Transmembrane B ephrins and their Eph receptors signal bi-directionally. The presently claimed invention describes a cytoplasmic protein, designated PDZ-RGS3, which binds B ephrins through a PDZ domain, and has a regulator of heterotrimeric G protein signaling (RGS) domain. PDZ-RGS3 mediates signaling from the ephrin-B cytoplasmic tail. SDF-1, a chemokine with a G protein coupled receptor, or BDNF, act as chemoattractants for cerebellar granule cells, with SDF-1 action being selectively inhibited by soluble EphB receptor. The claimed invention reveals a pathway that links reverse signaling to cellular guidance, uncovers a novel mode of control for G proteins, and demonstrates a mechanism for selective regulation of responsiveness to neuronal guidance cues. Further, compositions and methods of use are provided for modulating cell migration as a function of chemokines and GPCR interaction, to aid in the treatment of disease states and medical conditions, including cancer and immune responses such as allergy and autoimmune responses. In one embodiment, a method of altering the sensitivity of a cell to a chemokine is provided using a PDZ-RGS3 protein.
1. An amino acid sequence having a PDZ domain and an RGS domain. 2. A protein comprising an amino acid sequence substantially identical to that shown in SEQ ID NO: 1. 3. A nucleic acid encoding the amino acid sequence according to 4. A nucleic acid that hybridizes to the nucleic acid according to 5. A recombinant vector comprising the nucleic acid according to 6. A recombinant cell containing the vector according to 7. A protein according to 8 A protein according to 9. A protein encoded by a gene, the protein having an RGS domain and a PDZ domain, the PDZ domain being capable of binding to a portion of a cytoplasmic domain of an ephrin-B2 in a cell. 10. A protein according to 11. A protein according to any of 12. A protein according to 13. A protein according to 14. A protein according to 15. A protein according to 16. A protein according to 17. A protein according to 18. A protein according to 19. A protein according to 20. A protein according to 21. A protein according to 22. A soluble epHB2 receptor capable of binding a cell, such that a pattern of migration of the cell is altered. 23. A method of altering sensitivity of a cell to a chemokine, comprising:
transmitting a reverse signal from a recombinant soluble ephB2 receptor to a transmembrane protein in the cell which is a ligand of the ephB2 receptor; binding a cytoplasmic protein, the cytoplasmic protein having an RGS domain and a PDZ domain, to the cytoplasmic domain of the transmembrane protein in the cell; and altering a reaction of a G-protein coupled receptor (GPCR) in the membrane of the cell, such that the cell has altered sensitivity to a chemoattractant chemokine. 24. A method according to 25. A method according to 26. A method according to 27. A method according to 28. A method according to 29. A method according to 30. A method according to 31. A method according to 32. A method according to 33. A method according to 34. A method of modulating an intracellular pathway involved in cell migration upon the event of a cell to cell contact, comprising:
initiating ephrin signaling by providing cell to cell contact in a cell having a cytoplasmic protein, the cytoplasmic protein having an amino terminus that interacts with the carboxy terminus of ephrin, and having a carboxy terminus that affects a GTP-linked reaction of a seven transmembrane protein, causing the cell in the presence of sufficient chemokine to otherwise inhibit such migration from an initial anatomical location and towards a target location. 35. A method according to 36. A method of screening in a test sample for the presence of an agent that alters in vivo functional interactions among the components of an ephrin-B signal pathway involving chemoattraction by a chemokine, comprising:
placing chemokine-sensitive cells having the ephrin-B ligand on a top side of a filter in an upper chamber of a transwell system, wherein the filter has pores of uniform size and separates the upper chamber from a lower chamber, and wherein the lower chamber contains the chemokine; adding a test sample to the lower chamber; and analyzing the lower side of the filter to determine an amount of migration of the cells into the lower chamber. 37. A method according to 38. A method according to 39. A method according to 40. A method according to 41. A method according to 42. A method according to 43. A method according to 44. A method according to 45. A method according to claim any one of claims 41 or 43, wherein the agent is a low molecular weight synthetic organic chemical. 46. A pharmaceutical composition for delivering to a selected site an effective dose of a protein having an RGS domain and a PDZ domain capable of altering the sensitivity of a cell to a chemokine comprising an effective dose of said protein and a suitable carrier, and optionally additional active or inert ingredients such as diluents, stabilizers, and excipients. 47. A pharmaceutical composition according to 48. A pharmaceutical composition according to 49. A pharmaceutical composition according to 50. A pharmaceutical composition according to 51. A pharmaceutical composition for delivering to a selected site an effective dose of a soluble protein having an Eph receptor ectodomain, said soluble protein being capable of altering a cell signaling pathway comprising:
an effective dose of said soluble protein; a suitable carrier; and optionally additional active or inert ingredients such as diluents, stabilizers, and excipients. 52. A pharmaceutical composition according to 53. A pharmaceutical composition according to 54. A pharmaceutical composition according to 55. A pharmaceutical composition according to 56. A pharmaceutical composition according to 57. A pharmaceutical composition according to 58. A viral vector comprising the nucleic acid sequence encoding the protein of 59. A plasmid comprising the nucleic acid sequence encoding the protein of 60. A plasmid vector encoding the protein of 61. A plasmid vector encoding the protein of
[0001] This application gains priority from U.S. Provisional Application No. 60/280,260, filed Mar. 30, 2001, which is hereby incorporated by reference in its entirety herein. [0002] The invention was made in part with government support under grants HD29417 and NS40043 awarded by the National Institutes of Health. The government has certain rights in the invention. [0003] The present invention relates to ephrin reverse signaling in vertebrate cells, particularly cerebellar granular cells and leukocytes, the signaling acting through a novel PDZ-RGS protein, to block a heterotrimeric G protein pathway. This signaling results in inhibition of the chemoattractant effects of a chemokine, in particular, of SDF-1. Methods and compositions for modulation of the pathway provide potential therapeutic agents for inflammation and autoimmune diseases. [0004] Chemoattractant cytokines or chemokines are a family of proinflammatory mediators that promote recruitment and activation of multiple lineages of leukocytes and lymphocytes. They can be released by many kinds of tissue cells after activation. Continuous release of chemokines at sites of inflammation mediates the ongoing migration of effector cells in chronic inflammation. The chemokines characterized to date are related in primary structure. They share four conserved cysteines, which form disulfide bonds. Based upon this conserved cysteine motif, the family is divided into two main branches, designated as the C-X-C chemokines (α-chemokines), and the C-C chemokines (β-chemokines), in which the first two conserved cysteines are separated by an intervening residue, or adjacent respectively (Baggiolini, M. and Dahinden, C. A., Immunology Today, 15:127-133 (1994)). [0005] The C-X-C chemokines include a number of potent chemoattractants and activators of neutrophils, such as interleukin 8 (IL-8), PF4 and neutrophil-activating peptide-2 (NAP-2). The C-C chemokines include RANTES (Regulated on Activation, Normal T Expressed and Secreted), the macrophage inflammatory proteins 1α and 1β (MIP-1α and MIP-1β), and human monocyte chemotatic proteins 1-3 (MCP-1, MCP-2, MCP-3), which have been characterized as chemoattractants and activators of monocytes or lymphocytes but do not appear to be chemoattractants for neutrophils. Chemokines, such as RANTES and MIP-1α, have been implicated in a wide range of human acute and chronic inflammatory diseases including respiratory diseases such as asthma and allergic disorders. [0006] The chemokine receptors are members of a superfamily of G protein-coupled receptors (GPCR) which share structural features that reflect a common mechanism of action