The present invention provides a fibromodulin (FMOD) reprogrammed (FReP) cell and a method of making therefor, a culture medium therefor, and a supernatant thereof, and methods of making and using these.
1. A fibromodulin (FMOD) reprogrammed (FReP) cell, generated by a method comprising:
treating a human cell with a cell culture medium for a period ranging from a day to a month, and changing the cell culture medium regularly until the FReP cell forms; wherein the medium comprises fibromodulin (FMOD), the FReP cell expresses NANOG and does not form teratoma, and wherein the human cell is a fibroblast cell. 2. The FReP cell according to 3. The FReP cell according to 4. A composition comprising the FReP cell of 5. The composition of
This application claims priority to International Application No. PCT/US2012/061389, filed on Oct. 22, 2012, which in turn claims the benefit of U.S. Provisional Patent Application No. 61/550,348, filed Oct. 21, 2011, the teaching of which is incorporated herein by reference in its entirety. The present invention relates generally to method and composition for cell pluripotency reprogramming. Embryonic stem (ES) cells are pluripotent cells capable of both proliferation in a cell culture and differentiation towards a variety of lineage-restricted cell populations that exhibit multipotent properties (Odorico et al., Stem Cells 19: 193-204 (2001)). Because of these characteristics, ES cells, including human ES cells, can become very specific cell types that perform a variety of functions. Generally, human ES cells are highly homogeneous, have a capacity for self-renewal and have an ability to differentiate into any functional cell in the body. Self-renewal can, under appropriate conditions, lead to a long-term proliferating capability with a potential for unlimited expansion in cell culture. In addition, if human ES cells differentiate in an undirected fashion, a heterogeneous population of cells is obtained that express markers for a plurality of different tissue types (WO 01/51616; and Shamblott et al., Proc. Natl. Acad. Sci. USA 98: 113 (2001)). These features make human ES cells a unique, homogeneous, starting population for the production of cells having therapeutic utility. Human ES cells can be used to make a variety of differentiated cells types for scientific and commercial research use. At present, differentiated human cells of many types are not readily available and cannot be expanded in significant numbers in vitro culture. Human ES cells, however, can expand indefinitely in culture and can differentiate into many, if not all, the differentiated cell types of the human body. As such, culture techniques are being developed to induce human ES cells to differentiate into any number of specific cell types of the human body. The availability of human ES cells has opened the possibility that many differentiated human cells will become available in significant numbers for scientific and commercial research. One difficulty in working with human ES cells is the development of conditions for the standardized culture of human ES cells without the use of animal products or products such as serum, which tend to vary from batch to batch. As such, the art desires culture conditions of human ES cell culture to be as defined as possible. To work toward that desired goal, a set of culture conditions was recently described that permitted the long-term culture of undifferentiated human ES cells in defined conditions. Ludwig et al., Nat. Methods 3:637-646 (2006), incorporated herein by reference as if set forth in its entirety. Ludwig et al. described a medium, referred to herein as TeSR™ medium, for cultivation of human ES cells in which each constituent of the medium was fully disclosed and characterized. TeSR™ is therefore a fully defined and sufficient medium for human ES cell culture. TeSR™ has proven effective for use in the derivation of new human ES cell lines as well, which is an even more challenging constraint than the culture of undifferentiated human ES cells. Human ES cells preferentially remain undifferentiated when grown in environments in which the cells are in direct contact with other cells or with physical structures in their environment. In other cellular environments, human ES cells begin to differentiate and become incapable of indefinite proliferation. This is significant in the process of cloning an ES cell culture. As used herein, “cloning” means a process of initiating an ES cell culture from a starting culture, ideally, from a single ES cell or at least from very few ES cells. Culture conditions that permit clonal culture of undifferentiated ES cells may be the most demanding conditions of all of those required in normal ES cell culture and proliferation. In spite of the progress in effectively culturing ES cells, several significant disadvantages with these methods still exist. For example, exposure to animal pathogens through MEF-conditioned medium or matrigel matrix is still a possibility. The major obstacle of the use of human ES cells in human therapy is that the originally described methods to propagate human ES cells involve culturing the human ES cells on a layer of feeder cells of non-human origin, and in the presence of nutrient serum of non-human origin. More recently, extensive research into improving culture systems for human ES cells has concentrated on the ability to grow ES cells under serum free/feeder-free conditions. For example, to ensure a feeder-free environment for the growth of human ES cells, a substitute system based on medium supplemented with serum replacement (SR), transforming growth factor β1 (TGF-β1), leukemia inhibitory factor (LIF), fibroblast growth factor (FGF) and a fibronectin matrix has also been tried (Amit et al (2004), Biol. Reprod. 70(3):837-45). As another example, despite substantial progress, most pluripotency reprogramming still requires at least one genome-integrated transcription factor, increasing risks of genome instability and tumor formation. A further example is formation of teratoma in the existing pluripotency reprogramming methods or systems. Therefore, it is an objective of the present invention to provide a method of pluripotency reprogramming that reduces or minimizes the adverse effects associated with pluripotency reprogramming. It is a further objective of the present invention to provide a pluripotency reprogrammed cell using a method of pluripotency reprogramming that reduces or minimizes the adverse effects associated with pluripotency reprogramming. The embodiments below address the above identified issues and needs. In one aspect of the present invention, it is provided a cell culture medium composition comprising fibromodulin (FMOD) or a derivative or fragment thereof, wherein the composition is effective for reprogramming a cell to form a FMOD reprogrammed (FReP) cell, wherein the FReP cell expresses NANOG and does not form teratoma in vivo. In some embodiments of the cell culture medium, the FMOD has a concentration from about 200 nM to about 800 nM. In some embodiments of the cell culture medium, optionally in combination with any or all of the above various embodiments, the cell is a human cell, mouse cell, and rat cell. In some embodiments, the cell can be a BJ fibroblast or primary adult normal human dermal fibroblast (NHDF). In some embodiments of the cell culture medium, optionally in combination with any or all of the above various embodiments, reprogramming is without using a genome-integrated transcription factor. In another aspect of the present invention, it is provided a method of pluripotency reprogramming, comprising: treating a mammalian cell with a cell culture medium comprising fibromodulin (FMOD) or a derivative or fragment thereof for a period ranging from a day to a month, and changing the cell culture medium regularly until a FMOD reprogrammed pluripotent (FReP) cell forms; wherein the FReP cell expresses NANOG and does not form teratoma in vivo. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the FMOD has a concentration from about 200 nM to about 800 nM. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the cell is a human cell, mouse cell, and rat cell. Examples of human cells include, e.g., BJ, MRC-5, HDF, keratinocytes, melanocytes, peripheral blood cells (e.g., CD34+), cord blood cells or even certain stem cells (e.g., adipose-derived stem cells, perivascular stem cells, neural stem cells). In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the cell is a BJ fibroblast or primary adult normal human dermal fibroblast (NHDF). In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the method is carried out without using a genome-integrated transcription factor. In a further aspect of the present invention, it is provided a fibromodulin (FMOD) reprogrammed pluripotent (FReP) cell, which FReP cell is generated by a method comprising: treating a mammalian cell with a cell culture medium for a period ranging from a day to a month, and changing the cell culture medium regularly until the FReP cell forms; wherein the medium comprises fibromodulin (FMOD) or a derivative or fragment thereof, and wherein the FReP cell expresses NANOG and does not form teratoma in vivo. In some embodiments of the FReP cell, optionally in combination with any or all of the above various embodiments, the FMOD has a concentration from about 200 nM to about 800 nM. In some embodiments of the FReP cell, optionally in combination with any or all of the above various embodiments, the cell is a human cell, mouse cell, and rat cell. Examples of human cells include, e.g., BJ, MRC-5, NHDF, keratinocytes, melanocytes, peripheral blood cells (e.g., CD34+), cord blood cells or even certain stem cells (e.g., adipose-derived stem cells, perivascular stem cells, neural stem cells). In some embodiments of the FReP cell, optionally in combination with any or all of the above various embodiments, the mammalian cell is a BJ fibroblast or primary adult normal human dermal fibroblast (HDF). In another aspect of the present invention, it is provided a method of treating a disorder in a mammal, which method comprising administering to the mammal a FReP cell disclosed herein above and/or below. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the mammal is a human being. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the disorder is a neurodegenerative disorder. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the disorder is a central nervous system (CNS) disease, cardiovascular disease, blood diseases, Crohn's disease, bone disease, muscle disease, or chondrocyte disease. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the disorder is a retina disease, a trauma and injury to a tissue, a skeletal disorder, an organ disease or an injury to skin, muscle, cartilage, tendon, peripheral nerve, spinal cord, blood vessels, or bone. In a further aspect of the present invention, it is provided a supernatant, comprising a cell culture medium disclosed above or below. In some embodiments of the supernatant, the supernatant can be included in a composition. In some embodiments, such composition can be, for example, a pharmaceutical or cosmetic composition. In a further aspect of the present invention, it is provided a method of treating or ameliorate a disorder, comprising administering to a mammalian subject a supernatant or a composition disclosed above or below. In further aspect of the present invention, it is provided a method or inhibiting tumor growth, comprising adding FMOD directly to tumorigenic, or tumor cells to inhibit their growth. For example, one can administer to a subject in need thereof a composition comprising an effective amount of fibromodulin (FMOD) to a site having tumorigenic or tumor cells in the subject to cause the tumorigenic cells or tumor cells to stop growth or growing at a slower rate. In one aspect of the present invention, it is provided a cell culture medium composition comprising fibromodulin (FMOD) or a derivative or fragment thereof, wherein the composition is effective for reprogramming a cell to form a FMOD reprogrammed (FReP) cell, wherein the FReP cell expresses NANOG and does not form teratoma in vivo. In some embodiments of the cell culture medium, the FMOD has a concentration from about 200 nM to about 800 nM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 1 nM to about 1000 μM, e.g., from about 1 nM to about 10 nM, from about 1 nM to about 20 nM, from about 1 nM to about 50 nM, from about 1 nM to about 100 nM, from about 1 nM to about 200 nM, from about 1 nM to about 500 nM, from about 1 nM to about 1000 nM, from about 1 nM to about 2 μM, from about 1 nM to about 5 μM, from about 1 nM to about 10 μM, from about 1 nM to about 20 μM, from about 1 nM to about 50 μM, from about 1 nM to about 100 M, from about 1 nM to about 200 μM, or from about 1 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 10 nM to about 1000 μM, e.g., from about 10 nM to about 20 nM, from about 10 nM to about 50 nM, from about 10 nM to about 100 nM, from about 10 nM to about 200 nM, from about 10 nM to about 500 nM, from about 10 nM to about 1000 nM, from about 10 nM to about 2 μM, from about 10 nM to about 5 μM, from about 10 nM to about 10 M, from about 10 nM to about 20 μM, from about 10 nM to about 50 μM, from about 10 nM to about 100 μM, from about 10 nM to about 200 μM, or from about 10 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 20 nM to about 1000 μM, e.g., from about 20 nM to about 50 nM, from about 20 nM to about 100 nM, from about 20 nM to about 200 nM, from about 20 nM to about 500 nM, from about 20 nM to about 1000 nM, from about 20 nM to about 2 μM, from about 20 nM to about 5 μM, from about 20 nM to about 10 μM, from about 20 nM to about 20 μM, from about 20 nM to about 50 μM, from about 20 nM to about 100 μM, from about 20 nM to about 200 μM, or from about 20 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 50 nM to about 1000 μM, e.g., from about 50 nM to about 100 nM, from about 50 nM to about 200 nM, from about 50 nM to about 500 nM, from about 50 nM to about 1000 nM, from about 50 nM to about 2 μM, from about 50 nM to about 5 μM, from about 50 nM to about 10 μM, from about 50 nM to about 20 μM, from about 50 nM to about 50 μM, from about 50 nM to about 100 μM, from about 50 nM to about 200 μM, or from about 50 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 100 nM to about 1000 μM, e.g., from about 100 nM to about 200 nM, from about 100 nM to about 500 nM, from about 100 nM to about 1000 nM, from about 100 nM to about 2 μM, from about 100 nM to about 5 μM, from about 100 nM to about 10 μM, from about 100 nM to about 20 μM, from about 100 nM to about 50 μM, from about 100 nM to about 100 μM, from about 100 nM to about 200 μM, or from about 100 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 200 nM to about 1000 μM, e.g., from about 200 nM to about 500 nM, from about 200 nM to about 1000 nM, from about 200 nM to about 2 μM, from about 200 nM to about 5 M, from about 200 nM to about 10 μM, from about 200 nM to about 20 μM, from about 200 nM to about 50 μM, from about 200 nM to about 100 μM, from about 200 nM to about 200 μM, or from about 200 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 500 nM to about 1000 μM, e.g., from about 500 nM to about 1000 nM, from about 500 nM to about 2 μM, from about 500 nM to about 5 μM, from about 500 nM to about 10 μM, from about 500 nM to about 20 μM, from about 500 nM to about 50 μM, from about 500 nM to about 100 μM, from about 500 nM to about 200 μM, or from about 500 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 1000 nM to about 1000 μM, e.g., from about 1000 nM to about 2 μM, from about 1000 nM to about 5 μM, from about 1000 nM to about 10 μM, from about 1000 nM to about 20 μM, from about 1000 nM to about 50 μM, from about 1000 nM to about 100 μM, from about 