very particularly preferably at least 95% identity, with the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 over a length of at least 20, preferably at least 25, particularly preferably at least 30, consecutive nucleotides, and very particularly preferably over their full length. [0032] The degree of identity of the nucleic acid sequences is preferably determined with the aid of the program GAP from the program package GCG, Version 9.1, using standard settings. [0033] The present invention furthermore provides DNA constructs which comprise a nucleic acid according to the invention and a heterologous promoter. [0034] The term “heterologous promoter” as used in the present context refers to a promoter which has properties which differ from the properties of the promoter which controls the expression of the gene in question in the original organism. The term “promoter” as used in the present context generally refers to expression control sequences. [0035] The choice of heterologous promoters depends on whether pro- or eukaryotic cells or cell-free systems are used for expression. Examples of heterologous promoters are the early or late promoter of SV40, of the adenovirus or of the cytomegalovirus, the lac system, the trp system, the main operator and promoter regions of the lambda phage, the fd coat protein control regions, the 3-phosphoglycerate kinase promoter, the acid phosphatase promoter and the yeast α-mating factor promoter. [0036] The invention furthermore provides vectors which contain a nucleic acid according to the invention or a DNA construct according to the invention. All plasmids, phasmids, cosmids, YACs or synthetic chromosomes used in molecular biology laboratories can be used as vectors. [0037] The present invention also provides host cells comprising a nucleic acid according to the invention, a DNA construct according to the invention or a vector according to the invention. [0038] The term “host cell” as used in the present context refers to cells which do not naturally comprise the nucleic acids according to the invention. [0039] Suitable host cells are both prokaryotic cells, such as bacteria from the genera Bacillus, Pseudomonas, Streptomyces, Streptococcus, Staphylococcus, preferably [0040] The invention furthermore provides antibodies which bind specifically to the above-mentioned polypeptides or receptors. Such antibodies are produced in the customary manner. For example, such antibodies may be produced by injecting a substantially immunocompetent host with such an amount of a polypeptide according to the invention or a fragment thereof which is effective for antibody production, and subsequently obtaining this antibody. Furthermore, an immortalized cell line which produces monoclonal antibodies may be obtained in a manner known per se. If appropriate, the antibodies may be labelled with a detection reagent. Preferred examples of such a detection reagent are enzymes, radiolabelled elements, fluorescent chemicals or biotin. Instead of the complete antibody, it is also possible to employ fragments which have the desired specific binding properties. The term “antibodies” as used in the present context therefore also extends to parts of complete antibodies, such as Fa, F(ab′)2or Fv fragments, which are still capable of binding to the epitopes of the polypeptides according to the invention. [0041] The nucleic acids according to the invention can be used, in particular, for generating transgenic invertebrates. These may be employed in assay systems which are based on an expression, of the polypeptides according to the invention, which deviates from the wild type. Based on the information disclosed herein, it is furthermore possible to generate transgenic invertebrates where expression of the polypeptides according to the invention is altered owing to the modification of other genes or promoters. [0042] The transgenic invertebrates are generated, for example, in the case of Drosophila melanogaster, by P-element-mediated gene transfer (Hay et al., 1997) or, in Caenorhabditis elegans, by transposon-mediated gene transfer (for example by Tcl; Plasterk, 1996). [0043] The invention therefore also provides transgenic invertebrates which contain at least one of the nucleic acids according to the invention, preferably transgenic invertebrates of the species Drosophila melanogaster or Caenorhabditis elegans, and their transgenic progeny. The transgenic invertebrates preferably contain the polypeptides according to the invention in a form which deviates from the wild type. [0044] The present invention furthermore provides methods of producing the polypeptides according to the invention. To produce the polypeptides encoded