of signal transduction (Gerard, C. and Gerard, N. P., Annu Rev. Immunol., 12:775-808 (1994); Gerard, C. and Gerard, N. P., Curr. Opin. Immunol., 6:140-145 (1994)). Conserved features include seven hydrophobic domains spanning the plasma membrane, which are connected by hydrophilic extracellular and intracellular loops. The majority of the primary sequence homology occurs in the hydrophobic transmembrane regions with the hydrophilic regions being more diverse. [0007] The superfamily of GPCRs has at least 250 members (Strader et al. FASEB J., 9:745-754, 1995; Strader et al. Annu. Rev. Biochem., 63:101-32, 1994). It has been estimated that one percent of human genes may encode GPCRs. GPCRs bind to a wide-variety of ligands ranging from photons, small biogenic amines (i.e., epinephrine and histamine), peptides (i.e., IL-8), to large glycoprotein hormones (i.e., parathyroid hormone). Upon ligand binding, GPCRs regulate intracellular signaling pathways by activating guanine nucleotide-binding proteins (G proteins). GPCRs play important roles in diverse cellular processes including cell proliferation and differentiation, leukocyte migration in response to inflammation, and cellular response to light, odorants, neurotransmitters and hormones (Strader et al., supra.). [0008] Over the last fifteen years it has become apparent that many ligands that signal through cell surface receptors are themselves transmembrane molecules (Pfeffer and Ullrich, 1985; Flanagan et al., 1991; Massague and Pandiella, 1993). One function of this ligand anchorage may be to tightly localize the signal. This idea is particularly well exemplified by the ephrins, since they require membrane anchorage to activate their receptors in a direct cell-cell contact mechanism, and since they have spatially precise patterning roles. [0009] A second potential function for transmembrane ligands is to allow bi-directional signaling. Again, the ephrins have provided a particularly good model system to investigate this idea. Reverse signaling through B ephrins has been demonstrated biochemically by ligand phosphorylation. Evidence of important developmental roles has come from genetic and embryological studies of whole embryos or tissues. [0010] Ligands in the ephrin-B family are cell surface anchored by a transmembrane domain, and signal through their Eph receptors by direct cell-cell contact (Davis et al., 1994; Drescher et al., 1997; Flanagan and Vanderhaeghen, 1998; Frisen et al., 1999; Holder and Klein, 1999; Mellitzer et al., 1999). This contact-mediated mechanism provides the potential for bi-directional signaling, with a forward signal through the tyrosine kinase receptor, and a reverse signal through the ligand. Reverse signaling has been demonstrated biochemically by studies showing B ephrins become phosphorylated upon treatment of cells with soluble EphB-Fc receptor fusion protein (Holland et al., 1996; Bruckner et al., 1997). In the context of whole organisms or tissues, genetic and embryological studies have supported important roles for B ephrin reverse signaling in developmental processes, including axon pathway selection, blood vessel formation, and rhombomere compartmentation (Henkemeyer et al., 1996; Jones et al., 1998; Wang et al., 1998; Adams et al., 1999; Gerety et al., 1999; Mellitzer et al., 1999: Xu et al., 1999). However, little is known of the specific effects of B ephrin reverse signaling on individual cells, or the signal transduction pathways that lead to such effects. [0011] Evidence that B ephrins might interact with cytoplasmic proteins initially came from sequence comparison of ephrin-B1 and -B2, which show a striking 100% amino acid identity in the last 33 amino acids of the intracellular domain (Bennett et al., 1995; Bergemann et al., 1995). Using the intracellular domain in yeast two-hybrid screens, several binding proteins have been identified (Torres et al., 1998; Bruckner et al., 1999; Lin et al., 1999). All the binding proteins identified to date contain a PDZ (PSD-95/Dlg/ZO-1) domain, a protein module that binds the C-termini of membrane proteins. PDZ proteins have been widely implicated in forming sub-membrane scaffolds that cluster molecules at the cell surface (Craven and Bredt, 1998; Garner et al., 2000; Sheng and Pak, 2000). [0012] RGS proteins form a large molecular family identified in recent years, with more than 20 members in mammals (Arshavsky and Pugh, 1998; Kehrl, 1998; De Vries and Farquhar, 1999; Zheng et al., 1999). They act as GTPase activating proteins (GAPS) for heterotrimeric G proteins, accelerating the G protein catalytic cycle and thereby facilitating rapid signaling processes such as retinal phototransduction (Arshavsky and Pugh, 1998). Many RGS proteins contain additional motifs, including PDZ domains, leading to suggestions that they could couple G proteins with other signaling pathways (Kehrl, 1998; De Vries and Farquhar, 1999). The RGS protein p115RhoGEF has separate domains that regulate both heterotrimeric and small G proteins, while nematode EAT-16 mediates a genetic interaction between two heterotrimeric G protein pathways (Hart et al., 1998; Kozasa et al., 1998; Hajdu-Cronin et al., 1999). However, there is generally little functional evidence on the specific significance of combining RGS domains with other domains, including a potential role for PDZ-RGS proteins in regulating G proteins in response to extracellular signals. [0013] Heterotrimeric G protein-coupled receptors (GPCRs) are seven-transmembrane proteins that mediate the effects of many extracellular signals (Watson and Arkinstall, 1994; Bargmann and Kaplan, 1998). Some of the best characterized guidance molecules act through GPCRs (Parent and Devreotes, 1999), notably the chemokines, which are leukocyte chemoattractants with important roles in immunity (Melchers et al., 1999). A role for chemokines in neural development was shown more recently. The radial movement of cerebellar granule cells is a well characterized model for neural migration (Rakic, 1990; Hatten, 1999) and occurs prematurely in mice with gene disruptions of the chemokine SDF-1, or its receptor CXCR4 (Ma et al., 1998; Zou et al., 1998). Heterotrimeric G protein signaling may also mediate, at least in part, the actions of Netrins, Semaphorins and other neural guidance molecules, though these pathways are generally less well understood (Vancura and Jay, 1998; Corset et al., 2000; Nakamura et al., 2000). [0014] In one aspect, an embodiment of the invention provides an amino acid sequence having a PDZ domain and an RGS domain. An embodiment of the invention is a protein comprising an amino acid sequence substantially identical to that shown in SEQ ID NO: 1. Further, an embodiment of the invention is a nucleic acid encoding the amino acid sequence of the protein. The nucleic acid is an isolated nucleotide sequence encoding the amino acid sequence of the protein. Further, a nucleic acid that hybridizes to this nucleic acid is provided, as is a recombinant vector, and a recombinant cell containing the vector, comprising any of these nucleic acids. In one embodiment, the protein is encoded by a gene from a vertebrate, for example, the vertebrate is a mammal. [0015] In a further aspect, an embodiment of the invention is a protein encoded by a gene, the protein having an RGS domain and a PDZ domain, the PDZ domain being capable of binding to a portion of a cytoplasmic domain of an ephrin-B2 in a cell. For example, the binding occurs in a two-hybrid system in a yeast cell, wherein the ephrin-B2 cytoplasmic domain is used as the bait of the system. Further, the mammalian cDNA library is obtained from a tissue selected from the group consisting of an embryo, a tumor or a leukemia, for example, the tumor is of neural origin, for example, the tumor of neural origin is a neuroblastoma. [0016] In a further aspect, an embodiment of the invention is a protein having an RGS domain and a PDZ domain or a protein comprising an amino acid sequence substantially identical to that shown in SEQ ID NO: 1, wherein the protein causes stimulation of ephrin-B1 induced de-adhesion of embryonic test cells at levels of ephrin-B1 that are suboptimal, for example, when the stimulation is at least 2-fold, for example at least 4-fold, or at least 8-fold. Further, the stimulation is dependent on the presence of an amino acid sequence present in the carboxy terminal RGS domain, or the stimulation is reversed in a dose-dependent manner in the presence of the amino terminal PDZ domain and in the absence of the carboxy terminal RGS domain. Further, the embryonic test cells are from an embryo of a cold-blooded vertebrate, for example, the vertebrate is an amphibian. [0017] In a further aspect, an embodiment of the invention is a soluble eph2 receptor