1000 nM to about 200 μM, or from about 1000 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 2 μM to about 1000 μM, e.g., from about 2 μM to about 5 μM, from about 2 μM to about 10 μM, from about 2 μM to about 20 μM, from about 2 μM to about 50 μM, from about 2 μM to about 100 μM, from about 2 μM to about 200 μM, or from about 2 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 5 μM to about 1000 μM, e.g., from about 5 μM to about 10 μM, from about 5 μM to about 20 μM, from about 5 μM to about 50 μM, from about 5 μM to about 100 μM, from about 5 μM to about 200 μM, or from about 5 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 10 μM to about 1000 μM, e.g., from about 10 μM to about 20 μM, from about 10 μM to about 50 μM, from about 10 μM to about 100 μM, from about 10 μM to about 200 μM, or from about 10 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 20 μM to about 1000 μM, e.g., from about 20 μM to about 50 μM, from about 20 μM to about 100 μM, from about 20 μM to about 200 μM, or from about 20 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 50 μM to about 1000 μM, e.g., from about 50 μM to about 100 μM, from about 50 μM to about 200 μM, or from about 50 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 100 μM to about 1000 μM, e.g., from about 100 μM to about 200 μM, or from about 100 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 500 μM to about 1000 μM. Examples of the concentration of FMOD protein or peptide in the culture medium can be, e.g., about 10 nM, about 20 nM, about 50 nM, about 100 nM, about 200 nM (e.g., 220 nM), about 500 nM, about 1000 nM, about 2 μM, about 5 M, about 10 μM, about 20 μM, about 50 μM, about 100 μM, about 200 μM, or about 500 μM. In some embodiments of the cell culture medium, optionally in combination with any or all of the above various embodiments, the cell is a human cell, mouse cell, and rat cell. In some embodiments, the cell can be a BJ fibroblast or primary adult normal human dermal fibroblast (HDF). In some embodiments of the cell culture medium, optionally in combination with any or all of the above various embodiments, reprogramming is without using a genome-integrated transcription factor. In another aspect of the present invention, it is provided a method of pluripotency reprogramming, comprising: treating a mammalian cell with a cell culture medium comprising fibromodulin (FMOD) or a derivative or fragment thereof for a period ranging from a day to a month, and changing the cell culture medium regularly until a FMOD reprogrammed (FReP) cell forms; wherein the FReP cell expresses NANOG and does not form teratoma in vivo. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the FMOD has a concentration from about 200 nM to about 800 nM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 1 nM to about 1000 μM, e.g., from about 1 nM to about 10 nM, from about 1 nM to about 20 nM, from about 1 nM to about 50 nM, from about 1 nM to about 100 nM, from about 1 nM to about 200 nM, from about 1 nM to about 500 nM, from about 1 nM to about 1000 nM, from about 1 nM to about 2 μM, from about 1 nM to about 5 μM, from about 1 nM to about 10 μM, from about 1 nM to about 20 μM, from about 1 nM to about 50 μM, from about 1 nM to about 100 M, from about 1 nM to about 200 μM, or from about 1 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 10 nM to about 1000 μM, e.g., from about 10 nM to about 20 nM, from about 10 nM to about 50 nM, from about 10 nM to about 100 nM, from about 10 nM to about 200 nM, from about 10 nM to about 500 nM, from about 10 nM to about 1000 nM, from about 10 nM to about 2 μM, from about 10 nM to about 5 μM, from about 10 nM to about 10 μM, from about 10 nM to about 20 μM, from about 10 nM to about 50 μM, from about 10 nM to about 100 μM, from about 10 nM to about 200 μM, or from about 10 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 20 nM to about 1000 μM, e.g., from about 20 nM to about 50 nM, from about 20 nM to about 100 nM, from about 20 nM to about 200 nM, from about 20 nM to about 500 nM, from about 20 nM to about 1000 nM, from about 20 nM to about 2 μM, from about 20 nM to about 5 μM, from about 20 nM to about 10 μM, from about 20 nM to about 20 μM, from about 20 nM to about 50 μM, from about 20 nM to about 100 μM, from about 20 nM to about 200 μM, or from about 20 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 50 nM to about 1000 μM, e.g., from about 50 nM to about 100 nM, from about 50 nM to about 200 nM, from about 50 nM to about 500 nM, from about 50 nM to about 1000 nM, from about 50 nM to about 2 μM, from about 50 nM to about 5 μM, from about 50 nM to about 10 μM, from about 50 nM to about 20 μM, from about 50 nM to about 50 μM, from about 50 nM to about 100 μM, from about 50 nM to about 200 μM, or from about 50 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 100 nM to about 1000 μM, e.g., from about 100 nM to about 200 nM, from about 100 nM to about 500 nM, from about 100 nM to about 1000 nM, from about 100 nM to about 2 μM, from about 100 nM to about 5 μM, from about 100 nM to about 10 μM, from about 100 nM to about 20 μM, from about 100 nM to about 50 μM, from about 100 nM to about 100 μM, from about 100 nM to about 200 μM, or from about 100 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 200 nM to about 1000 μM, e.g., from about 200 nM to about 500 nM, from about 200 nM to about 1000 nM, from about 200 nM to about 2 μM, from about 200 nM to about 5 M, from about 200 nM to about 10 μM, from about 200 nM to about 20 μM, from about 200 nM to about 50 μM, from about 200 nM to about 100 μM, from about 200 nM to about 200 μM, or from about 200 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 500 nM to about 1000 μM, e.g., from about 500 nM to about 1000 nM, from about 500 nM to about 2 μM, from about 500 nM to about 5 μM, from about 500 nM to about 10 μM, from about 500 nM to about 20 μM, from about 500 nM to about 50 μM, from about 500 nM to about 100 μM, from about 500 nM to about 200 μM, or from about 500 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 1000 nM to about 1000 μM, e.g., from about 1000 nM to about 2 μM, from about 1000 nM to about 5 μM, from about 1000 nM to about 10 μM, from about 1000 nM to about 20 μM, from about 1000 nM to about 50 μM, from about 1000 nM to about 100 μM, from about 1000 nM to about 200 μM, or from about 1000 nM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 2 μM to about 1000 μM, e.g., from about 2 μM to about 5 μM, from about 2 μM to about 10 μM, from about 2 μM to about 20 μM, from about 2 μM to about 50 μM, from about 2 μM to about 100 μM, from about 2 μM to about 200 μM, or from about 2 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 5 μM to about 1000 μM, e.g., from about 5 μM to about 10 μM, from about 5 μM to about 20 μM, from about 5 μM to about 50 μM, from about 5 μM to about 100 μM, from about 5 μM to about 200 μM, or from about 5 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 10 μM to about 1000 μM, e.g., from about 10 μM to about 20 μM, from about 10 μM to about 50 μM, from about 10 μM to about 100 μM, from about 10 μM to about 200 μM, or from about 10 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 20 μM to about 1000 μM, e.g., from about 20 μM to about 50 μM, from about 20 μM to about 100 μM, from about 20 μM to about 200 μM, or from about 20 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 50 μM to about 1000 μM, e.g., from about 50 μM to about 100 μM, from about 50 μM to about 200 μM, or from about 50 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 100 μM to about 1000 μM, e.g., from about 100 μM to about 200 μM, or from about 100 μM to about 500 μM. In some embodiments, the culture medium can include a FMOD protein or peptide in a concentration from about 500 μM to about 1000 μM. Examples of the concentration of FMOD protein or peptide in the culture medium can be, e.g., about 10 nM, about 20 nM, about 50 nM, about 100 nM, about 200 nM (e.g., 220 nM), about 500 nM, about 1000 nM, about 2 μM, about 5 M, about 10 μM, about 20 μM, about 50 μM, about 100 μM, about 200 μM, or about 500 μM. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the cell is a human cell, mouse cell, and rat cell. Examples of human cells include, e.g., BJ, MRC-5, HDF, keratinocytes, melanocytes, peripheral blood cells (e.g., CD34+), cord blood cells or even certain stem cells (e.g., adipose-derived stem cells, perivascular stem cells, neural stem cells). In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the cell is a BJ fibroblast or primary adult normal human dermal fibroblast (NHDF). In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the method is carried out without using a genome-integrated transcription factor. In a further aspect of the present invention, it is provided a fibromodulin (FMOD) reprogrammed (FReP) cell, which FReP cell is generated by a method comprising: treating a mammalian cell with a cell culture medium for a period ranging from a day to a month, and changing the cell culture medium regularly until the FReP cell forms; wherein the medium comprises fibromodulin (FMOD) or a derivative or fragment thereof, and wherein the FReP cell expresses NANOG and does not form teratoma in vivo. In some embodiments of the FReP cell, optionally in combination with any or all of the above various embodiments, the FMOD has a concentration from about 200 nM to about 800 nM. In some embodiments of the FReP cell, optionally in combination with any or all of the above various embodiments, the cell is a human cell, mouse cell, and rat cell. Examples of human cells include, e.g., BJ, MRC-5, HDF, keratinocytes, melanocytes, peripheral blood cells (e.g., CD34+), cord blood cells or even certain stem cells (e.g., adipose-derived stem cells, perivascular stem cells, neural stem cells). In some embodiments of the FReP cell, optionally in combination with any or all of the above various embodiments, the mammalian cell is a BJ fibroblast or primary adult normal human dermal fibroblast (NHDF). In another aspect of the present invention, it is provided a method of treating a disorder in a mammal, which method comprising administering to the mammal a FReP cell disclosed herein above and/or below. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the mammal is a human being. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the disorder is a neurodegenerative disorder. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the disorder is a central nervous system (CNS) disease, cardiovascular disease, blood diseases, Crohn's disease, bone disease, muscle disease, or chondrocyte disease. In some embodiments of the method, optionally in combination with any or all of the above various embodiments, the disorder is a retina disease, a trauma and injury to a tissue, a skeletal disorder, an organ disease or an injury to skin, muscle, cartilage, tendon, peripheral nerve, spinal cord, blood vessels, or bone. In a further aspect of the present invention, it is provided a supernatant, comprising a cell culture medium disclosed above or below. In some embodiments of the supernatant, the supernatant can be included in a composition. In some embodiments, such composition can be, for example, a pharmaceutical or cosmetic composition. In a further aspect of the present invention, it is provided a method of treating or ameliorate a disorder, comprising administering to a mammalian subject a supernatant or a composition disclosed above or below. In further aspect of the present invention, it is provided a method or inhibiting tumor growth, comprising adding FMOD directly to tumorigenic, or tumor cells to inhibit their growth. For example, one can administer to a subject (e.g., a cancer patient) in need thereof a composition comprising an effective amount of fibromodulin (FMOD) to a site having tumorigenic or tumor cells in the subject to cause the tumorigenic cells or tumor cells to stop growth or growing at a slower rate. As used herein, the term effective amount shall mean an amount FMOD effective to stop or slow the growth of tumor cells in the subject using a dosage regime prescribed by a medical practitioner. As used herein, the term “grow at a slower rate” shall mean a rate of growth of the tumorigenic or tumor cells slower than their rate of growth without receiving a composition comprising FMOD described herein. In addition to the FMOD protein or peptide or a derivative or fragment thereof, the culture medium can be any cell culture medium commonly used in the art. For example, the culture medium generally includes saline. An example of cell culture medium includes, e.g., saline, a pH of 7.4 PBS, DMEM medium, or fibroblast basic medium (FBM, Lonza). In some embodiments, the culture medium can include additional components or agents, e.g., transforming growth factor (TGF)-β. As used herein, the term “sufficient time” shall mean a period sufficiently long to reprogram the mammalian cell by the culture medium disclosed herein. In some embodiments, the term “sufficient time” ranges from hours to about 180 days, e.g., from 8 hrs to about 12 hrs, from about 8 hrs to about 24 hrs, from about 8 hrs to about 2 days, from about 8 hrs to about 7 days, from about 8 hrs to about 14 days, from about 8 hrs to about 21 days, from about 8 hrs to about 30 days, from about 8 hrs to about 45 days, from about 8 hrs to about 60 days, from about 8 hrs to about 90 days, from about 8 hrs to about 120 days, from about 8 hrs to about 150 days, or from about 8 hrs to about 180 days. In some embodiments, the term “sufficient time” ranges from 1 day to about 180 days, e.g., from about 1 day to about 2 days, from about 1 day to about 7 days, from about 1 day to about 14 days, from about 1 day to about 21 days, from about 1 day to about 30 days, from about 1 day to about 45 days, from about 1 day to about 60 days, from about 1 day to about 90 days, from about 1 day to about 120 days, from about 1 day to about 150 days, or from about 1 day to about 180 days. In some embodiments, the term “sufficient time” ranges from 2 days to about 180 days, e.g., from about 2 days to about 7 days, from about 2 days to about 14 days, from about 2 days to about 21 days, from about 2 days to about 30 days, from about 2 days to about 45 days, from about 2 days to about 60 days, from about 2 days to about 90 days, from about 2 days to about 120 days, from about 2 days to about 150 days, or from about 2 days to about 180 days. In some embodiments, the term “sufficient time” ranges from 7 days to about 180 days, e.g., from about 7 days to about 14 days, from about 7 days to about 21 days, from about 7 days to about 30 days, from about 7 days to about 45 days, from about 7 days to about 60 days, from about 7 days to about 90 days, from about 7 days to about 120 days, from about 7 days to about 150 days, or from about 7 days to about 180 days. In some embodiments, the term “sufficient time” ranges from 14 days to about 180 days, e.g., from about 14 days to about 21 days, from about 14 days to about 30 days, from about 14 days to about 45 days, from about 14 days to about 60 days, from about 14 days to about 90 days, from about 14 days to about 120 days, from about 14 days to about 150 days, or from about 14 days to about 180 days. In some embodiments, the term “sufficient time” ranges from 21 days to about 180 days, e.g., from about 21 days to about 30 days, from about 21 days to about 45 days, from about 21 days to about 60 days, from about 21 days to about 90 days, from about 21 days to about 120 days, from about 21 days to about 150 days, or from about 21 days to about 180 days. In some embodiments, the term “sufficient time” ranges from 30 days to about 180 days, e.g., from about 30 days to about 45 days, from about 30 days to about 60 days, from about 30 days to about 90 days, from about 30 days to about 120 days, from about 30 days to