by the nucleic acids according to the invention, host cells which contain one of the nucleic acids according to the invention can be cultured under suitable conditions, where the nucleic acid to be expressed may be adapted to the codon usage of the host cells. Thereupon, the desired polypeptides can be isolated from the cells or the culture medium in a customary manner. The polypeptides may also be produced in in vitro systems. [0045] A rapid method of isolating the polypeptides according to the invention which are synthesized by host cells using a nucleic acid according to the invention starts with the expression of a fusion protein, it being possible for the fusion partner to be affinity-purified in a simple manner. For example, the fusion partner may be glutathione S-transferase. The fusion protein can then be purified on a glutathione affinity column. The fusion partner can then be removed by partial proteolytic cleavage, for example at linkers between the fusion partner and the polypeptide according to the invention to be purified. The linker can be designed such that it includes target amino acids, such as arginine and lysine residues, which define sites for trypsin cleavage. To generate such linkers, standard cloning methods using oligonucleotides may be employed. [0046] Other purification methods which are possible are based on preparative electro-phoresis, FPLC, HPLC (for example using gel filtration, reversed-phase or moderately hydrophobic columns), gel filtration, differential precipitation, ion-exchange chromatography and affinity chromatography. [0047] Since the receptors constitute membrane proteins, the purification methods preferably involve detergent extractions, for example using detergents which have no, or little, effect on the secondary and tertiary structures of the polypeptides, such as nonionic detergents. [0048] The purification of the polypeptides according to the invention can encompass the isolation of membranes, starting from host cells which express the nucleic acids according to the invention. Such cells preferably express the polypeptides according to the invention in a sufficiently high copy number, so that the polypeptide quantity in a membrane fraction is at least 10 times higher than that in comparable membranes of cells which naturally express the receptors; particularly preferably, the quantity is at least 100 times, very particularly preferably at least 1000 times, higher. The terms “isolation or purification” as used in the present context mean that the polypeptides according to the invention are separated from other proteins or other macromolecules of the cell or of the tissue. The protein content of a composition containing the polypeptides according to the invention is preferably at least 10 times, particularly preferably at least 100 times, higher than in a host cell preparation. [0049] The polypeptides according to the invention may also be affinity-purified without a fusion partner with the aid of antibodies which bind to the polypeptides. [0050] The present invention furthermore provides methods for producing the nucleic acids according to the invention. The nucleic acids according to the invention can be produced in a customary manner. For example, all of the nucleic acid molecules can be synthesized chemically, or else only short sections of the sequences according to the invention can be synthesized chemically, and such oligonucleotides can be radiolabelled or labelled with a fluorescent dye. The labelled oligonucleotides can be used for screening cDNA libraries generated starting from insect MRNA or for screening genomic libraries generated starting from insect genomic DNA. Clones which hybridize with the labelled oligonucleotides are chosen for isolating the DNA in question. After characterization of the isolated DNA, the nucleic acids according to the invention are obtained in a simple manner. [0051] Alternatively, the nucleic acids according to the invention can also be produced by means of PCR methods using chemically synthesized oligonucleotides. [0052] The term “oligonucleotide(s)” as used in the present context denotes DNA molecules composed of 10 to 50 nucleotides, preferably 15 to 30 nucleotides. They are synthesized chemically and can be used as probes. [0053] The nucleic acids or polypeptides according to the invention allow novel active compounds for crop protection and/or pharmaceutically active compounds for the treatment of humans and animals to be identified, such as chemical compounds which, being modulators, in particular agonists or antagonists, alter the properties of the receptors according to the invention. To this end, a recombinant DNA molecule comprising