capable of binding a cell, such that a pattern of migration of the cell is altered. [0018] In a further aspect, an embodiment of the invention is a method of altering sensitivity of a cell to a chemokine, comprising: transmitting a reverse signal from a recombinant soluble ephB2 receptor to a transmembrane protein in the cell which is a ligand of the ephB2 receptor; binding a cytoplasmic protein, the cytoplasmic protein having an RGS domain and a PDZ domain, to the cytoplasmic domain of the transmembrane protein in the cell; and altering a reaction of a G-protein coupled receptor (GPCR) in the membrane of the cell, such that the cell has altered sensitivity to a chemoattractant chemokine. Further, the cell is selected from the group of: a leukocyte; a granule cell located in an external granule cell layer (EGL) of a developing brain cerebellum; a cell involved in migration, blood vessel formation, axon pathway selection, or rhombomere compartmentation. The transmembrane protein is substantially homologous to an ephrin-B2, or transmission of the reverse signal requires a presence of the PDZ-RGS3 protein in the first cell, or the chemokine is an SDF-1, for example, transmission of the reverse signal causes loss of responsiveness of the cell to the SDF-1. Further, when the cell is a leukocyte, the method by which the cell loses sensitivity to the chemokine is a treatment for an inflammatory condition or an autoimmune disease. Further, an embodiment of the invention provides omitting the recombinant soluble ephB2 and screening the sample for a chemical agent that substitutes functionally for the omitted ephB2, the method comprising adding a test sample to screen the sample for the presence of the agent that alters sensitivity of the cell to the chemokine. [0019] In a further aspect, an embodiment of the invention is a method of modulating an intracellular pathway involved in cell migration upon the event of a cell to cell contact, comprising: initiating ephrin signaling by providing cell to cell contact in a cell having a cytoplasmic protein, the cytoplasmic protein having an amino terminus that interacts with the carboxy terminus of ephrin, and having a carboxy terminus that affects a GTP-linked reaction of a seven transmembrane protein, causing the cell in the presence of sufficient chemokine to otherwise inhibit such migration from an initial anatomical location and towards a target location. Further, the method involves selecting the cell from a group consisting of a granule cell and a leukocyte, such that the protein mediates an intracellular pathway that causes the granule cell to migrate away from the EGL, or that causes the leukocyte to migrate into an inflamed tissue, respectively. [0020] In a further aspect, an embodiment of the invention is a method of screening for the presence in a test sample of an agent that alters in vivo functional interactions among the components of an ephrin-B signal pathway involving chemoattraction by a chemokine, comprising: placing chemokine-sensitive cells having the ephrin-B ligand on a top side of a filter in an upper chamber of a transwell system, wherein the filter has pores of uniform size and separates the upper chamber from a lower chamber, and wherein the lower chamber contains the chemokine; adding a test sample to the lower chamber; and analyzing the lower side of the filter to determine an amount of migration of the cells into the lower chamber. Further, the method comprises having a second transwell such that adding a test sample to the lower chamber of the second transwell is omitted as a control, and further comparing the amount of migration of cells in the presence and absence of the test sample is an indication of the effect of the agent on cell migration. Further, the cells are selected from a purified preparation of cerebellar granule cells and a pure cultured leukocyte cell line; further, the chemokine can be SDF-1. Further, the lower chamber contains the chemokine at a sub-optimal level, wherein the agent in the test sample causes a decrease in cell migration in comparison to the second transwell control. The agent is an anti-inflammatory or an anti-autoimmune therapeutic composition. Further, the agent causes a increase in cell migration in comparison to the control, for example, the agent is a novel chemokine, or the agent is a low molecular weight synthetic organic chemical. [0021] In other embodiments according to the claimed invention, a pharmaceutical composition is described for delivering to a selected site an effective dose of a protein having an RGS domain and a PDZ domain capable of altering the sensitivity of a cell to a chemokine comprising an effective dose of said protein and a suitable carrier, and optionally additional active or inert ingredients such as diluents, stabilizers, and excipients. [0022] Another embodiment in accordance with the present invention includes a pharmaceutical composition for delivering to a selected site an effective dose of a protein having an RGS domain and a PDZ domain capable of altering the sensitivity of a cell to a chemokine comprising an effective dose of said protein and a suitable carrier, and optionally additional active or inert ingredients such as diluents, stabilizers, and excipients, wherein the pharmaceutical composition is administered intradermally, intramuscularly, subcutaneously, topically, or in the form of a vector. In addition, the presently claimed invention describes a pharmaceutical composition as above further comprising a substance that allows for the slow release of the pharmaceutical composition at the selected site. Still yet another embodiment in accordance with the present invention is a pharmaceutical composition as above wherein the selected site for delivery is a tumor site, or an allergic response site, or an autoimmune response site. [0023] Another embodiment in accordance with the present invention is a viral vector comprising the nucleic acid sequence encoding the protein of SEQ ID NO.1. And another embodiment in accordance with the present invention is a plasmid comprising the nucleic acid sequence encoding the protein of SEQ ID NO.1. [0024] The foregoing features of the invention will be more readily understood by reference to the following detailed description, taken with reference to the accompanying drawings, in which: [0025] [0026] [0027] [0028] [0029] [0030] [0031] [0032] [0033] [0034] [0035] [0036] [0037] [0038] [0039] [0040] [0041] [0042] [0043] [0044] [0045] [0046] [0047] [0048] EphB2-Fc does not inhibit chemotaxis to BDNF. [0049] [0050] [0051] [0052] [0053] All references cited herein are incorporated in their entirety by reference. [0054] Definitions. As used in this description and the accompanying claims, the following terms shall have the meanings indicated, unless the context otherwise requires: [0055] Chemokine refers to small molecular weight proteins that regulate leukocyte migration and activation. They are typically secreted by activated leukocytes themselves, and also by stromal cells such as endothelial and epithelial cells, after inflammatory stimuli. Examples of chemokines include monocyte chemotactic protein (MCP)-3, MCP-4, macrophage inflammatory protein (MIP)-1α, MIP-1β, RANTES (regulated on activation, normal T cell expressed and secreted), SDF-1, Teck (thymus expressed chemokine), and MDC (macrophage derived chemokine). As used herein, chemokine also includes any molecule that can act as a chemotactic agent. A chemotactic agent may be a small chemical compound, natural or synthetic, that is a selective agonist of a chemokine receptor, for example, CXCR4, a heterotrimeric G protein-coupled receptor (GPCR) that is the receptor for the chemokine SDF-1. [0056] Altered cell migration means, within the context of the present invention, a measurable or observable effect on cell migration by an agent, when compared to cell migration in the absence of said agent. [0057] Altered sensitivity to a chemokine means, within the context of the present invention, an effect of a chemokine on a population of cells that is measurably or observably different under one set of conditions (for example, in the absence of a PDZ-RGS3 protein) from the effect of the same chemokine on the same population of cells under a different set of conditions (for example, in the presence of a PDZ-RGS3 protein). [0058] Chemokine-sensitive cell means a cell that shows a measurable or observable response to a chemokine, as defined above, in the context of cell migration. [0059] A low molecular weight synthetic organic molecule means, within the context of the present invention, a synthetic chemokine. [0060] Little is known of the specific effects of B ephrin reverse signaling on individual cells, or the signal transduction pathways