about 150 days, or from about 30 days to about 180 days. In some embodiments, the term “sufficient time” ranges from 45 days to about 180 days, e.g., from about 45 days to about 60 days, from about 45 days to about 90 days, from about 45 days to about 120 days, from about 45 days to about 150 days, or from about 45 days to about 180 days. In some embodiments, the term “sufficient time” ranges from 60 days to about 180 days, e.g., from about 60 days to about 90 days, from about 60 days to about 120 days, from about 60 days to about 150 days, or from about 60 days to about 180 days. In some embodiments, the term “sufficient time” ranges from 90 days to about 180 days, e.g., from about 90 days to about 120 days, from about 90 days to about 150 days, or from about 90 days to about 180 days. In some embodiments, the term “sufficient time” ranges from 120 days to about 180 days, e.g., from about 12 days to about 150 days, or from about 60 days to about 180 days. In some embodiments, the method provided herein further includes changing culture medium with fresh culture medium regularly. The term “regularly” shall mean changing culture medium hourly, bi-hourly, four times a day, twice a day, daily, once per two-day, bi-weekly, weekly, bi-monthly, or monthly. In another aspect of the present invention, it is provided a supernatant of the FReP cell disclosed herein. The supernatant includes the culture medium of the present invention and also growth factors and/or transcriptional factors excreted by the FReP cells or clones provided herein. The supernatant disclosed herein is effective for treating or ameliorating a disorder as is the FReP cell disclosed herein. In some embodiments, the supernatant can form a composition, optionally with a carrier. The composition can be applied to a mammalian subject for treating or ameliorating a disorder. In some embodiments, the composition can be a cosmetic composition or a pharmaceutical composition. As used herein, the term FReP cell shall mean a cell reprogrammed by exposure to a culture medium comprising FMOD that is not a pluripotent stem cell (“PSC”) but possesses at least one of the characteristics of PSC. The FReP cell disclosed herein has ability to differentiate into a desired tissue cell in a physiological condition of a tissue. An attribute of the FReP disclosed herein is that it expresses NANOG. In some embodiments, the FReP cell disclosed herein does not form teratoma. The characteristics or attributes of PSC are generally known in the art, some features of which are described as follows. Generally recognized characteristics of PSC include its ability to differentiate into different tissue cells under proper conditions. Other attributes of a PSC include, e.g., expression of transcriptional regulators such as OCT4, SOX2, or NANOG or antigens such as SSEA-4, TRA-1-60, or TRA-1-81, as well as high expression of alkaline phosphatase (AP). In some embodiments, the FReP cell disclosed herein has all the attributes or a pluripotent stem cell. In these embodiments, the FReP cell is presumably a PSC. In some embodiments, the FReP cell disclosed herein has one or more, but not all, of the attributes or a pluripotent stem cell. In these embodiments, the FReP cell disclosed herein does not amount to a PSC. These transcriptional regulators or antigens can be readily recognized by antibodies against these regulators or antigens in, e.g., immunofluorescent staining. As used herein, the term PSC shall also encompass pluripotent germ cells. Generally, a FReP cell can be generated by a method comprising the steps of: treating a mammalian cell with a cell culture medium for a period ranging from a day to a month, and changing the cell culture medium regularly until the FReP cell forms. WO 2011/143400 discloses a method of forming a pluripotent stem cell like (PSCL) cell and method of making thereof. The teaching in WO 2011/143400 is incorporated herein in its entirety. The FReP cell can be used in medicine as is a PSC to treat or ameliorate a disorder in a mammal (e.g., a human being or an animal). Generally, the method includes administering to a subject having a disorder a FReP cell(s) or clone(s) so as to treat or ameliorate the disorder. Methods of using pluripotent stem cell to treat a disorder is generally established and known in the art as it will closely resemble the protocols used for embryonic stem cells (see, e.g., Sun, et al., Cell Cycle 9:5, 880-885 (2010)). Although, there are no approved products yet, there are a lot of potential applications, such as transplantation, gene repair and cell replacement therapy for a variety of genetic disorders (see, e.g., Gunaseelie, et al., The disorder can be any disorder that can be treated or ameliorated by a pluripotent stem cell. In some embodiments, the disorder can be a degenerative disease such as a neurodegenerative disorder or cardiac degenerative disease. In some embodiments, the disorder can be a central nervous system (CNS) disease, cardiovascular disease, blood diseases, Crohn's disease, bone disease, muscle disease, baldness, cancer, infertility, or chondrocyte disease, such as adenosine deaminase deficiency-related severe combined immunodeficiency (ADA-SCID), Shwachman-Bodian-Diamond syndrome (SBDS), Gaucher disease (GD) type III, Duchenne (DMD) and Becher muscular dystrophy (BMD), Parkinson disease (PD), Huntington disease (HD), juvenile-onset, type 1 diabetes mellitus (JDM), Down syndrome (DS)/trisomy 21, the carrier state of Lesch-Nyhan syndroms, Alzheimer's disease, or ischemic heart diseases (see, e.g., Gunaseelie, et al., In some embodiments, the disorder can be a retina disease. In some embodiments, the disorder can be a trauma and injury to a tissue. Examples of such tissue can be skin, muscle, cartilage, tendon, peripheral nerve, spinal cord, blood vessels, or bone. Examples of trauma can be trauma inflicted by physical impact or trauma by a procedure in medicine, e.g., removal of tissue in treating cancer, etc. In some embodiments, the disorder can be a skeletal disorder. In some embodiments, the disorder can be an organ disease. In further aspect of the present invention, it is provided a method or inhibiting tumor growth, comprising adding FMOD directly to tumorigenic, or tumor cells to inhibit their growth. For example, one can administer to a subject (e.g., a cancer patient) in need thereof a composition comprising an effective amount of fibromodulin (FMOD) to a site having tumorigenic or tumor cells in the subject to cause the tumorigenic cells or tumor cells to stop growth or growing at a slower rate, which is defined above. Administration of an effective amount of FMOD or a composition comprising an effective amount of FMOD can be achieved by systemic or local administration. Systemic administration and local administration are well understood in the art. Examples of systemic administration is parenteral injection or IV injection. Examples of local administration include e.g., injection to the local site or implantation. The following examples illustrate, rather than limit, embodiments of the present invention. Studies on Reprogramming Human Fibroblasts to Pluripotency Using a Single Protein, Fibromodulin Summary Pluripotent and/or multipotent stem cell-based therapeutics are a vital component of tissue engineering and regenerative medicine. The generation or isolation of safer and readily available stem cell sources will significantly aid clinical applications. We report here a technique using a single molecule, recombinant human fibromodulin protein (FMOD), to reprogram human fibroblasts into multipotent cells. Like virally-induced pluripotent stem (iPS) cells, FMOD reprogrammed (FReP) cells express pluripotency markers, form embryoid bodies (EBs), and differentiate into ectoderm, mesoderm, and endoderm derivatives in vitro. Notably, FReP cells regenerate muscle and bone tissues but do not generate teratomas in vivo. Unlike iPS