at least one nucleic acid according to the invention is introduced into a suitable host cell. The host cell is grown in the presence of a compound or a probe comprising a variety of compounds under conditions which allow expression of the receptors according to the invention. A change in the receptor properties can be detected, for example, as described below in Example 2. This allows, for example, insecticidal substances to be found. [0054] Receptors alter the concentration of intracellular cAMP via interaction with G-proteins, preferably after previously having been activated. Thus, changes in the receptor properties by chemical compounds can be measured after heterologous expression, for example by measuring the intracellular cAMP concentrations directly via ELISA assay systems (Biomol, Hamburg, Germany) or RIA assay systems (NEN, Schwalbach, Germany) in HTS format. An indirect measurement of the cAMP concentration is possible with the aid of reporter genes (for example luciferase), whose expression depends on the cAMP concentration (Stratowa et al., 1995). The coexpression of receptors with specific G-proteins, for example Gα15, Gα16 or else chimeric G-proteins, in heterologous systems and measuring the increase in calcium, for example using fluorescent dyes or equorin, is an alternative possibility of carrying out the screening (Stables et al., 1997, Conklin et al., 1993). [0055] Furthermore, the binding of GTP to the activated G-protein can be used as a read-out system for assaying substances. Also, binding experiments with labelled peptides can be employed for screening. [0056] The term “agonist” as used in the present context refers to a molecule which activates the receptor. [0057] The term “antagonist” as used in the present context refers to a molecule which displaces an agonist from its binding site. [0058] The term “modulator” as used in the present context constitutes the generic term for agonist and antagonist. Modulators can be small organochemical molecules, peptides or antibodies which bind to the polypeptides according to the invention. Other modulators may be small organochemical molecules, peptides or antibodies which bind to a molecule which, in turn, binds to the polypeptides according to the invention, thus affecting their biological activity. Modulators may constitute mimetics or natural substances and ligands. [0059] The modulators are preferably small organochemical compounds. [0060] The binding of the modulators to the polypeptides according to the invention can alter the cellular processes in a manner which leads to the death of the insects treated therewith. [0061] The present invention therefore also extends to the use of modulators of the polypeptides according to the invention as insecticides or pharmaceuticals. [0062] The nucleic acids or polypeptides according to the invention also allow compounds to be found which bind to the receptors according to the invention. Again, these can be used as insecticides on plants or as pharmaceutically active compounds for the treatment of humans and animals. For example, host cells which contain the nucleic acids according to the invention and which express the corresponding receptors or polypeptides, or the gene products themselves, are brought into contact with a compound or a mixture of compounds under conditions which permit the interaction of at least compound with the host cells, the receptors or the individual polypeptides. [0063] Using host cells or transgenic invertebrates which contain the nucleic acids according to the invention, it is also possible to find substances which alter receptor expression. [0064] The above-described nucleic acids according to the invention, vectors and regulatory regions can furthermore be used for finding genes which encode polypeptides which participate in the synthesis, in insects, of functionally similar receptors. Functionally similar receptors are to be understood as meaning in accordance with the present invention receptors which comprise polypeptides which, while differing from the amino acid sequence of the polypeptides described herein, essentially have the same functions. [0065] SEQ ID NO: 1 and SEQ ID NO: 3 show the nucleotide and amino acid sequences of the isolated receptor cDNAs. SEQ ID NO: 2 and SEQ ID NO: 4 furthermore show the amino acid sequences of the proteins deduced from the receptor cDNA sequences. [0066] SEQ ID NO: 5 shows the sequence of the primer 1 [0067] SEQ ID NO: 6 shows the sequence of the primer 1 [0068] Isolation of the Above-Described Polynucleotides [0069] Polynucleotides were manipulated by standard methods of recombinant DNA technology (Sambrook et al., 1989). Nucleotide and protein sequences were bioinformatically processed using the program package GCG Version 9.1 (GCG Genetics Computer Group, Inc., Madison Wis., USA). [0070] Isolation of poly-A-containing RNA from Drosophila tissue and construction of the cDNA libraries. [0071] The RNA for the cDNA library I was isolated from whole Drosophila melanogaster embryos and larvae (RNAzol, Life Technologies, Karlsruhe, Germany, following the instructions of the manufacturer). From this RNA, the poly-A-containing RNAs were then isolated by purification using Dyna Beads 280 (Dynal, Hamburg, Germany). 