Methods for determining whether a tissue sample or an analogue and/or derivative thereof comprises a cell with a chromosome (11:18) translocation associated with malignancies such as mucosa-associated lymphoid tissue (MALT) lymphomas. The invention further provides insight into a novel mechanism of transformation of primary cells. The mechanism involves expression of a fusion proteinaceous molecule comprising at least apoptosis inhibitor 2 (API2) or a functional part, derivative and/or analogue thereof fused to at least One other proteinaceous molecule. The invention also provides a novel nucleic acid sequence and proteinaceous molecule expressed from the sequence termed “MALT-lymphoma associated Translocation (MLT) protein.”
1. An isolated nucleic acid comprising a first portion encoding at least part of an apoptosis inhibitor 2 (API2) gene, said first portion corresponding to the N-terminal portion of API2, wherein said N-terminal portion of API2 does not extend to 3′ of intron 7, and a second portion encoding at least part of a mucosa-associated lymphoid tissue (MALT)-Lymphoma associated Translocation (MLT) protein (SEQ ID NO:60), said isolated nucleic acid capable of diagnosing low grade lymphoma. 2. The isolated nucleic acid of 3. The isolated nucleic acid of 4. The isolated nucleic acid of 5. The isolated nucleic acid of 6. An isolated nucleic acid comprising a DNA sequence encoding a fragment of a mucosa associated lymphoid tissue (MALT)-Lymphoma associated translocation (MLT) protein of SEQ ID NO:8, said isolated nucleic acid useful in the diagnosis of low grade lymphoma. 7. The isolated nucleic acid of 8. The isolated nucleic acid of 9. The isolated nucleic acid of 10. The isolated nucleic acid of 11. The isolated nucleic acid of 12. An isolated nucleic acid complementary to the isolated nucleic acid of 13. The isolated nucleic acid of 14. The isolated nucleic acid of
[0001] This application is a continuation of U.S. patent application Ser. No. 09/579,692, filed Mar. 26, 2000, which claims priority from Provisional Patent Application No. 60/138,834, filed Jun. 9, 1999. [0002] The invention relates to the fields of medicine and diagnostics. More in particular, the invention relates to medicine and the diagnosis of tumors. [0003] Recurrent translocations acquired in a process of transformation are well recognized in nodal B-cell lymphomas. These translocations characterize distinct subtypes of disease and involve genes controlling cell proliferation and apoptosis. BCL2, which suppresses apoptosis, was cloned from the t(14;18)(q21;q32) found in most cases of follicular B-cell lymphoma, whereas translocations involving the BCL1/CyclinDl gene on chromosome 11q13 are seen in nearly all cases of mantle cell lymphoma.1 [0004] By contrast, the genetic mechanisms underlying the genesis and disease progression of extranodal marginal zone B-cell lymphomas of the mucosa-associated lymphoid tissue (MALT) type, a recently recognized distinct subtype of B-cell Non-Hodgkin's Lymphoma's (NHL), are not known.2MALT lymphomas account for five to ten percent of all NHLs and the vast majority of lymphomas arising at extranodal sites. They originate in a setting of chronic inflammation triggered by chronic infection or autoimmune disorders, such as [0005] Since biopsies of these lymphomas are relatively rarely subjected to cytogenetic analysis and their in vitro proliferation is often poor, abnormal karyotypic data have been published for only 46 low-grade MALT lymphomas,9-175 extranodal small lymphocytic lymphomas of probable marginal zone origin,18-20and 23 high-grade gastric MALT lymphomas.14,15Recurrent abnormalities in these cases include trisomies of chromosomes 3, 7, 12, and 18,11,17,21the t(1;14)(p22;q32) which has been described in two cases17and the t(11;18)(q21;q21). The t(11;18)(q21;q21) has been detected in 15 out of the 51 low-grade lymphomas arising from various extranodal sites9,12,14,18-20but in none of the high-grade MALT lymphomas or any other subtype of NHL. In the largest cytogenetic series, this translocation has been found in 7 out of 13 cases of low-grade MALT lymphomas with an abnormal karyotype.14These data clearly indicate that the t(11;18) represents the most frequent structural abnormality in low-grade MALT lymphomas and seems to specifically characterize this disease entity. An attempt to delineate the breakpoint at 18q21.1 has been described by Akagi et al. (Genes, Chromosomes and Cancer, 24 (1999): 315-321). A detailed characterization, however, is urgently needed. [0006] In one aspect, the present invention provides a detailed molecular genetic characterization of the 11q21 and 18q21 breakpoint regions in MALT lymphomas characterized by the t(11;18)(q21;q21). The invention further identifies that the API2 gene, also known as c-IAP2,22HIAPI23and MIHC,24an inhibitor of apoptosis, and a novel gene on 18q21, named MLT, are rearranged in this translocation. The invention also identifies that truncation of the API2 gene distal to its three BIR domains and fusion of this truncated gene with the carboxy-terminal region of MLT may lead to increased inhibition of apoptosis and thereby confer a survival benefit to MALT type B-cell lymphomas. In other words, the present invention discloses that, surprisingly, truncation of the API2 gene and fusion to the new MLT gene is crucial for the development of MALT type B-cell lymphomas. [0007] In one aspect, the invention teaches that the t(11;18)(q21;q21) associated with extranodal marginal zone B-cell lymphomas of the MALT type results in the expression of a chimeric transcript fusing 5′-API2 on chromosome 11 to 3′-MLT on chromosome 18. The occurrence of the t(11;18) translocation in not less than 17 out of 51 published cases of low-grade MALT lymphomas9,12,14,18-20including the two cases described herein, along with its presence as the sole cytogenetic abnormality in 16 out of the 17 reported cases, indicates that the t(11;18) represents one of the main recurrent, disease-specific translocations in NHL. [0008] Several observations point to the API2-MLT fusion as the oncogenic lesion underlying the t(11;18). The chimeric cDNA was cloned from two independent tumors. In one case, the genomic breakpoints were also cloned and the structure of both genes and the localization of the breakpoints are in agreement with the expression of the fusion transcript. The cryptic deletion of the 3′ part of API2 in case 1 precludes the expression of a reciprocal MLT-API2 transcript in this case. As a result of the deletion, the 5′-end of the MLT gene is fused to the 5′-end of the MMP20 gene on the der(18). As both genes are present on opposite strands of the DNA, no MLT-MMP20 transcript is expressed. Furthermore, FISH experiments with PACs for respectively MLT, API2 and MMP20 clearly suggest that, in case 2, a balanced translocation occurred not