cells, undifferentiated FReP cells proliferate slowly and express low proto-oncogene c-MYC and unexpectedly high levels of cyclin-dependent kinase inhibitors p15Ink4Band p21WAF1/Cip1. Remarkably, in a fashion reminiscent of quiescent stem cells, the slow replicative phenotype of undifferentiated FReP cells reverses after differentiation induction, with differentiating FReP cells proliferating faster and expressing less p15Ink4Band p21WAF1/Cip1than differentiating iPS cells. Overall, single protein, FMOD-based, cell reprogramming bypasses the risks of mutation, gene instability, and malignancy associated with genetically-modified iPS cells and provides an alternative strategy for engineering patient-specific multipotent cells for basic research and therapeutic applications. Patient-specific stem cells bypass many ethical and immunologic concerns and may be created by reprogramming somatic cells into a pluripotent state. Previous studies show that a mammalian somatic cell can be reprogrammed by transferring its nucleus into an oocyte [1-3] or by fusion with an embryonic stem (ES) cell [4,5]. Recently, somatic cells were reprogrammed to gain pluripotency utilizing viral-mediated genomic integration of Yamanaka factors (Oct4, Sox2, Klf4, and c-Myc) in mouse cells, or Thomason factors (OCT4, SOX2, NANOG, and LIN28) in human cells [6,7]. These virally-induced pluripotent stem (iPS) cells resemble natural pluripotent stem cells such as ES cells in many aspects including stem cell surface markers and transcription factor expression profiles, doubling time, embryoid body (EB) formation, teratoma formation, and the capacity to differentiate into the three germ layers: endoderm, mesoderm, and ectoderm [6-10]. Despite significant promise for patient-specific cell therapy, cumbersome iPS cell reprogramming protocols as well as safety concerns over genome integrative approaches that increase iPS cell tumorigenicity have impeded clinical application [11,12]. Viral or DNA-based methodologies all exhibit varying degrees of genomic integration and insertional mutagenesis risks, making them potentially unsafe for human use [11-13]. In this study, we describe a technically straightforward method to create induced multipotent cells from somatic cells based on extracellular delivery of a single extracellular matrix (ECM) component-fibromodulin (FMOD). These FMOD reprogrammed (FReP) cells have the potential to differentiate into various therapeutic cells, but unlike iPS cells, they do not impose a risk of tumor formation from undifferentiated cells. 2.1. FMOD Production cDNA of human FMOD transcript (Genebank accessory number: M 002023) was subcloned into commercially available vector pSecTag2A (Invitrogen) with C-terminal His-tag and transfected into CHO-K1 cells. After establishing a stable expression clone, FMOD was harvested from the conditioned medium and purified via ProBond™ Purification System (Invitrogen) as previously described [14]. 2.2. Cell Culture Human newborn foreskin fibroblast BJ (ATCC CRL-2522) and primary adult normal human dermal fibroblast HDF (Lonza Biosciences) cells were maintained in Clonetics® Normal Human Fibroblast Cell Systems (FGM-2; Lonza Biosciences). Viral vector-mediated human iPS (clone iPS2) [1,5] cells were maintained on irradiated mouse embryonic fibroblast (MEF) feeder cells (GlobalStem Inc.) in ES-DMEM/F12 (optimized for human ES cells; GlobalStem Inc.) supplemented with 20% knockout serum replacement (Invitrogen) and 10 ng/ml human recombinant fibroblast growth factor (FGF)-2 (GlobalStem Inc). Viral vector harboring enhanced green fluorescent protein gene (EGFP) derived by NANOG promoter (NANOG::EGFP reporter) was produced and infected as previously described [16]. 2.3. FMOD Reprogramming 4×105/well human fibroblasts cultured in FGM-2 medium were seeded in 6-well cell culture plates overnight to confluence. Serum-free, growth factor-free Fibroblast Basal Medium (FBM; Lonza Biosciences) supplied with 0.4 mg/ml recombinant human FMOD, 2 mM L-glutamine (Invitrogen), and 1% penicillin/streptomycin (PS; Invitrogen) was used to treat human fibroblasts daily for three to four weeks ( 1×104/cm2cells were seeded into 12-well culture plates for proliferation assay. After 3 days incubation, cell proliferation was analyzed by Click-iT® EdU Microplate Assay (Invitrogen). 2.4. In Vitro Differentiation 2.4.1. EBs Formation Following manufacturer's instructions, AggreWell™ 800 Plates and AggreWell™ Medium (StemCell Technologies) were used for formation of EBs in suspension culture. Established protocols for direct differentiation of human ES and iPS cells were used for the differentiation of FReP cells with some modification [17-23]. 2.4.2. Neurogenes is For neuron differentiation, EBs were transferred into 6-well ultra-low plates with knockout DMEM medium (Invitrogen) supplied with 10% knockout serum replacement, 2 mM L-glutamine, 1% PS, 10 μM all-trans retinoic acid (RA; Sigma-Aldrich), and 100 nM of the N-terminal active fragment of human sonic hedgehog (Shh; R&D systems) to generate spheres. Fresh retinoic acid (RA) was added every day, and the medium and supplements, including Shh, were replaced every 72 h. After 8-day suspension culture, these induced spheres were transferred onto poly-ornithine/fibronectin (Sigma-Aldrich) coated plates with DMEM F12 medium (Invitrogen) supplied with 2% fetal bovine serum (FBS; Invitrogen), N2 supplement (Invitrogen), 20 ng/ml glial-derived neurotrophic factor (GD F; Invitrogen), 20 ng/ml brain-derived neurotrophic factor (BD F; Invitrogen), 20 ng/ml ciliary neurotrophic factor (CNTF; Invitrogen), and 1×B27 serum-free supplement (Invitrogen) [17,18]. After 3-4 days, cultures were fixed for immunofluore scent (IF) staining. 2.4.3. Pancreagenesis Cells were cultured in RPMI 1640 medium (Invitrogen) supplied with 2% FBS, 2 mM L-glutamine, 1% PS, and 100 ng/ml recombinant activin A (R&D systems) for 4 days for differentiation into endoderm derivative. For further induction of pancreatic lineage cells, cells with 4 days of activin A treatment were cultured for another 8 days without activin A [19,20]. 2.4.4. Cardiomyogenesis For cardiac differentiation, colonies were detached by Dispase (Invitrogen) and transferred into 6-well ultra-low plates with DMEM F12 medium supplied with 20% FBS, 1 mM nonessential amino acids (NEAA; Invitrogen), and 0.1 mM 3-mercaptoethanol (Sigma-Aldrich) to initiate cardiac differentiation. During suspension culture, the medium was changed at day 1 followed by culture for another 3 days. Afterwards, the spheres were plated on AF solution (Invitrogen) coated plates for another 10 days before IF staining. Medium was changed every day [19,21]. 2.4.5. Skeletal Myogenesis For skeletal myogenesis, colonies were transferred onto AF solution coated plates with myogenic medium I [DMEM medium supplied with 10% FBS, 10% horse serum (HS; Invitrogen), 1% chicken embryo extract (CEE; Accurate), and 1% PS] for 7 days, and then for 7-10 days in myogenic medium II [DMEM medium supplied with 1% FBS, 1% HS, 0.5%) CEE, and 1%>PS]. Half of the medium was renewed every 4 days [22]. 2.4.6. Osteogenesis For osteogenesis, colonies were transferred onto AF solution coated plates in a-MEM medium (Invitrogen) supplied with 10% FBS, 50 μg/ml ascorbic acid (Sigma-Aldrich), 10 mM β-glycerophosphate (Sigma-Aldrich), and 1% PS for 28 days. Mineralization was detected by Alizarin Red staining as previously described [23]. 2.4.7. Adipogenesis hMSC Mesenchymal Stem Cell Adipogenic Differentiation Medium (Lonza Biosciences) was used for adipogenesis in vitro. Oil Red O staining was used to identify adipocytes. 