5 μg of these poly-A-containing RNAs were then employed for constructing the cDNA library using the λ-ZAP-CMV vector (cDNA Synthesis Kit, ZAP-cDNA Synthesis Kit and ZAP-cDNA Gigapack III Gold Cloning Kit, all from Stratagene-Europe, Amsterdam, the Netherlands). [0072] Generation of Plasmid Pools [0073] Following the instructions of the manufacturer, the cDNA library in Lambda-pCMV was subjected to mass in-vivo-excision to generate a phagemide library. 10×96 minipreparation cultures were then sown, each preparation calculated to contain 1000 clones. The DNA was then purified using the Qiawell Ultra DNA preparation system from Qiagen (Hilden, Germany) and deposited in 96-well microtitre plates. In this way, the library was represented in the form of 960 pools of 1000 cDNA clones each. [0074] PCR with library pools. [0075] Each microtitre plate was copied to a meta pool which represented the entire plate. In each case 0.5 μl of this meta pool was used for a PCR with the following oligodeoxynucleotide primers:
[0076] The PCR parameters were as follows: 94° C., 1 min; 35 times (94° C., 30 s; 55° C., 30 s; 72° C., 45 s). The PCRs were carried out on a Biometra Uno II (Biometra, Göttingen, Germany). [0077] Library pools which were positive in the PCR were transformed in X1-1 Blue (Stratagene, Amsterdam, the Netherlands) and subjected to a colony lift (Sambrook et al., 1989). The probe used for the hybridization was a PCR product of the reaction with the respective primer pair (hybridization and detection by means of BrightStar, psoralene-biotin kit, Ambion, Austin, Tex., USA), labelled using psoralene-biotin (BrightStar, psoralene-biotin kit, Ambion, Austin, Tex., USA). Positive colonies were selected and grown, and the DNA was isolated by plasmid preparation (Qiagen, Hilden, Germany). [0078] For identification, the isolated gene library plasmids were subjected to incipient sequencing (ABI Prism Dye Terminator Cycle Sequencing Kit, ABI, using the ABI prism 310 genetic analyser, ABI-Deutschland, Weiterstadt, Germany) using T3 and T7 primers. The complete polynucleotide sequences of the DB3 were determined by primer walking by means of the Cycle Sequencing ABI Prism Dye Terminator Cycle Sequencing Kit, ABI, using an ABI prism 310 genetic analyser (ABI-Deutschland, Weiterstadt, Germany). [0079] The sequences of SEQ ID NO: 2 and SEQ ID NO: 4 were designed by blast analysis (Blastp; Altschul et al., 1997). What is shown is in each case the best hit from the blast analysis (non-reducing protein database: Genbank CDS translations+PDB+Swissprot+PIR database of Mar. 4, 2000). The E-value parameter is a measure for the non-randomness of the assignment. With sufficient reliability, the sequence was identified as latrotoxin receptor. [0080] Sequence comparison and assignment of the sequences
[0081] Heterologous Expression [0082] The receptor according to the invention from insects can be expressed functionally in xenopus ooctyes. To this end, G-protein-activatable potassium channels (GIRK1 and GIRK4) are coexpressed in order to measure activation of the receptors (White et al., 1998). The nucleic acid according to the invention is used directly for the expression experiments, since it is already in an expression vector with CMV promoter. [0083] Ooeyte Measurements [0084] 1. Oocyte preparation [0085] The oocytes are obtained from an adult female [0086] 2. Injecting the oocytes [0087] Injection electrodes of diameter 10-15 μm are prepared using a pipette-drawing device (type L/M-3P-A, list-electronic, Darmnstadt-Eberstadt, Germany). Prior to injection, aliquots with the receptor DNA or GIRK1/4-DNA are defrosted and diluted with water to a final concentration of 10 ng/μl. The DNA samples are centrifuged for 120 s at 3 200 g (type Biofuge 13, Heraeus Instruments GmbH, Hanau, Germany). An extended PE tube is subsequently used as transfer tube to fill the pipettes from the rear end. The injection electrodes are attached to an X,Y,Z positioning system (treatment centre EP1090, isel-automation, Eiterfeld, Germany). With the aid of a Macintosh Computer, the oocytes in the microtitre plate wells are