involving a break in the MMP20 gene, further arguing against any significance of the MLT-MMP20 fusion. [0009] API2 belongs to the family of inhibitors of apoptosis proteins (“IAP”), which play an evolutionary conserved role in regulating programmed cell death in diverse species (International Patent Application WO 97/06182 to Rothe and Goeddel). The IAP genes were first identified in baculoviruses in which they demonstrated an ability to suppress the host cell apoptotic response to viral infection.33Subsequently, five human IAP relatives have been described: NIAP, API1 (also known as cIAP1, HIAP2, MIHB), API2 (cIAP2, HIAP1, MIHC), XIAP-hILP and survivin.22-24,34-37The common structural features of all IAP family members is a motif termed baculovirus IAP repeat (“BIR”) occurring in one to three copies, a caspase recruitment domain or CARD30located between the BIR domain(s) and a carboxy-terminal zinc binding RING finger domain31that is present in all IAPs with the exception of NIAP and survivin. The human API1 and API2 proteins were originally identified as proteins that are recruited to the cytosolic domain of the tumor necrosis factor (TNF) receptor II via their association with the TNF-associated factor (TRAF) proteins, TRAF-1 and TRAF-2,22and have been subsequently shown to suppress different apoptotic pathways by inhibiting distinct caspases, such as caspase-3, caspase-7, and pro-caspase-9.35,38 [0010] The function of the novel MLT gene (also known as “MALT1”) located on chromosome 18q21 is not yet known. Its closest homologue is a hypothetical [0011] The molecular mechanism of action of the API2-MLT fusion remains to be elucidated. Without being limited by theory, it is hypothesized that the fusion protein resulting from the t(11;18) may lead to increased inhibition of apoptosis and thereby confer a survival advantage to MALT lymphomas and allow antigen-independent proliferation. Indeed, MALT lymphomas have been shown to display low levels of apoptosis39and to escape from FAS-mediated apoptosis40and about 20% of low-grade MALT lymphomas do not respond to [0012] The mechanism of gene deregulation by the t(11;18) differs from that seen in most of the B-cell lymphoma-associated translocations, which involve one of the immunoglobulin loci on 14q32, 2p12, or 22q11 and lead to deregulated expression of the incoming oncogene due to the proximity of potent B-cell transcriptional enhancers within the immunoglobulin loci.41In this case, the expression of the fusion gene is driven from the promoter of its 5′ partner, API2. This agrees with the observation that API2 mRNA is highly expressed in adult lymphoid tissues, including spleen, thymus, and peripheral blood lymphocytes, and also in fetal lung and kidney.23It is also interesting to note that the IAP family member survivin is strongly expressed in apoptosis-regulated human fetal tissues, but not in terminally differentiated adult tissues.42Survivin becomes prominently expressed in transformed cell lines and in most human cancers. Survivin expression was also found in 50% of high-grade NHL (centroblastic, immunoblastic) but not in low-grade lymphomas (lymphocytic).37 [0013] At the genomic level, the rearrangements appear to be heterogeneous. The breakpoint in MLT occurred in two different introns for both cases. In the API2 gene the breakpoint occurred in the same intron for both cases, but it was associated with the deletion of the 3′-end of the gene in only one tumor. The cytogenetic analysis of MALT lymphoma is often hampered by their poor proliferation in vitro. However, the physical maps and the genomic clones that the present invention teaches allow the development of a wide variety of sensitive detection methods for this rearrangement, such as but not limited to interphase FISH assays and assays based on the specific amplification of nucleic acid encompassing the t(11:18) breakpoint. Alternatively, the fusion mRNA or the fusion protein provides new molecular targets for diagnosis. [0014] In one aspect, the invention provides a method for determining whether a tissue sample or an analogue and/or derivative thereof comprises a cell with a chromosome (11:18) translocation associated with malignancies such as MALT lymphomas, the method comprising subjecting nucleic acid from the sample to an amplification reaction using a primer that is complementary to a nucteic acid sequence which in humans lies on chromosome 11 region q21-22.3 and a primer that is complementary to a nucleic acid sequence which in humans lies on chromosome 18 region q21.1-22, and determining the presence of any amplified product. Preferably, the tissue sample is taken from a human individual. Preferably, the individual is suffering from or at risk of suffering from a disease. [0015] The nucleic acid may comprise chromosomal DNA, RNA or any other type of nucleic acid. With the knowledge of the region in which the (11:18) translocation occurs, a person skilled in the art is capable of developing specific nucleic acid amplification methods that allow the unambiguous detection of the translocation in a tissue sample. Such assays may be developed based on nucleic acid sequence information presented here. However, it is clear that using the teachings of the present invention, i.e., the identification of the breakpoint and the methods and means to do so, additional nucleic acid sequence information on the region surrounding the breakpoint can be obtained and the use of such sequence information for the development of detection assays for the translocation falls within the scope of the present invention. The term “complementary primer” means a primer that can hybridize to another sequence under relatively mild hybridization conditions, i.e., hybridization conditions that allow nucleic acids with sequences with some mismatches to hybridize to each other. The number of mismatches among others determines the specificity and the efficiency of polymerization. A complementary primer should comprise not more than 30% mismatches, preferably not more than 20% and more preferably not more than 10%. Preferably, the primer does not comprise mismatches. [0016] Amplification methods that may be used in a method of the invention include but are not limited to polymerase chain reaction, NASBA and intracellular PCR. [0017] [0018] [0019] Panel B illustrates the structure of the different fusion cDNAs. On top, the structure of API2 is shown with 3 amino-terminal BIR domains separated from the carboxy-terminal RING domain by a CARD domain. The API2 cDNA is truncated after the third BIR domain and fused in frame to MLT. As a result of the heterogeneity of the genomic breakpoints in case 2, 582 additional nucleotides, encoding two Ig-like C2 domains of MLT, are present in this fusion. An Ig gamma VDJ4-like sequence in MLT is shown by a cross-hatched box. The sequence and the translation of the