2.5. Generation of Functional Tissues In Vivo 8-week old SCID mice were anaesthetized by isoflurane/02 inhalation. For osteogenesis in vivo, a demineralized bone matrix (DBX; Musculoskeletal Transplant Foundation) was used as scaffold [23]. After 3-day pre-induction in a-MEM medium supplied with 10% FBS, 50 μg/ml ascorbic acid, 10 mM β-glycerophosphate, and 1% PS, 5×105cells were harvested and suspended in 150 μPBS and mixed with DBX before implantation into a pocket in the gluteofemoral muscle of SCID mice. Mice were sacrificed 8 weeks post procedure, and tissues were harvested and fixed in 10% formalin [23]. For myogenesis in vivo, 5×105cells were cultured in myogenic medium I for 3 days, and slowly injected into a pocket of gluteofemoral muscle of SCID mice; specimen were harvested at 8 weeks post injection. Alternatively, cardiotoxin (15 μg; Sigma) was injected into the gastrocnemius muscle 3 hours prior to transplantation of 5×105FReP cells. Mice were re-anaesthetized, and cells suspended in 35 μl PBS, or the same volume of PBS as a control, were then slowly injected into the injured muscle. Mice were sacrificed 3 weeks post-procedure and muscle tissue was harvested and fixed in 10% formalin [22]. 2.6. Karyotyping and Tumor Formation Karyotyping and tumor formation assays were performed by Applied StemCell Inc. Briefly, cells were collected by collagenase IV treatment and injected into male SCID-beige mice kidney and testis. Tissues were harvested after 3-4 months and processed for paraffin embedding and hematoxylin and eosin (H&E) staining following standard procedures. 2.7. Western Blotting Cells were harvested with RIPA buffer (Pierce) supplemented with Halt™ Protease and Phosphatase Inhibitor Cocktail (Pierce). 15 μg of protein from each sample was loaded onto SDS-PAGE and transferred to nitrocellulose membranes as previously described [24]. Western blotting was performed using the following primary antibodies: glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Santa Cruz Biotechnology, Inc.), NANOG (Cell Signaling Technology), OCT4A (Cell Signaling Technology), SMAD3 (Abeam Inc.), phosphorylated SMAD3 (pSMAD3, Abeam Inc.), and SOX2 (Cell Signaling Technology). Immu-Star™ WesternC™ kit (Biorad) was used for development. Bands on Western blot were quantified using QuantityOne® (Biorad), and values were expressed in relative arbitrary densitometry units. 2.8. RT-PCR, Quantitative RT-PCR (qRT-PCR) and PCR Array RNAs were extracted using RNeasy® Mini Kit (Qiagen) with DNase (Qiagen) followed by reverse transcription with Superscript™ III First-Strand Synthesis System for RT-PCR (Invitrogen). PCR was performed with Taq DNA polymerase (Invitrogen). Primers used in this study are listed in Table 1 [25]. qRT-PCR was performed on a 7300 Real-Time PCR system (Applied Biosystems Inc.) with TaqMan® Gene Expression Assays (Applied Biosystems Inc.). Concomitant GAPDH was also performed in separate tubes for each RT reaction. For each gene, at least three separate sets of qRT-PCR analyses were performed from different cDNA templates. The ΔCTlevels of GAPDH did not differ significantly between treatment conditions; thus, they were used as housekeeping standard (data not shown). qBiomarker™ Screening PCR Arrays for iPSC Colony Screening (SABiosciences Corp.) were used for RNA expression profile as well. AP staining was performed with the Vector Red substrate kit from Vector Laboratories. 2.10. IF and Immunohistochemistry (IHC) Staining Samples for IF were fixed in pre-chilled acetone, and 4′,6-diamidino-2-phenylindole (DAP I) was used for count staining. Meanwhile, samples for IHC were fixed in 10% formalin. After fixation, samples for IHC were dehydrated, paraffin-embedded, and sectioned at 5 μm for H&E, Masson's Trichrome, and IHC staining. IF and IHC staining were performed using the following primary antibodies: cardiac troponin t (cTNT; Abeam Inc.), α1-fetoprotein (AFP; Abeam Inc.), FLT-1 (Abeam Inc.), AMPA glutamate receptor 1 (GLUR1; Abeam Inc.), KRT-18 (Abeam Inc.), human major histocompatibility complex (MHC) Class 1 (clone H-300, Santa Cruz Biotechnology Inc.; clone EP1395Y, Abeam Inc.), MYOSIN (Skeletal, slow) (Sigma-Aldrich), osteocalcin (OCN, Santa Cruz Biotechnology), NANOG (Cell Signaling Technology), NESTIN (Abeam Inc.), NKX2.5 (Abeam Inc.), OCT4A (Cell Signaling Technology), pancrease/duodenum homoeobox 1 (PDX1; Abeam Inc.), runt-related transcription factor 2 (RUNX2, Santa Cruz Biotechnology, Inc.), SOX2 (Cell Signaling Technology), SSEA4 (Cell Signaling Technology), TRA-1-60 (Cell Signaling Technology), TRA-1-81 (Cell Signaling Technology), neuron specific βIII-TUBULIN (Abeam Inc.), VE-CADHERIN (Abeam Inc.), and Alexa Fluor® 594-Phalloidin (Invitrogen). 2.11. Statistical Analysis Results were graphically depicted as the mean±standard error of mean (s.e.m). Statistical significance was computed using ANOVA and Tukey-Fisher LSC criterion based on the post hoc t statistics. Independent-samples t-test was used to analyze experiments of two groups. All statistical analyses in this manuscript were as per consultation with the UCLA Statistical Biomathematical Consulting Clinic (SBCC). 3.1. FMOD Reprograms Human Fibroblasts Human newborn foreskin fibroblast BJ cells exposed to continuous recombinant human FMOD under serum-free conditions formed AP-positive, ES cell-like colonies on MEF feeders at an average frequency of 0.03% (32±2.6 ES cell-like colonies from 100,000 BJ fibroblasts, N=16) ( 3.2. FReP Cells Exhibit Multipotent Differentiation Potential 3.2.1. FReP Cells Differentiate into Multiple Lineage Derivatives In Vitro Similar to human ES and iPS cells, BJ-FReP cells formed EBs ( To confirm the multipotency of established FReP cells, we assessed their ability to differentiate into ectoderm, endoderm or mesoderm derivatives following protocols established for human ES and iPS cells [17-19, 21-23]. In the presence of differentiation media for neurons (ectoderm derivatives), the BJ-FReP-EBs dissociated and expanded, and most of the cells (˜90%) ultimately differentiated into neurons characterized by typical neuronal morphology and expression of neuron specific βIII-TUBULIN (a broadly used ectodermal differentiation marker) and GLUR1 (an excitatory neurotransmitter receptor in the mammalian brain, and activated in a variety of normal neurophysiologic processes) ( 3.2.2. FReP Cells Generate Bone and Skeletal Muscles In Vivo To study their in vivo osteogenic potential, BJ-FReP cells were pre-differentiated in osteogenic medium for 3 days, loaded onto DBX scaffolds, and then implanted into the gluteofemoral muscle pocket of immunodeficient SCID mice ( In a separate study, to assess in vivo myogenic potential, BJ-FReP cells underwent 3-day myogenic pre-differentiation in vitro before injection into the gluteofemoral muscle pocket of SCID mice. At 8 weeks post-injection, robust co-localization of human MHC Class I and human slow skeletal myosin confirmed BJ-FReP cell differentiation into skeletal muscle in vivo ( These data demonstrate the in vivo multipotency of FReP cells and highlight their potential usefulness for cell-based tissue engineering. 