that lead to such effects. The inventors have recently identified PDZ-RGS3 as a binding partner of B ephrins. In a Xenopus embryo de-adhesion assay, PDZ-RGS3 mediates signaling by the B ephrin cytoplasmic tail, in a manner dependent on both PDZ and RGS domains. Identification of the RGS protein led to further studies that identified a relationship between ephrins and chemokines. The inventors found that both SDF-1 and BDNF are in vitro chemoattractants for cerebellar granule cells. SDF-1 chemoattraction is selectively inhibited by soluble EphB receptor, and this inhibition is blocked by a truncated PDZ-RGS3 lacking the RGS domain. These results demonstrate a pathway connecting B ephrins to regulation of G protein coupled chemoattraction, and lead to a model for regulation of migration in cerebellar development. [0061] Cell biological effects, and molecular mechanisms of ephrin-B reverse signaling, were characterized. In the course of their investigations, the inventors uncovered a novel pathway for extracellular control of heterotrimeric G proteins, and demonstrated selective regulation of responsiveness to guidance factors as a mechanism that can regulate neuronal migration. [0062] Chemoattraction of a cell to another by chemokine stimuli can be modulated and/or regulated in cells by treatment with a PDZ-RGS3 type protein, wherein the PDZ-RGS3 type protein binds to a transmembrane protein such as B-ephrin, altering the cell's sensitivity to the chemokine. In the context of immune reactions such as autoimmune disease, tissue rejection or allergy, the invention provides compositions and methods for altering leukocyte sensitivity to chemokines involved in such immune responses. [0063] Modulation of chemokine signaling may also occur through the blocking of chemotaxis by ephrin reverse, and possibly forward, signaling. In such a pathway, soluble proteins comprising Eph receptor ectodomains may stimulate signaling through Eph receptors and interaction with the highly conserved PDZ-binding motifs. PDZ domains of various cell molecules including chemokines are known to also interact with the conserved PDZ-binding motifs. Introduction of soluble Eph receptor fusion proteins might thereby block the effect of chemokines or other G-protein coupled pathways involving molecules with PDZ domains that bind to the conserved PDZ-binding domains of the membrane proteins. [0064] It has also recently been shown that tumor cells express a distinct, non-random pattern of functionally active chemokine receptors (Müller, et al., Nature, 410, 50 (2001)). In vitro, chemokine ligand-receptor interactions trigger intracellular actin polymerization in leukocytes, a process that is prerequisite for cell motility and migration. Consistent with findings in leukocytes, CXCL12 (100 nM) and CCL21 (100 nM) induced, respectively, a transient 2.2- and 1.6-fold increase in intracellular filamentous actin (F-actin) in human breast cancer cells within 20 s. Conversely, the chemokine CX3CL1/fractalkine, whose receptor CX3CR1I/V28 was not detected on breast cancer cells, did not induce actin polymerization. [0065] In tumor cells, high levels of actin polymerization are required for the formation of pseudopodia, which in turn are needed for the invasion of malignant cells into tissues and for efficient metastases formation. Confocal laser scan microscopy of breast cancer cells stimulated in suspension with either CXCL12 or CCL21 revealed intense F-actin staining in the periphery of the cells and a redistribution of F-actin towards a leading edge. In adherent breast cancer cells, distinct pseudopodia formation was observed after 20 min of stimulation with either CCL21 or CXCL12. [0066] In agreement with these findings, both CXCL12 and CCL21 induced directional migration of breast cancer cells and directional invasion through a reconstituted basement membrane in a dose-dependent manner. Optimal migratory/invasive responses to CXCL12 or CCL21 were observed at concentrations of 100 nM, or 100 and 200 nM, respectively, reminiscent of observations made with leukocytes. Compared with breast cancer cells of well-characterized cell lines (MDA-MB-231, MDA-MB-361), primary tumor cells derived from a patient with malignant pleural effusion exhibited significant chemotactic responses to both CXCL12 and CCL21. CXCL12- and CCL21-mediated chemotaxis and invasion could be blocked by neutralizing anti-CXCR4 or anti-CCL21 antibodies, respectively, confirming the specificity of the chemotactic response induced by these chemokines. [0067] Thus, signaling through CXCR4 or CCR7 mediates actin polymerization and pseudopodia formation in breast cancer cells, and induces chemotactic and invasive responses. In addition, it was found that organs representing the main sites of breast cancer metastasis are the most abundant sources of ligands for these tumor-associated receptors. In vivo, neutralizing the interactions of CXCL12/CXCR4 leads to a significant inhibition of lymph-node and lung metastasis. [0068] In accordance with one embodiment of the present invention, there is provided a pharmaceutical composition comprising a soluble protein having an Eph receptor for delivering to a selected site an effective dose of said soluble protein, a suitable carrier, and optionally additional active or inert ingredients such as diluents, stabilizers, and excipients said soluble protein being capable of altering a cell signaling pathway. The pharmaceutical composition is then administered to a patient with cancer, for inhibiting cell response pathways involving chemokine-mediated mechanisms in tumor metastasis. [0069] The protein used in practicing the claimed invention may be a recombinant protein with an amino acid sequence identical to the claimed sequence of SEQ ID NO. 1, or a recombinant protein derived from SEQ ID NO. 1 but including modifications that change its pharmokinetic properties while keeping its original B ephrin-(PDZ-) binding domain and its regulator of heterotrimeric G protein signaling-(RGS-) domain. The protein may also be a soluble protein or fusion protein of the Eph receptor domain comprising the conserved 33 amino acids of the C-terminus of the B ephrins—the PDZ-binding motif, a motif also found in many other cell surface molecules. [0070] The mode of delivery of the protein may be by injection, including intradermal, intramuscular and subcutaneous, or topical, such as an ointment or patch. The protein may also be delivered as a nucleic acid sequence by way of a vector, such as a viral vector (e.g. adenoviruse, poxvirus, retrovirus, lentivirus, or a Sindvis viral vector), or an engineered plasmid DNA. [0071] Generally, the proteins of the presently claimed invention are administered as pharmaceutical compositions comprising an effective dose of the PDZ-RGS type protein or soluble Eph receptor domain in a pharmaceutical carrier. The protein can be combined for therapeutic use with additional active or inert ingredients, such as in conventional pharmaceutically acceptable carriers or diluents, along with physiologically innocuous stabilizers and excipients. A pharmaceutical carrier can be any compatible, non-toxic substance suitable for delivering the compositions of the claimed invention to a patient. [0072] The quantities of reagents necessary for effective therapy will depend upon many different factors, including means of administration, target site, physiological state of the patient, and other medicaments administered. Thus, treatment dosages should be titrated to optimize safety and efficacy. Animal testing of effective doses for treatment of particular cancers or disease states such as autoimmune or allergic response will provide further predictive indication of human dosage. Pharmaceutically acceptable carriers will include water, saline, buffers, and other compounds described, for example, in the Merck Index, Merck & Co., Rahway, N.J. Slow release formulations, or a slow release apparatus may be used for continuous administration. [0073] Dosage ranges for the claimed proteins would normally be expected to be in amounts lower than 1 mM concentrations, typically less than about 10 μM concentrations, usually less than about 100 nM, and particularly less than about 10 pM and more particularly less than about 1 fM, with an appropriate carrier. Treatment is normally initiated with smaller dosages which are less than optimum, and from there, the dosage is increased by small amounts to achieve the optimum effect under the circumstances. Determination of the ideal dosage and administration protocol for a particular patient or situation will be readily identified by one with ordinary skill in the art. [0074] It has been shown by the inventors that a cytoplasmic protein containing a PDZ domain and an RGS domain is