different junction fragments is shown underneath each cDNA. [0020] [0021] [0022] [0023] [0024] [0025] In a preferred embodiment, the amplified product comprises a linked nucleic acid comprising at least part of nucleic acid encoding a MALT-Lymphoma associated Translocation (MLT) protein and at least part of nucleic acid encoding apoptosis inhibitor 2 (API2). [0026] In a preferred embodiment, the tissue sample comprises a lymphocyte, preferably an activated lymphocyte. In a preferred embodiment, the tissue sample comprises digestive tract cells and/or stomach cells. [0027] In another aspect, the invention provides an isolated and/or recombinant nucleic acid encoding a proteinaceous molecule comprising at least API2 or a functional part, derivative and/or analogue thereof fused to at least one other proteinaceous molecule. The other proteinaceous molecule may be any proteinaceous molecule. Preferably, the other proteinaceous molecule comprises a MALT-Lymphoma associated Translocation (MLT) protein or a functional part, derivative and/or analogue thereof. Preferably, the nucleic acid molecule comprises in humans a sequence as depicted in [0028] A nucleic acid of the invention may further comprise other nucleic acid. Other nucleic acid may facilitate cloning or amplification in bacteria. Preferably, the other nucleic acid comprises nucleic acid corresponding in humans to chromosome 11 region q21-22.3 or a functional part, derivative and/or analogue thereof. In this way, the nucleic acid has advantageous properties for FISH analysis. Preferably, the other nucleic acid comprises nucleic acid corresponding in humans to chromosome 18 region q21.1-22 or a functional part, derivative and/or analogue thereof. In this way, the nucleic acid has advantageous properties for FISH analysis. [0029] The invention further provides a proteinaceous molecule encoded by a nucleic acid of the invention, or a functional part, derivative and/or analogue thereof. The protein may be advantageously used for the at least in part transforming a primary cell, preferably a B-cell and thus enabling and/or facilitating the generation of in vitro growing cell derivatives of the cell. One method of providing a cell with a proteinaceous molecule is through providing the cell with an expressible nucleic acid encoding the proteinaceous molecule and culturing the cell to obtain expression of the proteinaceous molecule. Preferably, the proteinaceous molecule comprises a sequence that, in humans, is a sequence as depicted in [0030] In another aspect, the invention provides an isolated recombinant nucleic acid encoding an MLT protein that, in humans, comprises a sequence as depicted in [0031] The invention further provides an antibody specific for a proteinaceous molecule according to the invention. It is clear to the person skilled in the art that antibodies can be generated in many ways once a suitable antigen has been identified. Antibodies can be generated through, for instance, the immunization of an animal or human with a proteinaceous molecule of the invention. Alternatively, suitable peptides can be generated and used using standard protocols used in the art to generate antibodies in a mammal. However, antibodies can also be generated completely artificially from, for instance, libraries of synthetic antibodies, single-chain antibodies, FAB fragment libraries, etc. Suitable antibodies may be isolated from such libraries through techniques known in the art. Furthermore, for the purpose of this invention, any proteinaceous molecule capable of binding to a proteinaceous molecule of the invention is considered an antibody. [0032] In another aspect, the invention provides the use of a nucleic acid of the invention and/or an antibody of the invention as a probe. The term “probe” refers to a means for detection. A nucleic acid of the invention may be used as a probe, for instance but not limited to, for hybridization to Southern Blot DNA of cells or for in situ hybridization of cells to determine the presence of DNA complementary to the nucleic acid. Information regarding the presence of such DNA may be used for determining the presence or absence of cells comprising the (11:18) translocation. Similarly, an antibody of the invention may be used for the determination of cells expressing a proteinaceous molecule of the invention. [0033] In another aspect, the invention provides a method for at least in part improving an immune response against an antigen comprising providing an immune cell comprising an immune property specific for the antigen with an expressible nucleic acid of the invention. [0034] In yet another aspect, the invention provides a method for at least in part preventing apoptosis in a cell comprising providing the cell with an expressible nucleic acid of the invention. [0035] In yet another aspect, the invention provides a nucleic delivery vehicle comprising a nucleic acid according to the invention. Preferably, the nucleic acid delivery vehicle comprises a virus particle, preferably an adenovirus particle, an adeno-associated virus particle and/or a retrovirus particle. [0036] In yet another aspect, the invention provides a cell comprising a nucleic acid according to the invention and/or a proteinaceous molecule according to the invention. [0037] In yet another aspect, the invention provides a transgenic animal comprising a nucleic acid according to the invention. The transgenic animal can be any known non-human animal and is preferably a mouse as is exemplified further. [0038] The invention is further explained by the use of the following, illustrative Examples. [0039] Material and Methods [0040] Tumor Specimens [0041] Two cases of low-grade extranodal gastrointestinal MALT lymphomas displaying the t(11;18)(q21;q21) were selected from the files of the Center for Human Genetics, University of Leuven, Belgium, and the Department of Hematology, University of Salamanca, Spain, based on the availability of metaphase spreads and frozen tumor tissue. Case 1 presented with an extended multifocal gastrointestinal MALT lymphoma involving the stomach, the small and large bowel, and the mesenteric lymph nodes. Case 2 was diagnosed with a gastric MALT lymphoma with secondary involvement of the spleen, the bone marrow, and the peripheral blood. Both cases revealed [0042] Cytogenetic Analysis [0043] Cytogenetic analysis was performed as described11utilizing tissue of a small bowel biopsy (case 1) and the spleen specimen (case 2). Both cases showed the t(11;18)(q21;q21) as the sole cytogenetic abnormality (case 1: 46,XY,t(11;18)(q21;q21) [17]/46,XY [3]; case 2: 46,XX,t(11;18)(q21;q21) [6]/46,X [14]). Fluorescence in situ hybridization (FISH) was performed as previously described.25Chromosomes 11 and 18 were identified by cohybridization with chromosome 11 (pLC11A) and 18 (L1.84) specific alpha-satellite probes in combination