3.3. FReP Cells are Distinct from Classic iPS Cells 3.3.1. Teratoma Assay To test FReP cell pluripotency and safety in vivo, we used a standard, SCID-beige mouse teratoma model injecting BJ-FReP cells or positive control human H9 ES cells into the kidney or testis. Instead of forming tumors, injected undifferentiated BJ-FReP cells developed into small, calcified nodules after 3 months ( 3.3.2. Proliferation Assay Cell proliferation ratios of untreated BJ fibroblasts, undifferentiated vs. differentiating BJ-FReP cells, and undifferentiated vs. differentiating iPS cells were compared. Our studies showed that undifferentiated BJ-FReP cells proliferated minimally, while differentiating BJ-FReP cells proliferated rapidly ( 3.3.3. Gene Expression Profile Assay FReP and iPS cells also showed different gene expression signatures ( Collectively, FReP and iPS cells have distinctly different proliferative, tumorigenic, and molecular phenotypes (Table 2). Tumorigenesis remains a significant obstacle to safe clinical application of pluripotent stem cells, such as iPS and ES cells [13,41]. At the genetic level, one crucial difference between iPS cells and ES cells is the introduction and integration of genes, which is essential for the reprogramming process, into the genome of somatic cells. As such, iPS cells are likely to carry a higher tumorigenicity risk than ES cells due to gene activation or interruption from viral integration during reprogramming [12, 13, 42-44]. Additionally, undesirable transgene reactivation is another problem of using viral iPS cells. For example, c-Myc reactivation has shown to significantly increase tumor formation in chimeric mice generated from iPS cells [8]. While c-MYC is dispensable for iPS cells generation, reactivation of the other reprogramming factors may also cause tumors [8, 12, 13, 19, 39, 44]. Meanwhile, apart from the extremely low efficiency [12, 44-46], using adenoviruses, plasmids and chemicals to generate iPS cells does not exclude the risk of teratoma formation since genetic alterations from integration of small virus/plasmid DNA fragments or chemically induced mutations can still occur [12, 44]. Moreover, non-integrative RNA- and protein-based iPS-generation approaches are complicated by the need for cell-penetrating, cytosolic delivery [1,1]. Although the minimal criteria for demonstrating successful human pluripotent stem cell reprogramming is teratoma formation, teratoma formation in and of itself does not guarantee pluripotency as there are instances of mouse ES-like cells that form teratomas but do not produce germline chimeras [44]. Concurrently, significant issues impede Food and Drug Administration (FDA) approval of iPS cells for human use, including (i) undesirable use of oncogenes for reprogramming, (ii) undesirable use of retroviral or genome integrative approaches, and (iii) undesirable teratoma formation. Thus, reprogramming approaches that specifically concentrate on FDA safety issues are required [12, 47-49]. To begin addressing FDA concerns, several groups have successfully reprogrammed fibroblasts into neurons and pancreatic exocrine cells into insulin-producing beta cells without an intermediate, potentially tumorigenic, pluripotent stage [50,51]. This reflects a recent focus on safer cellular reprogramming methodologies that generate curative cell types without teratoma formation [12,44,48]. In this respect, FReP cells may fulfill both goals of functional tissue generation and teratoma prevention. In this example, we disclose an approach that uses a single extracellular matrix (ECM) proteoglycan-FMOD, instead of genetic modifications [6,7,11,45,46], undefined embryonic stem cell extracts [4,52], or animal oocyte extracts [53,54] to generate multipotent cells useful for replacing, restoring, and/or regenerating tissue where disease or injury has caused irreparable damage to native tissues. After simple exposure to FMOD, human skin fibroblasts become at least partially reprogrammed as demonstrated by alterations in gene expression profiles ( We have demonstrated that the FReP cells are able to be differentiated into multiple functional cell types, including neurons, pancreatic lineage cells, cardiomyocytes, skeletal myocytes, osteoblasts, and adipocytes in vitro ( The fact that extracellular approaches can reprogram cells lends further support to our ability to reprogram fibroblasts using a single extracellular protein, FMOD [54]. The success of generating multipotent FReP cells using an extracellular protein approach has led us to explore the possible mechanism underlying FMOD-based reprogramming. Theoretically, only small molecules can freely penetrate into the cell for reprogramming. As a 59 kD ECM proteoglycan, passive entry of FMOD is unlikely. Alternatively, FMOD has been found to be a critical component for maintenance of endogenous stem cell niches [66]. Specific cellular niches or microenvironments are able to significantly modify epigenetic expression and lead to the altered cell fate [67,68], while FMOD is known to modulate expression, organization, and function of various growth factors, cytokines, and ECM components [14, 69-75]. It is thus possible that FMOD significantly affects ECM microenvironment to promote signal pathways involved in cell reprogramming. For instance, FMOD induces a specific, biphasic TGF-β/ACTIVIN/NODAL signaling response characterized by significantly reduced pSMAD3 levels at week 1 followed by markedly increased pSMAD3 at weeks 2 and 3 ( Unlike undifferentiated iPS cells, undifferentiated FReP cells exhibit minimal proliferation rates ( Remarkably, the slow proliferative rate of undifferentiated FReP cells is significantly reversed by culture in differentiation media, and differentiating FReP cells proliferate faster overall than differentiating iPS cells ( This study demonstrates that FMOD, a single ECM proteoglycan, can directly reprogram human fibroblasts to a minimally proliferative, multipotent state that resembles quiescent stem cells. Collectively, these results raise intriguing questions regarding FMOD's role in TGF-β/SMAD signaling and the molecular nexus governing cell reprogramming, stem cell quiescence, and tumorigenicity. Overall, additional detailed studies on FReP cell genetic stability, epigenetic memory, in vivo pluripotency, and long term viability are required. However, we believe that FMOD-based reprogramming may become a major enabling technology for cell-based therapies and tissue engineering applications due to its ease of application, non-integrative nature, and lack of teratoma formation. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is understood that certain adaptations of the invention are a matter of routine optimization for those skilled in the art, and can be implemented without departing from the spirit of the invention, or the scope of the appended claims.CROSS-REFERENCE TO RELATED APPLICATIONS
FIELD OF THE INVENTION
BACKGROUND
SUMMARY OF THE INVENTION
BRIEF DESCRIPTION OF THE DRAWINGS
DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS
Fibromodulin (FMOD) Reprogrammed (FReP) Cells
Method of Use
EXAMPLES
1. Introduction
2. Materials and Methods
Primers used for RT-PCR [1] Gene Forward primer Reverse primer NANOG cggcttcctcctcttcctctatac atcgatttcactcatcttcacacgtc (SEQ ID NO.: 1) (SEQ ID NO.: 2) OCT3/4 ctgcagtgtgggtttcgggca cttgctgcagaagtgggtggagga (SEQ ID NO.: 3) (SEQ ID NO.: 4) SOX2 gagagaaagaaagggagagaag gagagaggcaaactggaatc (SEQ ID NO.: 5) (SEQ ID NO.: 6) KRT-18 tctgtggagaacgacatcca ctgtacgtctcagctctgtga (SEQ ID NO.: 7) (SEQ ID NO.: 8) NESTIN cagctggcgcacctcaagatg agggaagttgggctcaggactgg (SEQ ID NO.: 9) (SEQ ID NO.: 10) FLT-1 atcagagatcaggaagcacc ggaacttcatctgggtccat (SEQ ID NO.: 11) (SEQ ID NO.: 12) VE-CADHERIN acgggatgaccaagtacage acacactttgggctggtagg (SEQ ID NO.: 13) (SEQ ID NO.: 14) GATA-4 ctccttcaggcagtgagagc gagatgcagtgtgctcgtgc (SEQ ID NO.: 15) (SEQ ID NO.: 16) β-ACTIN atctggcaccacaccttctacaatgagctgcg cgtcatactcctgcttgctgatccacatctgc (SEQ ID NO.: 17) (SEQ ID NO.: 18) [1] Villa-Diaz LG, Nandivada H, Ding J, Nogueira-de-Souza NC, Krebsbach PH, O'Shea KS, et al. Synthetic polymer coatings for long-term growth of human embryonic stem cells. Nat Biotechnol. 2010;28:581-3.
2.9. Alkaline Phosphatase (AP) Staining
3. Results
Comparison of human ES, iPS, and FReP cells ES iPS FReP Related Figure cells cells cells ES-like colonies ES-like colony formation FIG. 1 and FIG. 9a Yes Yes Yes on MEF feeder cells AP activity FIG. 1 and FIG. 9a Yes Yes Yes/ Partial Expression of pluripotency FIG. 2a, b, and Fig. Yes Yes Yes markers 9b Expression of ectoderm FIG. 2b No No Yes markers Expression of mesoderm FIG. 2b No No Yes markers EBs EB formation in suspension FIG. 4a and FIG. Yes Yes Yes culture 1 1a Expression of pluripotency FIG. 2b No No Yes markers Expression of ectoderm FIG. 2b Yes Yes Yes markers Expression of mesoderm FIG. 2b Yes Yes Yes markers Expression of endoderm FIG. 2b Yes Yes Weak markers In vitro differentiation Ectoderm derivatives FIG. 4b and FIG. Yes Yes Yes 1 1b 4. Discussion
5. Conclusion
REFERENCES