capable of binding to B ephrins through the PDZ domain and mediating signaling from the cytoplasmic tail of the B ephrin. The signal mediation is dependent on both the PDZ and the RGS domains. Chemokines such as SDF-1, also known as SDF-1α, and BDNF, typically associated with leukocyte migration, herein act as chemoattractants for cerebellar granule cells. The inventors found that the chemokine SDF-1 is selectively inhibited by the presence of soluble EphB receptor but that this inhibition is blocked by a truncated PDZ-RGS type protein lacking the RGS domain, suggesting a connection between B ephrins and regulation of G protein-coupled chemoattraction. Effects of the presently claimed proteins on immune response or cell migration could be monitored by a number of different methods. For example, measuring an immune response, whether enhanced or inhibited, to antigen-specific stimulation of immunoglobulin levels in serum, typically known as B-cell response, could be done in the presence or absence of the claimed proteins. In addition, a similar analysis for an increase or decrease in specific immunoglobulins associated with T cells is possible. [0075] In accordance with one embodiment of the present invention, the proteins claimed herein could be used in cancer treatment, or to treat autoimmune and/or allergic responses and diseases. An altered immune response is thus measured or observed by analyzing an antigen-specific cytotoxic response of defined population of lymphocytes such as those of the blood, spleen, lymph nodes, or a tumor. Other means for monitoring the effect of a PDZ-RGS type protein include analysis of rates of tumor metastasis, or tumor growth, or an increase or decrease in tumor incidence in a patient or animal model or cell population. [0076] Additional diseases or medical conditions envisioned to be appropriate systems for monitoring altered cell migration such that ephrin signaling will provide therapeutic benefit in inflammatory and autoimmune diseases include: arthritis (including osteoarthritis and rheumatoid arthritis), inflammatory bowel disease, Crohn's disease, emphysema, acute respiratory distress syndrome, asthma, chronic obstructive pulmonary disease, Alzheimer's disease, organ transplant toxicity, cachexia, allergic reactions, allergic contact hypersensitivity, cancer, tissue ulceration, restenosis, periodontal disease, epidermolysis bullosa, osteoporosis, loosening of artificial joint implants, atherosclerosis (including atherosclerotic plaque rupture), aortic aneurysm (including abdominal aortic aneurysm and brain aortic aneurysm), congestive heart failure, myocardial infarction, stroke, cerebral ischemia, head trauma, spinal cord injury, neurodegenerative disorders (acute and chronic), Huntington's disease, Parkinson's disease, migraine, depression, peripheral neuropathy, pain, cerebral amyloid angiopathy, amyotrophic lateral sclerosis, multiple sclerosis, ocular angiogenesis, corneal injury, macular degeneration, abnormal wound healing, burns, diabetes, tumor invasion, tumor growth, tumor metastasis, corneal scarring, scleritis, AIDS, sepsis, septic shock, and other conditions characterized by hyperinflammatory states and autoimmune dysfunctions. [0077] In accordance with one embodiment of the present invention, the proteins or protein fragments claimed herein could be formulated alone or in combination with substances for slow release at a delivery site. Alternatively, they could be formulated as fusion proteins or constructs made by chemical ligation of a PDZ-RGS type protein or protein fragment and a targeting moiety, or of an Eph receptor ectodomain type protein and a targeting moiety, thus allowing delivery of the construct to tumors of interest (for example, the targeting moiety could be an antibody or fragment of antibody, or a protein ligand, or a peptide of more than about 10 amino acids). Similarly, they could be formulated as a DNA or viral vector (for example, a Sindvis vector) encoding the protein or protein fragment with or without a targeting moiety. [0078] The claimed invention may be illustrated by the following non-limiting examples, which are more easily understood by reference to the following experimental details. [0079] Plasmids and Antibodies [0080] GST fusions were in vector pGEX2T (Pharmacia), and plasmids for cell transfection or embryo injection in vector CS2(+) (Rupp et al., 1994). In situ probes were: full length ephrin-B1 cDNA (Davis et al., 1994); XbaI/XhoI fragment of ephrin-B2 (Bergemann et al., 1995); nucleotides 3 to 861 of PDZ-RGS3; HindIII/PstI fragment of ephrin-B3 (Bergemann et al., 1998); nuclcotides 2698 to 3104 of EphB2 (Henkemeyer et al., 1996); nucleotides 2139 to 2873 of EphB3 (Ciossek et al., 1995); or CXCR4 and SDF-1 probes as described (Suzuki et al., 1999). Myc-SAP97 and myc-PSD95 plasmids were gifts from Dan Pak and Morgan Sheng. Rabbit polyclonal anti-PDZ-RGS3 antibodies were raised against an internal peptide TIPEEPGTTTKGKSYT or the C-terminal peptide RSDLYLINQKKMSPPL, with an N-terminal cysteine added for conjugation with carrier KLH. Antiserum was affinity purified on peptide columns using SulfoLink kit (Pierce). Antibodies to both peptides detect PDZ-RGS3 in Western blots of transfected cells and tissues. Rat monoclonal anti-HA was from Boehringer Mannheim. Mouse monoclonal anti-Myc, rabbit anti-ephrin-B1 (A20), rabbit anti-ephrin-B (C18) and goat anti-CXCR4 (C20) were from Santa Cruz Biotechnology. [0081] Yeast Two-Hybrid Screen and cDNA Cloning [0082] A two-hybrid library, a gift from Stanley Hollenberg, was screened as described (Hollenberg, et al., 1995). Several clones with overlapping partial sequences of PDZ-RGS3 were obtained. The longest contained nucleotides 15 to 465 and was used to probe a mouse newborn brain cDNA library (Stratagene). Among several overlapping clones, the longest contained nucleotides 1 to 1421. To obtain full length cDNA, 3′ RACE was performed on mouse E15.5 Marathon cDNA (Clontech) using 5′ internal primer set gtgggcaagcgcagtggccagcacaccctg and ccgcacatcccgcattccagttacggcacc. Multiple RACE clones were sequenced to ensure fidelity. [0083] GST Pull-Down, Immunoprecipitation and Western Blot [0084] GST fusions expressed in strain BL21 were immobilized on glutathione beads (Sigma). Twenty-five-μL beads were incubated with 25-50 μL35S-labeled PDZ-RGS3 made by in vitro transcription and translation (Promega TNT kit), in 500 μL binding buffer (25 mM TrisHCl 7.4, 150 mM NaCl, 1 mM EDTA and 1 mM DTT). Beads were washed with binding buffer followed by SDS-PAGE and autoradiography. [0085] For immunoprecipitations, COS cells were Lipofectamine transfected (Gibco) and lysed 30 hr later (25 mM Tris-HCl 7.4, 150 mM NaCl, Boehringer protease inhibitor cocktail, 1 mM DTT and 1% Triton X-100). After-microfuge clearing, supernatants were incubated with antibodies 1 hr, then protein A sepharose beads (Pharmacia) 1 hr. Beads were washed with lysis buffer, proteins were resolved on SDS gels, and transferred to PVDF membranes (Gelman Sciences). [0086] Mouse E16.5 cerebral cortices were triturated with a blue Gilson tip in hypotonic buffer (25 mM Tris-HCl 7.4, protease inhibitor cocktail, 1 mM DTT). After 10 min on ice, cells were lysed by passing through a 27-gauge needle 4-6 times. After microfuging 5000 rpm, 5 min, supernatant containing membranes and cytosol was incubated with 1% Triton X-100, 150 mM NaCl, 10 min on ice before immunoprecipitation as above. [0087] Xenopus Embryo De-Adhesion and Granule Cell Migration Assays [0088] For the Xenopus assay, plasmids were NotI linearized and transcribed to capped mRNA by SP6 mMessage mMachine kit (Ambion). Two-cell embryos were injected, and screened for dc-adhesion as described (Jones et al., 1998). For each plasmid combination, protein levels were tested by Western blot and were consistent. Approximately 30 embryos were tested for each condition in each experiment, and experiments were repeated 3 to 5 times with consistent results. Data shown are averages of all results combined. [0089] For migration assays, granule cells from P8-P9 mouse cerebella were dissociated and purified as described (Hatten, 1985) with modifications. Briefly, the cell suspension was spun 20 min, 3500 rpm on a step gradient (60% and 35% isotonic Percoll). The second layer of cells was collected, washed, and resuspended in NB medium (Neurobasal/B27; Gibco). Purified cells were incubated 37° C. on a poly-D-lysine coated culture flask, then shaken off after 2 hr for the migration assay. The cells were found to need this recovery period, perhaps for restoration of ephrin-B1 expression after trypsin cleavage. [0090] Transwell membranes (polycarbonate, 5 micron pores; Costar) were pre-coated on both sides with laminin (20 μg/mL)·1 hour then PBS washed. BDNF (Peprotech), SDF-1 (also called SDF-1α; Peprotech or Calbiochem) and EphB2-Fc were found most effective at concentrations of 10 ng/mL, 100 ng/mL, and 2 μg/mL, respectively, in line with previous publications. 