with G-banding using 4,6-diamidino-2-phenylindole-dihydrochloride (DAPI) counterstain. [0044] Yeast Artificial Chromosome (YAC) Clones [0045] YAC clones derived from the Centre dEtude du Polymorphism Human (CEPH) human mega YAC library were selected from the YAC contig reported by Chumakov et al.26and data obtained from the Whitehead Institute/MIT Center for Genome Research. In addition, YAC A1 53A6 hybridizing to the BCL2 gene located at 18q2127and a probe specific for the MLL gene on 11q23 (Oncor, Gaithersburg, Md.) were used. Human YAC inserts were selectively amplified using Alu-polymerase chain reaction (PCR).28In order to confirm their cytogenetic position and to determine the relative order of the YAC clones, pairs of differentially labeled YACs were hybridized to normal metaphase spreads obtained from PHA-stimulated peripheral blood lymphocytes of a healthy donor. [0046] P1 Artificial Chromosome (PAC) and Plasmid Clones [0047] PAC clones were isolated by screening high-density filters from the RPCI libraries with32P-labeled probes. A walking strategy was used to extend the map. PAC end-fragments were rescued using a vectorette ligation approach.29The presence of the STS in the relevant PACs was confirmed by PCR and each PAC was analyzed by FISH on normal metaphase spreads. [0048] BamHI subclones of PAC 152M5 were generated by ligation of gel-purified fragments in pUC18 (Pharmacia Biotech, Uppsala, Sweden) and transformation into XL10-gold cells (Stratagene, La Jolla, Calif.). A BamHI restriction map was generated by comparing the sequence of the ends of the BamHI fragments to the sequence of random 1 kb subclones selected for containing the BamHI restriction sites. To generate random subclones of PAC 152M5, DNA was sheared by sonication and the fraction around 1 kb was gel-purified (Qiaquick Gel Extraction, Qiagen), blunted and ligated in pUC18, and transformed into XL1-blue cells. [0049] Reverse Transcriptase (RT)-PCR and Cloning [0050] Total RNA was extracted from respectively tumor-infiltrated gastrointestinal and splenic tissue using the Trizol Reagent (Life Technologies, Inc., Rockville, Md.). First strand cDNA was reverse transcribed from 1 μg of total RNA with Murine Moloney Leukemia Virus reverse transcriptase (Life Technologies, Inc., Rockville, Md.) according to standard procedures using a random hexamer primer. After size fractionation on Microspin S-400 HR columns (Pharmacia Biotech), a poly-A tail was added to the first strand cDNA with dATP and terminal deoxynucleotidyl transferase (Boehringer Mannheim, Mannheim, Germany). Double-stranded cDNA was then generated using standard procedures with primer R2T8 (5′ CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCTTTTTTTT 3′ (SEQ ID NO:1)). Nested PCR was performed respectively using primers MLTr1 (5′ CCTTCTGCAACTTCATCCAG 3′ (SEQ ID NO:2)) and MLTr2 (5′ ATGGATTTGGAGCATCAACG 3′ (SEQ ID NO:3)) in combination with primers R2F1 (5′ CCAGTGAGCAGAGTGACG 3′ (SEQ ID NO:4)) and R2F2 (5′ GAGGACTCGAGCTCAAGC 3′ (SEQ ID NO:5)). Amplification products were cloned in pGEM T-easy (Promega, Madison, Wis.). [0051] The API2-MLT fusion was confirmed by RT-PCR on patient RNA using the Titan RT-PCR system (Boehringer Mannheim) with primers API2fl (5′ CCAAGTGGTTTCCAAGGTGT 3′ (SEQ ID NO:6)) and MLTr2 and by sequence analysis of the cloned amplification products. A partial MLT cDNA was isolated by 3′ RACE on cDNA of patient 1. Several overlapping clones were analyzed to obtain the 3′ end sequences of MLT (Genbank accession no. AF 130356). [0052] Results [0053] FISH Characterization of the 11q21 and 18q21 Translocation [0054] Twelve YACs derived from the chromosomal region 11q12-22.3 and the MLL probe were hybridized to metaphase spreads of case 1. [0055] From the 9 YACs assigned to 18q21.1-22, five hybridized centromeric and two (including A153A6 containing the BCL2 gene) telomeric to the translocation breakpoint (see [0056] Cloning of the Fusion Genes [0057] In order to identify genes on chromosome 18q in the vicinity of the breakpoints, the sequences derived from short random subclones from the BamHI fragments D, B, H and F were compared to the nucleotide databases. Subclone F24, mapping telomeric to the breakpoint, contained a 178 bp fragment identical to a single EST (IMAGE cDNA clone 1420842, GenBank accession no. AA826328) that resembles a hypothetical [0058] To identify an eventual chromosome 11 fusion partner for MLT, cDNA transcribed from RNA of case 1 was then used in 5′ RACE experiments with two nested primers (MLTr1 and r2) derived from MLT sequences telomeric to the breakpoint. The amplification products were cloned and eight clones with an average insert length of 800 bp were sequenced. Five clones contained only MLT sequences. The three remaining clones showed a fusion of MLT sequences to the 5′ part of the API2 gene, an inhibitor of apoptosis mapped to chromosome 11q22. The API2 protein contains three copies of the baculovirus IAP repeat (BIR) at its amino-terminus and a caspase recruitment domain or CARD30followed by a carboxy-terminal zinc binding RING finger domain.31The chimeric API2-MLT transcript contains base pairs 1-1446 of API2 (Genbank accession no. L49432) fused in frame with bp 583 of the partial MLT cDNA (Genbank accession no. AF130356). At the protein level, the first 441 AA of API2, containing the 3 BIR domains, are fused to the carboxy-terminal part of MLT ( [0059] Primers derived from the API2 and MLT cDNA sequences (M&M) were then used to confirm this fusion directly by RT-PCR. An amplification product with the expected size (445 bp) and sequence was obtained for patient 1, confirming the existence of the chimeric API2-MLT transcript. In contrast, using the same primers, a 1000 bp RT-PCR product was obtained with the RNA sample of the second patient ( [0060] To complete the sequence of the chimeric mRNA, 3′ RACE experiments were performed. The consensus cDNA sequences for both API2/MLT fusions are shown in [0061] Absence of a Reciprocal MLT-API2 Transcript [0062] To analyze the genomic events leading to the expression of a chimeric API2-MLT transcript, we cloned the genomic breakpoints of case 1. To this aim, an 8 kb EcoRI fragment spanning the breakpoint was subcloned from fragment H. Southern hybridization with the 5′ and the 3′ end fragments of this clone detected rearranged EcoRI fragments of respectively 6 kb containing the 5′ end of MLT and 10 kb containing the 3′ end of MLT ( [0063] Two strategies are applied to evaluate the oncogenic properties of the API2-MLT fusion in vivo. [0064] In a first approach, we generate via a bone marrow transplant (“BMT”) mice that express the API2-MLT fusion in their bone marrow cells. Lethally irradiated recipient mice are rescued by transplantation with donor bone marrow that are earlier retrovirally infected with a construct that expresses the API2-MLT fusion