approached, and approximately 50 nl of the DNA solution are injected into the oocytes by briefly applying a pressure (0.5-3.0 bar, 3-6 s). [0088] 3. Electrophysiological measurements [0089] A two-electrode voltage clamp equipped with a TURBO TEC-IOCD (npi electronic GmbH, Tamm, Germany) amplifier is used to carry out the electrophysiological measurements. The micropipettes required for this purpose are drawn in two movements from aluminium silicate glass (capillary tube, Art. No. 14 630 29, 1=100 mm, Øext=1.60 mm, Øint=1.22 mm, Hilgenberg GmbH, Malsfeld, Germany) (Hamill et al., 1981). Current and voltage electrodes have a diameter of 1-3 μm and are filled with 1.5 M KCl and 1.5 M potassium acetate. The pipettes have a capacitance of 0.2-0.5 MW. To carry out the electrophysiological measurements, the oocytes are transferred into a small chamber which is flushed continuously with normal Rimland solution (in mM: KCl 90, MgCl23, HEPES 5, pH 7.2). To apply a substance, the perfusion solution is exchanged for a substance solution of the same composition and additionally the desired substance concentration. The successful expression of the receptor DNA is checked after one week at a clamp potential of −60 mV. Unresponsive oocytes are discarded. All the others are used for substance testing. The data are documented by means of a YT plotter (YT plotter, model BD 111, Kipp & Zonen Delft BV, AM Delft, the Netherlands). When test substances are assayed in concentration series, these measurements are carried out on at least two different oocytes and at at least five different concentrations. The substances are assayed directly without preincubation in the presence of glutamate (gamma-amino-N-butyric acid, A2129, SIGMA-ALDRICH CHEMIE GmbH, Deisenhofen, Germany) for their antagonists. The individual data are entered in Origin (evaluation software Microcal Origin, Microcal Software, Inc., Northampton, MA 01060-4410 USA [lacuna] (Additive GmbH, Friedrichsdorf/Ts, Germany). Means, standard deviation, IC50values and IC50curves are calculated using Origin. These measurements are carried out at least in duplicate. [0090] References [0091] Altschul et al. (1997), Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25, 3389-3402. [0092] Conklin et al. (1993), Substitution of three amino acids switches receptor specificity of Gq alpha to that of Gi alpha, Nature 363, 274-276 [0093] Cull-Candy et al. (1973), Nature 241, 353-354 [0094] Devereux et al. (1984), Nucleic Acids Research 12, 387 [0095] Dulubova et al. (1996), Cloning and structure of delta-lateroinsectotoxin, a novel insect-specific member of the latrotoxin family, J. Biol. Chem. 271 (13), 7535-7543 [0096] Dumont, J. N. (1972), Oogenesis in [0097] Hamill, O. P., Marty, A., Neher, E., Sakmann, B. Sigworth, F. J. (1981), Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches, Pfügers Arch. 391, 85-100 [0098] Hay et al. (1997), P element insertion-dependent gene activation in the Drosophila eye, Proceedings of The National Academy of Sciences of The United States of America 94 (10), 5195-5200 [0099] Henkel und Sankaranarayanan (1999), Mechanisms of alpha-latrotoxin action, Cell Tissue Res. 296, 229-233 [0100] Longenecker et al. (1970), Nature 225, 701-703 [0101] Matsushita et al. (1999), The latrophilin family: multiply spliced G protein-coupled receptors with differential tissue distribution, FEBS Letters 443, 348-342 [0102] Plasterk (1996), The Tc1/mariner transposon family, Transposable Elements/Current Topics in Microbiology and Immunology 204, 125-143 [0103] Rosenthal und Meldolesi (1989), alpha-Latrotoxin and related toxins, Parmacol. Ther. 42, 115-134 [0104] Sambrook et al. (1989), Molecular Cloning, A Laboratory Manual, 2nd ed. Cold Spring Harbor Press 0 [0105] Stables et al. (1997), A Bioluminescent Assay for Agonist Activity at Potentially Any G-protein coupled Receptor, Analytical Biochemistry 252, 115-126 [0106] Stratowa C. et al. (1995), Use of a luciferase reporter system for characterizing G-protein-linked receptors, Current Opinion in Biotechnology 6, 574-581 [0107] White J. H. et al. (1998), Heterodimerization is required for the formation of a functional GABA(B) receptor, Nature 396, 679-682
Ala Gly, Ser Arg Lys Asn Gln, His Asp Glu Cys Ser Gln Asn Glu Asp Gly Ala, Pro His Asn, Gln Ile Leu, Val Leu Ile, Val Lys Arg, Gln, Glu Met Leu, Tyr, Ile Phe Met, Leu, Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp,Phe Val Ile, Leu INFORMATION ON THE SEQUENCE LISTING AND THE FIGURES
EXAMPLES
Primer 1s: TCCATCGCCAACGATATGTC (SEQ ID NO: 5) Primer 1a: CGCTCCCTGATGATCGTATC (SEQ ID NO: 6) EXAMPLE 2
2 6e-65 AF111098/Latrophilin-1 (Bos taurus) 4 4e-45 AF111098/Latrophilin-1 (Bos taurus) EXAMPLE 3