100,000 cells were placed in the top chamber and incubated 37° C., 5% CO2, 16 hr. The membrane was then methanol fixed and Giemsa stained. The upper side was wiped off, and cells that had migrated and attached to the lower side were counted blind, in 4 central fields with a 16× objective. Each condition was tested in duplicate or triplicate per experiment, and each experiment repeated 3 to 5 times with consistent results. Data shown are averages of all results combined. [0091] For viral transduction, PDZ-RGS3PDZ-EGFPwas cloned into pSinRepS (Invitrogen), and virus produced by the manufacturer's instructions. Immediately after the 2 hr recovery of purified granule cells, EGFP or PDZ-RGS3PDZ-EGFPvirus, with a similar titer, were added. Infection was 1 hr, room temperature on an orbital shaker, then 1 hr at 37° C. The assay was as above, except migration was for only 6 hr, then membranes were fixed with 4% paraformaldehyde in PBS 10 min, washed once with PBS, and slide mounted with fluoromount-G (Southern Biotechnology). [0092] Immunocytochemistry [0093] COS cells transfected with HA-ephrin-B1 and myc-PDZ-RGS3 were fixed in 4% paraformaldehyde, 4% sucrose in PBS, incubated with C18 antibody and monoclonal anti-myc in 0.5% NP40, 5%BSA in PBS, 1 hr, then secondary antibodies for 1 hr (donkey anti-rabbit-Rhodamine RedX and donkey anti-mouse-FITC; Jackson Immunoresearch) and mounted in Fluoromount-G. [0094] Purified granule cells were cultured overnight on laminin (100 μg/mL) pre-coated coverslips. EphB2-Fc (5 μg/) was added, 30 min, 37° C. Cells were fixed 15 min in 4% paraformaldehyde, 4% sucrose in PBS, permeabilized 5 min, 0.25% TritonX-100, blocked 2 hr, 10% BSA in PBS, labeled 4° C. overnight with rabbit anti-human Fc plus goat anti-CXCR4, or goat anti-human Fc (Jackson Immunoresearch) plus rabbit anti-PDZ-RGS3 in 3% BSA in PBS, then 2 hr, room temperature with secondary antibodies (donkey anti-goat-FITC and donkey anti-rabbit-Rhodamine RedX) and mounted in ProLong Antifade (Molecular Probes). [0095] Immunocytochemistry using purified leukocute cells is done as with granule cells. The purified leukocytes are cultured overnight, using standard techniques known to those skilled in the art. Addition of EphB2-Fc and labeling with anti-human Fc plus goat anti-CXCR4, or goat-anti-human FC plus rabbit anti-PDZ-RGS3 with secondary antibodies is as described above for granule cells. [0096] Identification of B Ephrin Binding Proteins [0097] As a first step to dissect reverse signaling, identification of B ephrin binding proteins was undertaken. Yeast two-hybrid cloning was employed, screening a mouse embryonic cDNA library (Hollenberg, et al., 1995) with the entire cytoplasmic domain of ephrin-B2 as bait. Subsequent studies focused on one of the cDNAs identified, encoding a previously unidentified 930 amino acid protein sequence ( [0098] Database searching revealed no identical sequence. However, it did reveal strong homology of the C-terminal half of this mouse sequence to human RGS3, which was previously described as a shorter sequence ( [0099] Binding of PDZ-RGS3 to B Ephrins [0100] After identifying PDZ-RGS3, the results of the two-hybrid screen were investigated to determine whether they reflect a biologically meaningful interaction. To address this, binding between PDZ-RGS3 and B ephrins was tested, using several approaches. [0101] 1. In Vitro GST Fusion Protein Pull-Down Assay. [0102] Fusion proteins were constructed between GST and the C-terminal 33 amino acids of ephrin-B1 (identical to the same region of ephrin-B2). In addition to the wild type sequence (GST-ephrin-B1), a version was made with the C-terminal Valine replaced by Alanine (GST-ephrin-B1V/A), which is expected to abolish or strongly reduce binding of PDZ proteins (Song yang et al., 1997). Affinity beads bearing GST-ephrin-B1 or GST-ephrin-B1V/Ain similar amounts ( [0103] 2. Binding in Transfected Cells. [0104] Constructs encoding myc-tagged PDZ-RGS3 and HA-tagged ephrin-B1, or mutant derivatives, were co-transfected into COS cells. Lysates were then immunoprecipitated with anti-myc or anti-HA, followed by Western blot using anti-myc or a rabbit polyclonal anti-ephrin-B. Levels of wild-type and mutant proteins were comparable ( [0105] 3. Interaction in Lysates of a Neuroblastoma Cell Line, or Mouse Cortex, Where PDZ-RGS3 and Ephrin-B1 are Expressed Endogenously. [0106] Ephrin-B1 was immunoprecipitated with a rabbit polyclonal antibody, and the subsequent Western blot was probed with an antibody to PDZ-RGS3. The results show that a PDZ-RGS3immunoreactive protein of the expected size co-precipitated with ephrin-B1 ( [0107] Overlapping Expression of PDZ-RGS3 and B Ephrins [0108] If PDZ-RGS3 and B ephrins interact functionally, it is expected they will have overlapping expression patterns. Therefore, comparison of PDZ-RGS3 expression with that of ephrin-B1 and ephrin-B2 by in situ hybridization on mouse embryos was carried out. PDZ-RGS3 co-localized with ephrin-B1 in cortical ventricular zone ( [0109] B Ephrin Signaling in Xenopus Embryos Mediated by PDZ-RGS3 [0110] The functional relationship between B ephrin and PDZ-RGS3 was next examined. Microinjection of ephrin-B1 RNA was previously shown to cause cell de-adhesion in Xenopus embryos or animal caps. The C-terminal 19 amino acids were required, whereas the extracellular domain was not (Jones, et al., 1998), showing this phenotype involves interactions of the ephrin-B1 cytoplasmic tail, and is not dependent on forward signaling. (Signaling by B ephrin lacking an extracellular domain is consistent with the constitutive signaling seen when other receptors are truncated.) This assay has the advantage that it permits multiple proteins to be expressed simultaneously and at variable levels, facilitating analysis of domain functions and interactions. [0111] 1. Requirement of the PDZ Binding Domain of ephrin-B1 for the De-Adhesion Activity. [0112] Ephrin-B1Δ3did not cause the de-adhesion phenotype ( [0113] 2. PDZ-RGS Domain Effects on ephrin-B1 De-Adhesion Activity. [0114] Ephrin-B1 RNAs were next co-injected with various forms of PDZ-RGS3. The first form of PDZ-RGS3 tested had the RGS domain deleted (PDZ-RGS3ΔRGS), to create a putative dominant negative protein. PDZ-RGS3ΔRGSalone had no effect. However, it inhibited the cell dissociation caused by ephrin-B1 in a dose dependent manner ( [0115] 3. Investigation of Membrane-Localization of PDZ-RGS3 using PDZ-RGS3 with an Added Myristoylation Motif (PDZ-RGS3myr). [0116] Most, if not all, the protein from this construct localized to the membrane fraction, whereas wild-type PDZ-RGS3 expressed by itself was mainly cytosolic (data not shown). Embryos injected with PDZ-RGS3myrdid not develop the de-adhesion phenotype ( [0117] Effect of Soluble EphB Receptor on Isolated Cells and Its Role in Neuronal Guidance. [0118] Identification of PDZ-RGS3, and the demonstration of a role for its RGS domain in the Xenopus assay suggested that one potential mechanism of reverse signaling could be to regulate signaling by a GPCR. If so, B ephrins should be expressed in the same regions as candidate GPCRs. Consequently, the expression of ephrin-B2 and EphB2 in cerebellar granule cells was of particular interest. In mice with gene disruption of SDF-1 or its receptor CXCR4, granule cells migrate prematurely from the external granule cell layer (EGL), indicating SDF-1 normally functions to prevent premature inward migration (Ma et al., 1998; Zou et al., 1998). [0119] To investigate these ideas further, expression patterns were examined by in situ hybridization. Granule cell migration normally begins around postnatal day 3 (P3) and continues into the third postnatal week (flatten, 1999). Expression of SDF-1 and CXCR4 has been reported at pre-natal stages (Zou et al., 1998; McGrath et al., 1999), and we extended this postnatally. Consistent with the prenatal pattern, we saw RNA expression for CXCR4 in the EGL, while SDF-1 was restricted more superficially to the pial membrane. Similar patterns were seen at P0 and P3 ( [0120] Co-expression of B ephrin and CXCR4 was confirmed in individual purified granule cells ( [0121] Regulation of Cerebellar Granule Cell Chemoattraction [0122] To test functionally for an interaction of ephrin-B and SDF-1, a Transwell assay system was assembled using purified cerebellar granule cells. Briefly, a membrane filter with defined uniform pore size separates upper and lower chambers. Cells are placed in the upper chamber and the number of cells that have migrated to the lower side of the filter