protein. [0065] In a second approach, the API2-MLT fusion is introduced in a germline of mice through a human chromosomal vector (HCV). After incorporation of an API2-MLT fusion construct in the HCV via Cre-mediated homologous recombination in hamster cells, the vector is shuffled via microcell-mediated chromosome transfer to mouse ES cells for the generation of transchromosomal (transgenic) mice. B-cell specific expression of the API2-MLT fusion protein is achieved by using a B-cell specific promoter or by removal of a repressor element via a recombinase-mediated system driven by a B-cell specific promoter. [0066] The mice models are used to assess the role of antigen triggering in the development and growth of gastric MALT lymphomas by infection with [0067] The present example relates to the characterization of the genomic organization of the MLT gene. The information is used to amplify the genomic breakpoint junctions for five MALT-type lymphomas with t(11;18)(q21;q21). Sequences near the breakpoint junctions do not yield evidence for the participation of site-specific recombinases or Alu-mediated homologous recombination in the generation of the t(11;18). Clustering of the breakpoints in intron 7 of API2 and the consistency of “in-frame” API2-MLT fusions therefore point to a selective advantage associated with these fusions which leads to their clonal outgrowth. [0068] Materials and Methods [0069] Patients [0070] Five patients with gastric marginal zone B-cell lymphoma of MALT-type were investigated. The t(11;18) was confirmed by RT-PCR analysis for the API2-MLT fusion transcript (Baens et al. 2000). Cases 4 and 1 are cases 1 and 2 respectively of a previous study (Dierlamm et al. 1999). The features of the API2-MLT fusions for these five cases are depicted in [0071] The Genomic Structure of MLT [0072] A fetal kidney cDNA library in λgt11 was screened with a 5′ MLT probe to determine the full open reading frame of the MLT gene. MLT cDNAs for the entire open reading frame were used as probes on high-density filters containing 1 kb subclones of PAC 152M5. Purified PAC DNA was sonicated and the ends were blunted by successive treatment with respectively T4 DNA polymerase (AP Biotech, Uppsala, Sweden) and Klenow DNA polymerase (AP Biotech) in the presence of the 4 dNTPs. The fraction between 800 and 1500 bp was gel-purified (Qiaquick Gel Extraction, Qiagen, Hilden, Germany) and cloned into pUC18, linearized with SmaI and dephosphorylated (AP Biotech). Subclones identified by the MLT cDNA probes were sequenced to determine the exon-intron junctions. A vectorette PCR approach (Riley et al. 1990) was applied to amplify exon-intron boundaries absent in the subclone library. [0073] Nucleotide sequencing reactions were carried out by dideoxynucleotide chain-termination with FITC-dATP or fluorescently labeled primers and analyzed on an Automated Laser Fluorescence sequencer (AP Biotech). Sequences were aligned with the Seqman software (DNAstar Inc.). Repeatmasker software developed by the University of Washington was used to identify repetitive elements. [0074] Characterization of the Genomic API2-MLT and MLT-API2 Fusion Fragments [0075] Nested or heminested amplification was performed using the Expand Long Template PCR System according to the manufacturer's recommendations (Roche Diagnostics, Mannheim, Del.). Primers used for amplification are summarized in Table 2. PCR amplification products were gel-purified (Qiaquick Gel Extraction, Qiagen), phosphorylated with T4 polynucleotide kinase (AP Biotech) and sonicated, and the fraction between 800 and 1500 bp was gel purified and cloned in pUC18/SmaI/BAP (AP Biotech). Intron 7 of API2 was amplified using primers API2-1374f and API2-1546r with as template DNA of PAC 523024, containing the API2 gene. Subcloning and sequencing was performed as described above. The genomic API2-MLT and MLT-MMP20 fusion fragments of case 4 were characterized in a previous study (Dierlamm et al. 1999). [0076] Results [0077] The Genomic Structure of the MLT Gene [0078] The present invention discloses an MLT consensus cDNA sequence of 2491 bp (Genbank Accession number AF130356). A fetal kidney cDNA library was screened with a 5′ cDNA probe and two hybridizing clones were identified. Sequence analysis revealed additional 5′ sequences with an “in frame” ATG start codon at position 165 (Genbank Accession number AF130356). To determine the genomic organization of MLT, we generated a 1 kb subclone library of PAC 152M5 containing the MLT gene. Southern hybridizations confirmed the presence of 5′ and 3′ MLT sequences in this PAC clone. MLT cDNAs were used as probes on high-density filters containing the 1 kb subclones of PAC 152M5. Sequence analysis of hybridizing clones yielded the flanking intron sequences for all exons except exon 14 (3′ acceptor of preceding intron missing). A vectorette PCR approach (Riley et al. 1990) was applied to characterize the missing boundary for exon 14. Base pairs 1-373 of the consensus cDNA sequence belong to exon 1 and show a high GC content (78%) with 48 CpG dinucleotides and recognition sequences for several rare cutting restriction enzymes (SacII, NarI, NaeI). In total, 17 exons all flanked by canonical splice donor and acceptor sites were identified (Table 1). The size of the introns was estimated by long range PCR with exon specific primers and/or restriction mapping. It shows that the MLT gene is approximately 80 kb in size (Table 1 and [0079] The Genomic Breakpoint Junctions for 5 MALT-Type Lymphomas with t(11;18) [0080] Five marginal zone B-cell lymphomas of MALT-type were selected from 11 cases identified with an API2-MLT fusion as part of large screening of gastric lymphomas (Baens et al. 2000). All 11 cases had their chromosome 11 breakpoint in the 5 kb intron between exon 7 and 8 of API2 (exon numbering according to Young et al. 1999). The genomic structure of MLT shows that the chromosome 18 breakpoint in these cases occurs upstream of exon 3, 5, 8 or 9 respectively and that the intron sizes permit amplification of the genomic fusion fragments using API2 and MLT exon primers (Table 2). Genomic DNA extracted from a frozen tissue block comprising the lymphoma was used as a template. Nested or heminested amplification yielded the genomic API2-MLT and MLT-API2 amplification products for all cases, except for case 2 where no MLT-API2 fragment could be amplified (Table 2). All fragments were partially sequenced until the breakpoint junctions were detected by comparison with the intron 7 sequence of API2 (Acc. No. AF178945). The sequence of the latter was determined from a 5 kb PCR fragment amplified from PAC 532024 with primers for exon 7 and 8 of API2 (Table 2). Sequences fused to API2 were then used to screen high-density filters containing the 1 kb subclones of PAC 152M5 to obtain the MLT sequences flanking the breakpoint. [0081] The genomic breakpoints on chromosome 11 are scattered in intron 7 of API2 ( [0082] Characteristic Sequences Near the Breakpoints [0083] Computer-based FINDPATTERN® searches were performed to identify sequence motifs that might reveal a common mechanism for DNA breakage and rejoining. In lymphoid neoplasms, the presence of heptamer-nonamer recombination signals at or near the breakpoints suggests the involvement of V(D)J recombinase activity in the illegitimate recombination events leading to these translocations (Tycko and Sklar 1990). We did not find appropriate antigen receptor gene-like signals within the chromosome 11 and 18 sequences flanking the breakpoint junctions. The absence of non-template N nucleotides at the fusion junctions, characteristic for V(D)J recombination, further argues against its involvement. [0084] Several other sequence motifs that could potentially infer recombination or genetic instability leading to chromosomal translocation have been reported, such as the DNA topoisomerase II binding and cleavage site (Negrini et al. 1993; Gu et al. 1994; Domer et al. 1995) χ-like sequences (Wyatt et al. 1992), the translin-binding consensus sequence (Jaeger et al. 1993; Aoki et al. 1995) and alternating polypurine-polypyrimidine stretches (Boehm et al. 1989; Thandla et al. 1999; Wiemels and Greaves 1999; Thandla et al. 1999; Wiemels and Greaves 1999). None of these sites were consistently present near the breakpoint junctions. An 18/18 bp match for the topoisomerase II consensus sequence was only observed for case 1. Degenerated sequences (15 to 16 bp match on 18) were identified on one or both participating chromosomes for 4 out of 5 cases, but their position relative to the breakpoint does not imply any causality. Based on the same criteria, a recombination event mediated by χ-like elements could be excluded. Furthermore, no regions homologous to the Translin-binding consensus sequence or with alternating polypurine/polypyrimidine stretches were apparent. [0085] Homologous recombination between human Alu repeats located on the same or different chromosomes has been reported to cause chromosomal translocations (Jeffs et al. 1998; Strout et al. 1998). Alu repeats are also often observed in the vicinity of breakpoints and it is speculated that their mutual attraction juxtaposes these different chromosomal regions and in this way facilitates recurrent rearrangements between them (Obata et al. 1999). Repetitive sequences near the breakpoint junctions were identified using REPEATMASKER® and are summarized in [0086] 1. Tycko B, Sklar J: Chromosomal translocations in lymphoid neoplasia: a reappraisal of the recombinase model. Cancer Cells 2:1, 1990 [0087] 2. Harris N L, Jaffe E S, Stein H, Banks P M, Chan J K, Cleary M L, Delsol G, De-Wolf-Peeters C, Falini B, Gatter K C: A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group. Blood 84:1361, 1994 [0088] 3. De-Wolf-Peeters C, Pittaluga S, Dierlamm J, Wlodarska I, Van-den-Berghe H: Marginal zone B-cell lymphomas including mucosa-associated lymphoid tissue type lymphoma (MALT), monocytoid B-cell lymphoma and splenic marginal zone cell lymphoma and their relation to the reactive marginal zone. Leuk. Lymphoma 26:467, 1997 [0089] 4. Hussell T, Isaacson P G, Crabtree J E, Spencer J: Helicobacter pylori-specific tumor-infiltrating T cells provide contact dependent help for the growth of malignant B cells in low-grade gastric lymphoma of mucosa-associated lymphoid tissue. J. Pathol. 178:122, 1996 [0090] 5. Wotherspoon A C, Doglioni C, Diss T C, Pan L, Moschini A, de-Boni M, Isaacson P G: Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet 342:575, 1993 [0091] 6. Bayerdorffer E, Neubauer A, Rudolph B, Thiede C, Lehn N, Eidt S, Stolte M: Regression of primary gastric lymphoma of mucosa-associated lymphoid tissue type after cure of [0092] 7. Qin Y, Greiner A, Trunk M J, Schmausser B, Ott M M, Muller H H: Somatic hypermutation in low-grade mucosa-associated lymphoid tissue-type B-cell lymphoma. Blood 86:3528, 1995 [0093] 8. Tierens A, Delabie J, Pittaluga S, Driessen A, DeWolf P C: Mutation analysis of the rearranged immunoglobulin heavy chain genes of marginal zone cell lymphomas indicates an origin from different marginal zone B lymphocyte subsets. Blood 91:2381, 1998 [0094] 9. Auer I A, Gascoyne R D, Connors J M, Cotter F E, Greiner T C, Sanger W G, Horsman D E: t(11;18)(q21;q21) is the most common translocation in MALT lymphomas. Ann. Oncol. 8:979, 1997 [0095] 10. Clark H M, Jones D B, Wright D H: Cytogenetic and molecular studies of t(14;18) and t(14;19) in nodal and extranodal B-cell lymphoma. J. Pathol. 166:129, 1992 [0096] 11. Dierlamm J, Pittaluga S, Wlodarska I, Stul M, Thomas J, Boogaerts M, Michaux L, Driessen A, Mecucci C, Cassiman J J, et al.: Marginal zone B-cell lymphomas of different sites share similar cytogenetic and morphologic features. Blood 87:299, 1996 [0097] 12. Horsman D, Gascoyne R, Klasa R, Coupland R: t(11;18)(q21;q21.1): a recurring translocation in lymphomas of mucosa-associated lymphoid tissue (MALT)? Genes Chromosomes. Cancer 4:183, 1992 [0098] 13. Kubonishi I, Sugito S, Kobayashi M, Asahi Y, Tsuchiya T, Yamashiro T, Miyoshi I: A unique chromosome translocation, t(11;12;18)(q13;q13;q12), in primary lung lymphoma. Cancer Genet. Cytogenet. 82:54, 1995 [0099] 14. Ott G. Katzenberger T. Greiner A, Kalla J, Rosenwald A, Heinnich U, Ott M M, Muller H H: The t(11;18)(q21;q21) chromosome translocation is a frequent and specific aberration in low-grade but not high-grade malignant non-Hodgkin's lymphomas of the mucosa-associated lymphoid tissue (MALT-) type. Cancer Res. 57:3944, 1997 [0100] 15. Robledo M, Benitez J, Rivas C, Martinez C P: Cytogenetic study of B-cell lymphoma of mucosa-associated lymphoid tissue. Cancer Genet. Cytogenet. 62:208, 1992 [0101] 16. Whang P J, Knutsen T, Jaffe E, Raffeld M, Zhao W I, Duffey P, Longo D L: Cytogenetic study of two cases with lymphoma of mucosa-associated lymphoid tissue. Cancer Genet. Cytogenet. 77:74, 1994 [0102] 17. Wotherspoon A C, Pan L X, Diss T C, Isaacson P G: Cytogenetic study of B-cell lymphoma of mucosa-associated lymphoid tissue. Cancer Genet. Cytogenet. 58:35, 1992 [0103] 18. Leroux D, Seite P, Hillion J, Le-Marc'hadour F, Pegourie B B, Jacob M C, Larsen C J, Sotto J J: t(11;18)(q21;q21) may delineate a spectrum of diffuse small B-cell lymphoma with extranodal involvement. Genes Chromosomes. Cancer 7:54, 1993 [0104] 19. Levine E G, Arthur D C, Machnicki J, Frizzera G, Hurd D, Peterson B, Gail P K, Bloomfield C D: Four new recurring translocations in non-Hodgkin lymphoma. Blood 74:1796, 1989 [0105] 20. Griffin C A, Zehnbauer B A, Beschorner W E, Ambinder R, Mann R: t(11;18)(q21;q21) is a recurrent chromosome abnormality in small lymphocytic lymphoma. Genes Chromosomes. Cancer 4:153, 1992 [0106] 21. Dierlamm J, Michaux L, Wlodarska I, Pittaluga S, Zeller W, Stul M, Criel A, Thomas J, Boogaerts M, Delaere P, Cassiman J J, De-Wolf-Peeters C, Mecucci C, Van-den-Berghe H: Trisomy 3 in marginal zone B-cell lymphoma: a study based on cytogenetic analysis and fluorescence in situ hybridization. Br. J. Haematol. 