is subsequently counted. [0123] Initially, a chemoattractant effect of SDF-1 on cultured granule cells was investigated, something which had not been described previously. When SDF-1 was added to the lower chamber it promoted migration of granule cells (p<0.001, unpaired t test; [0124] A potential explanation for this inhibitory effect of EphB2-Fc, not intended to be limiting in any way, could be a general effect on cell motility or responsiveness. To address this, we tested BDNF as a control attractant. BDNF was previously reported to promote cerebellar granule cell survival (Schwartz et al., 1997), and since it can act in vitro as an attractant for axons (Song et al., 1997) it was considered likely that it might also act as a chemoattractant for granule cells. Addition of BDNF to the lower chamber indeed promoted migration (p<0.005; [0125] These results supported the prediction, based on analysis of PDZ-RGS3, that reverse signaling might affect a heterotrimeric G protein signaling pathway. To assess this further, a dominant negative form of PDZ-RGS3 was tested. To overcome a major obstacle for such an experiment, namely, the difficulty of expressing genes with high enough efficiency in primary neurons, a Sindbis viral vector was used, based on reports of efficient gene transfer into a wide variety of cells. Enhanced green fluorescent protein (Chalfie et al., 1994) was incorporated into the constructs, so infected cells could be traced. The dominant negative construct in these experiments was the PDZ domain of PDZ-RGS3, fused to EGFP (PDZ-RGS3PDZ-EGFP). As in uninfected cells, when granule cells were infected with control EGFP virus, SDF-1 acted as a chemoattractant, and thus was inhibited by EphB2-Fc (data not shown). When PDZ-RGS3PDZ-EGFPwas introduced into the cells, SDF-1 still acted as a chemoattractant (p<0.001; [0126] Effect of Soluble EphB Receptor on Isolated Cells and Its Role in Leukocyte Migration. [0127] As stated above, identification of PDZ-RGS3, and the demonstration of a role for its RGS domain in the Xenopus assay suggested that one potential mechanism of reverse signaling was to regulate signaling by a GPCR (G protein-coupled receptor). Recently, Wu et al., Nature, 410, 948 (2001), showed that the secreted protein Slit, previously known for its role of repulsion in axon guidance and neuronal migration, also inhibited leukocyte chemotaxis induced by chemotactic factors, i.e. chemokines. [0128] Regulation of Cerebellar Granule Cell Chemoattraction [0129] To investigate this concept with PDZ-RGS3 protein, a transwell system is assembled wherein the effect of leukocyte migration, in the presence of an appropriate chemokine such as SDF-1 with or without PDZ-RGS3 protein, is monitored. [0130] To test functionally for an interaction of the GPCR ephrin B and SDF-1, a transwell assay system can be assembled using purified leukocytes. As described above, a membrane filter with defined uniform pore size separates upper and lower chambers. Cells are placed in the upper chamber and the number of cells that have migrated to the lower side of the filter is subsequently counted. [0131] Initially, the chemoattractant effect of an appropriate chemokine, such as SDF-1, on cultured leukocyte cells is investigated. The chemokine is added to the lower chamber to promote migration of leukocyte cells. Reverse signaling is then triggered with soluble EphB2-Fc, which is dimerized by its Fc tag and used without further clustering as above. EphB2-Fc is then added with the cells in the top chamber to look for inhibition of the chemoattractant effect of the chemokine, in this case, SDF-1. Control Fc protein is also added to the top chamber, and expected to have no effect. [0132] BDNF can also be added to the chambers as a control attractant, to investigate any general effect on cell motility of responsiveness exhibited by EphB2-Fc, and to determine whether the effect on migration of leukocytes by the assayed chemokine, in this case SDF-1, is selective. If addition of EphB2-Fc to the top or bottom chamber does not inhibit cell migration towards BDNF, then inhibition by EphB2-Fc will be selective for the chemokine (SDF-1) induced migration observed. [0133] A second potential function for transmembrane ligands is to allow bi-directional signaling. Again, the ephrins have provided a particularly good model system to investigate this idea. Reverse signaling through B ephrins has been demonstrated biochemically by ligand phosphorylation. Evidence of important developmental roles has come from genetic and embryological studies of whole embryos or tissues. Herein, characterization of cell biological effects, and molecular mechanisms of ephrin-B reverse signaling, have been detailed. In addition, the experiments have led to other conclusions, uncovering a novel pathway for extracellular control of heterotrimeric G proteins, and demonstrating selective regulation of responsiveness to guidance factors as a mechanism that can regulate neuronal migration. [0134] Molecular and Cellular Mechanisms of Reverse Signaling [0135] Reverse signaling at a molecular level was investigated by screening for proteins that bind the B ephrin cytoplasmic domain, leading to identification of PDZ-RGS3 in a yeast two-hybrid assay. The two proteins also bind one another in an in vitro GST pull-down assay, and by co-immunoprecipitation from lysates of transfected cells, or neural cells and tissues that express the two proteins endogenously. In situ hybridization shows a close overlap of expression patterns for PDZ-RGS3 with one or other of the three known B ephrins in several parts of the nervous system. Taken together these results indicate that PDZ-RGS3 is a genuine biological interaction partner of B ephrins. [0136] The domain structure of PDZ-RGS3 suggests how this protein might function, but the following is in no means intended to be limiting of function. PDZ domains are known to bind to a short conserved motif at the C-terminus of many membrane proteins (Songyang et al., 1997; Sheng and Pak, 2000). A sequence fitting this motif is found at the C-terminus of all known B ephrins, and the experiments herein indicate that the PDZ domain of PDZ-RGS3 binds the ephrin-B C-terminus. Tyrosine residues are found in the binding motif (YYKV-carboxy terminus) suggesting potential control of binding by phosphorylation, and the PDZ-GRS3/ephrin B interaction did not appear to be regulated by EphB receptor binding. The presence of an RGS domain suggested PDZ-RGS3 might interact with downstream effector pathways. In fact, a Xenopus embryo cell dissociation assay showed that PDZ-RGS3 mediates effects of the B ephrin cytoplasmic tail, in a manner dependent on both its PDZ and RGS domains. While the Xenopus assay was well suited to test the function and interaction of individual domains, such a system does not readily assess the effect of Eph receptor binding, the downstream pathways, and the relevance to guidance. Due to the involvement of the RGS domain in signaling, as well as the cerebellar expression of ephrins, cerebellar granule cells were tested for an effect of reverse signaling on the action of SDF-1, which acts through a GPCR. As expected, soluble EphB2-Fc selectively regulated the guidance response to SDF-1, and this regulation was blocked by a truncated version of PDZ-RGS3 lacking the RGS domain. A molecular model based on such studies, in no way intended to be the only possible model, is shown in [0137] At the level of cell biological effects, the above examples show that reverse signaling induced by Eph receptor can regulate cellular guidance ( [0138] Regarding the mechanism for signal transduction across the cell membrane, as with other PDZ proteins that bind B ephrins (Torres et al., 1998; Bruckner et al., 1999; Lin et al., 1999), the association with PDZ-RGS3 was seen constitutively, and did not appear to be modulated by treating cells with soluble EphB2-Fc. This suggests regulated association between B ephrin and PDZ-RGS3 is not a likely mechanism of signal transduction. An alternative could be regulation of clustering or subcellular localization. It is known that EphB2-Fc can cluster B ephrins and associated PDZ proteins into membrane rafts (Bruckner et al., 1999). Heterotrimeric G proteins have also been localized to rafts (Simons and Ikonen, 1997). Therefore, one model could be that Eph receptor binding could cluster B ephrins into rafts, or other subcellular structures, and this could bring associated PDZ-RGS3 into proximity with the appropriate G proteins, resulting in inhibition of their activity. It is finally worth noting that not only the PDZ binding motif, but at least 33 amino acids of the B ephrin cytoplasmic tail are strongly conserved, and it is likely that additional protein