93:242, 1996 [0107] 22. Rothe M, Pan M G, Henzel W J, Ayres T M, Goeddel D V: The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins. Cell 83:1243, 1995 [0108] 23. Liston P, Roy N, Tamai K, Lefebvre C, Baird S, Cherton H G, Farahani R, McLean M, Ikeda J E, MacKenzie A, Korneluk R G: Suppression of apoptosis in mammalian cells by NAIP and a related family of IAP genes. Nature 379:349, 1996 [0109] 24. Uren A G, Pakusch M, Hawkins C J, Puls K L, Vaux D L: Cloning and expression of apoptosis inhibitory protein homologs that function to inhibit apoptosis and/or bind tumor necrosis factor receptor-associated factors. Proc. Natl. Acad. Sci. U.S.A 93:4974, 1996 [0110] 25. Dierlamm J, Wlodarska I, Michaux L, La Starza R: Successful Use of the Same Slide for Consecutive Fluorescence In Situ Hybridization Experiments. Genes Chromosomes. Cancer 16:261, 1996 [0111] 26. Chumakov I M, Rigault P, Le G, I, Bellanne C C, Billault A, Guillou S, Soularue P, Guasconi G, Poullier E, Gros I, Belova M, Sambucy J-L, Susini L, Gervy P, Gilbert F, Beaufils S, Bui H, Massart C, De Tand M-F, Dukasz F, Lecoulant S, Ougen P, Perrot V, Saumier M, Soravito C, Bahouayila R, Cohen-Akenine A, Barillot E, Bertrand S, Codani J-J, Caterina D, Georges I, Lacroix B, Lucotte G, Sahbatou M, Schmidt C, Sangouard M, Tubacher E, Dib C, Fauré S, Fizames C, Gyapay G, Millaseau P, Nguyen S, Muselet D, Vignal A, Morissette J, Menninger J, Lieman J, Desai T, Banks A, Bray-Ward P, Ward D, Hudson T J, Gerety S S, Foote S, Stein L, Page D C, Lander E S, Weissenbach J, Le Paslier D, Cohen D: A YAC contig map of the human genome. Nature 377:175, 1995 [0112] 27. Poetsch M, Weber M K, Plendl H J, Grote W, Schlegelberger B: Detection of the t(14;18) chromosomal translocation by interphase cytogenetics with yeast-artificial-chromosome probes in follicular lymphoma and nonneoplastic lymphoproliferation. J. Clin. Oncol. 14:963, 1996 [0113] 28. Lengauer C, Green E D, Cremer T: Fluorescence in situ hybridization of YAC clones after Alu-PCR amplification. Genomics 13:826, 1992 [0114] 29. Riley J, Butler R, Ogilvie D, Finniear R, Jenner D, Powell S, Anand R, Smith J C, Markham A F: A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18:2887, 1990 [0115] 30. Hofmann K, Bucher P. Tschopp J: The CARD domain: a new apoptotic signaling motif. Trends Biochem. Sci. 22:155, 1997 [0116] 31. Saurin A J, Borden K L, Boddy M N, Freemont P S: Does this have a familiar RING? Trends Biochem. Sci. 21:208, 1996 [0117] 32. Willis T G, Jadayel D M, Coignet L J, Abdul R M, Treleaven J G, Catovsky D, Dyer M J: Rapid molecular cloning of rearrangements of the IGHJ locus using long-distance inverse polymerase chain reaction. Blood 90:2456, 1997 [0118] 33. Clem R J, Fechheimer M, Miller L K: Prevention of apoptosis by a baculovirus gene during infection of insect cells. Science 254:1388, 1991 [0119] 34. Hay B A, Wassarman D A, Rubin G M: Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death. Cell 83:1253, 1995 [0120] 35. Roy N, Deveraux Q L, Takahashi R, Salvesen G S, Reed J C: The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 16:6914, 1997 [0121] 36. Duckett C S, Nava V E, Gedrich R W, Clem R J, Van-Dongen J L, Gilfillan M C, Shiels H, Hardwick J M, Thompson C B: A conserved family of cellular genes related to the baculovirus iap gene and encoding apoptosis inhibitors. EMBO J. 15:2685, 1996 [0122] 37. Ambrosini G, Adida C, Altieri D C: A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma. Nat. Med. 3:917, 1997 [0123] 38. Deveraux Q L, Roy N, Stennicke H R, Van-Arsdale T, Zhou Q, Srinivasula S M, Alnemri E S, Salvesen G S, Reed J C: IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases. EMBO J. 17:2215, 1998 [0124] 39. Du M, Singh N, Husseuin A, Isaacson P G, Pan L: Positive correlation between apoptotic and proliferative indices in gastrointestinal lymphomas of mucosa-associated lymphoid tissue (MALT). J. Pathol. 178:379, 1996 [0125] 40. Greiner A, Seeberger H, Knorr C, Starostik P, Müiller-Hermelinck H K: MALT-type B-cell lymphomas escape the censoring FAS-mediated apoptosis. Blood 92 Suppl.1:#1997, 1998 (abstr.) [0126] 41. Jain V K, Judde J G, Max E E, Magrath I T: Variable IgH chain enhancer activity in Burkitt's lymphomas suggests an additional, direct mechanism of c-myc deregulation. J. Immunol. 150:5418, 1993 [0127] 42. Adida C, Crotty P L, McGrath J, Berrebi D, Diebold J, Altieri D C: Developmentally regulated expression of the novel cancer anti-apoptosis gene survivin in human and mouse differentiation. Am. J. Pathol. 152:43, 1998 [0128] Akagi T, Motegi M, Tamura A, Suzuki R, Hosokawa Y, Suzuki H, Ota H, Nakamura S, Morishima Y, Taniwaki M, Seto M: A novel gene, MALT1 at 18q21, is involved in t(11;18) (q21;q21) found in low-grade B-cell lymphoma of mucosa-associated lymphoid tissue. Oncogene 18: 5785-5794, 1999 [0129] Aoki K, Suzuki K, Sugano T, Tasaka T, Nakahara K, Kuge O, Omori A, Kasai M: A novel gene, Translin, encodes a recombination hotspot binding protein associated with chromosomal translocations. Nat. Genet. 10: 167-174, 1995 [0130] Aplan P D, Raimondi S C, Kirsch I R: Disruption of the SCL gene by a t(1;3) translocation in a patient with T cell acute lymphoblastic leukemia. J. Exp. Med. 176: 1303-1310, 1992 [0131] Baens M, Maes B, Steyls A, Geboes K, Marynen P, De Wolf-Peeters C: The product of the t(11;18), an API2-MLT fusion, marks nearly half of the gastro-intestinal MALT type lymphomas without large cell proliferation. Am. J. Pathol.156:1433-1439 [0132] Baguley B C, Ferguson L R: Mutagenic properties of topoisomerase-targeted drugs. Biochim. Biophys. Acta 1400: 213-222, 1998 [0133] Bernard O A, Berger R: Molecular basis of 11q23 rearrangements in hematopoietic malignant proliferations. Genes Chromosomes. Cancer 13: 75-85, 1995 [0134] Boehm T, Mengle-Gaw L, Kees U R, Spurr N, Lavenir I, Forster A, Rabbitts T H: Alternating purine-pyrimidine tracts may promote chromosomal translocations seen in a variety of human lymphoid tumors. EMBO J. 8: 2621-2631, 1989 [0135] Chissoe S L, Bodenteich A, Wang Y F, Wang Y P, Burian D, Clifton S W, Crabtree J, Freeman A, Iyer K, Jian L, et al.: Sequence and analysis of the human ABL gene, the BCR gene, and regions involved in the Philadelphia chromosomal translocation. Genomics 27: 67-82, 1995 [0136] Dierlamm J, Baens M, Wlodarska I, Stefanova O M, Hernandez J M, Hossfeld D K, De-Wolf-Peeters C, Hagemeijer A, Van-den-Berghe H, Marynen P: The apoptosis inhibitor gene API2 and a novel 18q gene, MLT, are recurrently rearranged in the t(11;18) (q21;q21) p6ssociated with mucosa-associated lymphoid tissue lymphomas. Blood 93: 3601-3609, 1999 [0137] Domer P H, Head D R, Renganathan N, Raimondi S C, Yang E, Atlas M: Molecular analysis of 13 cases of MLL/11q23 secondary acute leukemia and identification of topoisomerase II consensus-binding sequences near the chromosomal breakpoint of a secondary leukemia with the t(4;11). Leukemia 9:1305-1312, 1995 [0138] Golub T R, Barker G F, Bohlander S K, Hiebert S W, Ward D C, Bray-Ward P, Morgan E, Raimondi S C, Rowley J D, Gilliland D G: Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia. Proc. Natl. Acad. Sci. U.S.A 92: 4917-4921, 1995 [0139] Gu Y, Alder H, Nakamura T, Schichman S A, Prasad R, Canaani O, Saito H, Croce C M, Canaani E: Sequence analysis of the breakpoint cluster region in the ALL-1 gene involved in acute leukemia. Cancer Res. 54: 2326-2330, 1994 [0140] Harris N L, Jaffe E S, Diebold J, Flandrin G, Muller-Hermelink H K, Vardiman J, Lister T A, Bloomfield C D: World Health Organization Classification of Neoplastic Diseases of the Hematopoietic and Lymphoid Tissues: Report of the Clinical Advisory Committee Meeting-Airlie House, Va., November 1997. J. Clin. Oncol. 17: 3835-3849, 1999 [0141] Jaeger U, Purtscher B, Karth G D, Knapp S, Mannhalter C, Lechner K: Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein. Blood 81: 1833-1840, 1993 [0142] Jeffs A R, Benjes S M, Smith T L, Sowerby S J, Morris C M: The BCR gene recombines preferentially with Alu elements in complex BCR-ABL translocations of chronic mycloid leukaemia. Hum. Mol. Genet 7: 767-776, 1998 [0143] Lochner K, Siegler G, Fuhrer M, Greil J. Beck J D, Fey G H, Marschalek R: A specific deletion in the breakpoint cluster region of the ALL-1 gene is associated with acute lymphoblastic T-cell leukemias. Cancer Res. 56: 2171-2177, 1996 [0144] Maes B, Baens M, Marynen P, De Wolf-Peeters C: The product of the t(11;18), an API2-MLT fusion, is an almost exclusive finding in marginal zone cell lymphoma of extranodal MALT-type. Ann. Oncol., in press [0145] Maraschin J, Dutrillaux B, Aurias A: Chromosome aberrations induced by etoposide (VP-16) are not random. Int. J. Cancer 46: 808-812. 1990 [0146] Mitelman F, Mertens F, Johansson B: A breakpoint map of recurrent chromosomal rearrangements in human neoplasia. Nat. Genet. 15 Spec No: 417-474, 1997 [0147] Negrini M, Felix C A, Martin C, Lange B J, Nakamura T, Canaani E, Croce C M: Potential topoisomerase II DNA-binding sites at the breakpoints of a t(9;11) chromosome translocation in acute myeloid leukemia. Cancer Res. 53: 4489-4492, 1993 [0148] Obata K, Hiraga H, Nojima T, Yoshida M C, Abe S: Molecular characterization of the genomic breakpoint junction in a t(11;22) translocation in Ewing sarcoma. Genes Chromosomes. Cancer 25: 6-15, 1999 [0149] Reichel M, Gillert E, Nilson I, Siegler G, Greil J, Fey G H, Marsehalek R: Fine structure of translocation breakpoints in leukemic blasts with chromosomal translocation t(4;11): the DNA damage-repair model of translocation. Oncogene 17: 3035-3044, 1998 [0150] Romana S P, Poirel H, Leconiat M, Flexor M A, Mauchauffe M, Jonveaux P, Macintyre E A, Berger R, Bernard O A: High frequency of t(12;21) in childhood B-lineage acute lymphoblastic leukemia. Blood 86: 4263-4269, 1995 [0151] Rosenwald A, Ott G, Stilgenbauer S, Kalla J, Bredt M, Katzenberger T, Greiner A, Ott M M, Gawin B, hner H, ller-Hermelink H K: Exclusive Detection of the t(11;18)(q21;q21) in Extranodal Marginal Zone B Cell Lymphomas (MZBL) of MALT Type in Contrast to other MZBL and Extranodal Large B Cell Lymphomas. Am. J. Pathol. 155: 1817-1821, 1999 [0152] Sambrook J, Fritsch E, Maniatis T: Molecular cloning: A laboratory manual. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989 [0153] Showe L C, Croce C M: The role of chromosomal translocations. Annu. Rev. Immunol. 5: 253-277, 1987 [0154] Strout M P, Marcucci G, Bloomfield C D, Caligiuri M A: The partial tandem duplication of ALL1 (MLL) is consistently generated by Alu-mediated homologous recombination in acute myeloid leukemia. Proc. Natl. Acad. Sci. U.S.A 95: 2390-2395, 1998 [0155] Thandla S P, Ploski J E, Raza E S, Chhalliyil P P, Block A W, de-Jong P J, Aplan P D: ETV6-AML1 translocation breakpoints cluster near a purine/pyrimidine repeat region in the ETV6 gene. Blood 93: 293-299, 1999 [0156] Toth G, Jurka J: Repetitive DNA in and around translocation breakpoints of the Philadelphia chromosome. Gene 140: 285-288, 1994 [0157] Tsujimoto Y, Gorham J, Cossman J, Jaffe E, Croce C M: The t(14;18) chromosome translocations involved in B-cell neoplasms result from mistakes in VDJ joining. Science 229: 1390-1393, 1985 [0158] Wiemels J L, Greaves M: Structure and possible mechanisms of TEL-AML1 gene fusions in childhood acute lymphoblastic leukemia. Cancer Res. 59: 4075-4082, 1999 [0159] Wyatt R T, Rudders R A, Zelenetz A, Delellis R A, Krontiris T G: BCL2 oncogene translocation is mediated by a chi-like consensus. J. Exp. Med. 175: 1575-1588, 1992 [0160] Young S S, Liston P, Xuan J Y, McRoberts C, Lefebvre C A, Korneluk R G: Genomic organization and physical map of the human inhibitors of apoptosis: HIAP1 and HIAP2. Mamm. Genome 10: 44-48, 1999
BACKGROUND OF THE INVENTION
Technical Field
BRIEF SUMMARY OF THE INVENTION
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
DETAILED DESCRIPTION OF THE INVENTION
EXAMPLES
1. Characterization of the 11q21 and 18q21 Translocation and Cloning of the Fusion Genes
2. Evaluation of the Oncogenic Properties of the API2-MLT Fusion
3. Structure of the MLT Gene and Molecular Characterization of the Genomic Breakpoint Junctions in the t(11;18)(q21;q21) of Marginal Zone B-cell Lymphomas of MALT Type
API2-MLT Primer Locus Size (kb) Sequence 1r API2-1266f Exon 7 5′-ATTAATGCTGCCGTGGAAAT 2r API2-1301f Exon 7 (SEQ ID NO:41) 5′-CCTGGTAAAACAGACAGTTCAGA (SEQ ID NO:42) case 1 MLT-i2r1 Intron 5′-CAGGTGGTGGATAACGTGGAGTTT 1r MLT-i2r2 2 8 (SEQ ID NO:43) 2r Intron 5′-CACAAATCTGCCTGGCCAGAGAAG 2 (SEQ ID NO:44) case 2/3 MLT-984r Exon 5 5′-GCTTTTTGGTCTCATGTGTTAATG 1r MLT-929r Exon 5 10/7 (SEQ ID NO:45) 2r 5′-AATAGGGCTTCCAACAGCAA (SEQ ID NO 46) case 4 MLT-1147r Exon 8 5 5′-GGATGACCAAGATTATTTAATTCA 1-2r (SEQ ID NO:47) case 5 MLT-1181r Exon 9 ˜1 5′-CAAAGGCTGGTCAGTTGTTTG 1-2r (SEQ ID NO :48) MLT-API2 Primer Locus Sequence 1r API2-1684r Exon 8 5′-AACACAGCTTCAGCTTCTTGC (SEQ ID NO:49) 2r API2-1546r Exon 8 5′-TTAATAATTCCGGCAGTTAGTAGAC (SEQ ID NO:50) case 1 MLT-i2f1 Intron 5′-GGTTGAGCTTGGAAAGACAAAGG 1r 2 (SEQ ID NO:51) 2r MLT-i2f2 Intron 6 5′-ACCTGATGCACTCTATTTTACGTGG 2 (SEQ ID NO:52) case2/3 MLT-717f Exon 4 5′-GCAGGCTTTTATGTCTGTCG 1r (SEQ ID NO:53) 2r MLT-757f Exon 4 2.2 5′-TTGAATTCAGCCAGTGGTCA (SEQ ID NO:54) case 4 previously 0.65 (Dierlamm done et al, 1999) case 5 MLT-i8fl Intron 5′-CTTTTGTAAATAGCCACCACTAAGATT 1r 8 (SEQ ID NO:55) 2r MLT-i8f2 Intron 5 5′-TTCCCACAATTCAGGGAGTACCAAA 8 (SEQ ID NO:56) 1r: first round primer 2r: second round primer 1-2r: first and second round primer Reference List