interactions play a role in signaling, either through independent pathways or in collaboration with PDZ-RGS3. [0139] Heterotrimeric G Protein Signaling [0140] Heterotrimeric G proteins are classically controlled by receptors in the seven—transmembrane family. RGS proteins were identified as GAPs for G proteins, and contain additional protein modules, including PDZ domains, which could potentially allow control of G proteins by other signaling pathways. Moreover, PDZ and RGS domains can associate through protein-protein interactions, as in the case of GIPC/NIP/SEMCAP-1, a PDZ protein that binds the RGS protein GAIP, and also interacts with cell surface semaphorins and neuropilins (De Vries et al., 1998; Cai and Reed, 1999; Wang et al., 1999). The observation that B ephrin signaling can be mediated by PDZ-RGS3, in a manner requiring both PDZ and RGS domains, provides a possible explanation, in no way intended to be limiting, for the presence of both PDZ and RGS domains in this protein. The regulation of a G protein pathway by ephrin reverse signaling also provides a potentially general mechanism that can allow heterotrimeric G protein pathways to be regulated through cell surface receptors, other than classical seven-transmembrane GPCRs. [0141] It is not clear to what degree PDZ-RGS3 interactions might be general or specific. Most known RGS proteins, including human RGS3, are GAPs for the Gαi or Gαq subfamily of G proteins. Our results are therefore very consistent with studies showing CXCR4 is coupled to Gαi2 (Moepps et al., 1997). On the other hand, experiments on purified proteins or transfected cells suggest the specificity of RGS proteins for individual G proteins, and likewise the specificity of PDZ proteins for individual binding motifs, may not be high. Differences in affinity or kinetics could provide some degree of specificity. Alternatively, biological specificity may come from expression patterns, since these intracellular interactions would require the proteins to be expressed in the same cell. In keeping with this idea, we find a close correlation in the expression patterns of PDZ-RGS3 and B ephrins, suggesting there may be a special biological relationship between these proteins. Finally, a further layer of specificity could be provided by subcellular localization. The observation that PDZ-RGS3 failed to signal when targeted to the membrane by myristoylation could be consistent with a model where B ephrins not only bring PDZ-RGS3 to the membrane, but also target it to signaling complexes containing the appropriate G proteins. [0142] Cerebellar Granule Cell Migration [0143] The inward migration of cerebellar granule cells from the EGL is one of the best characterized models of neuronal migration. The genetic demonstration that SDF-1 and its receptor CXCR4 are required for normal granule cell migration provided the first evidence of chemokines as regulators of neural development. Specifically, the phenotype of premature granule cell migration, taken together with the embryonic expression of SDF-1 in the pia mater overlying the cerebellum, suggested a model wherein SDF-1 prevents premature inward migration of cerebellar granule cells by chemoattraction toward the pia (Ma et al., 1998; Zou et al., 1998; McGrath et al., 1999). The presently claimed invention supports this model, by experimental results showing SDF-1 expression in the pia at postnatal stages that span the onset of granule cell migration, and by demonstrating that SDF-1 is a chemoattractant for cultured cerebellar granule cells. [0144] Experiments further show that reverse signaling induced by soluble EphB2-Fc can inhibit the effect of SDF-1 on cerebellar granule cells. This provides the first functional evidence for an effect of ephrin signaling on cerebellar granule cells. A developmental role for the interaction of these signaling pathways is supported by the correlated expression of ephrinB2, SDF-1, and their receptors during cerebellar development. [0145] The following model is based on the above functional assays of primary cultured cerebellar granule cells, the expression patterns of the relevant molecules during cerebellar development, and the phenotypes of SDF-1 and CXCR4 gene disrupted mice. During the period when some granule cells remain in the EGL, and others have migrated inwards, expression of SDF-1 and CXCR4 persists. To reconcile the inconsistency that SDF-1 prevents inward migration by chemoattracting granule cells toward the pia, and 10 yet some cells still break away to migrate inward, it is proposed that when granule cells are ready to migrate, they may lose responsiveness to SDF-1. [0146] Such a change in responsiveness could be mediated at least in part by B ephrins and EphB receptors, a model consistent with the observed inhibitory effect of EphB2-Fc on SDF-1 responsiveness of granule cells, as well as the up-regulation of ephrin-B2 and EphB2 gene expression by granule cells around the time of migration onset in mouse cerebellum. Ephrin-B1 and EphB2 were also reported to be expressed by migrating granule cells in chick cerebellum (Karam et al., 2000). Consistent with this model, explant culture experiments show that at the time of migration onset, cerebellar granule cells lose their responsiveness to a chemoattractant in the pia. When granule cells start to travel inwards, they presumably still need to be responsive to other signals, allowing them to migrate and find their destination in the internal granule cell layer. BDNF could promote this inward migration, since it is a chemoattractant for cerebellar granule cells, as shown here, and since the inward migration is impaired by BDNF gene knockout. The selectivity observed for EphB2 in inhibiting responsiveness to SDF-1 but not BDNF suggests a developmental model where ephrin signaling could act as a switch, changing the balance of preference from SDF-1 to other guidance cues. Such a model, while consistent with the presently known data, is in no way intended to limit other possible models that may also be consistent. [0147] Finally, it is interesting to consider why regulation in this context might be mediated by ephrins, providing a bi-directional signaling system requiring direct cell-cell contact. One possibility could be autocrine signaling by granule cells. An alternative model is suggested by the observation that developing granule cells do not migrate independently, but rather in contact with other granule cells and radial glial fibers (Rakic, 1990; Hatten, 1999). Persistence of SDF-1 expression may ensure that granule cells do not migrate in isolation. Cell-cell contact could then activate ephrin signaling, and allow migration once granule cells are assembled with the correct cellular partners. Other models are also possible. [0148] Contact-mediated cell-cell signaling can allow spatial precision, and bi-directional control. Forward signaling through Eph receptors is well established to precisely guide cell and axon migration. Genetic and embryological studies have shown B ephrin reverse signaling can affect processes involving migration or morphogenesis, and the presently claimed inventions shows that soluble EphB-Fc receptor can directly regulate cell guidance. Ephrin signaling can thus allow contact-mediated bi-directional regulation of guidance. This may allow coordinated movement within a cell population, or mutual regulation of interacting cell populations. [0149] Our results also provide a mechanism for a receptor not in the seven-transmembrane class to regulate G protein signaling. In addition to the effect seen herein on cerebellar cells, it is proposed that ephrin reverse signaling affects leukocyte chemotaxis to chemokines, thereby providing a means for treatment of inflammation and other diseases. More generally, it is proposed that regulation through PDZ-RGS proteins provides a pathway to control many processes regulated by G proteins. [0150] The presently claimed invention provides a means for selective regulation of responsiveness to guidance factors. Throughout the nervous system, the immune system, and elsewhere, such mechanisms are likely to have critical roles in allowing migrating cells and axons to appropriately modulate their responses, as they leave their point of origin, pass intermediate guideposts, and arrive at their final targets. [0151] Adams, R. H. Wilkinson, G. A. Weiss. C., Diella. F., Gale, N. W., Deutsch, U., Risau, W., and Klein, R. (1999). Roles of ephrinB ligands and EphB receptors in cardiovascular development: demarcation of arterial/venous domains, vascular morphogenesis, and sprouting angiogenesis. Genes Dev. 13, 295-306. [0152] Arshavsky, V. Y., and Pugh, E. N.J. (1998). Lifetime regulation of G protein-effector complex: emerging importance of RGS proteins. Neuron 20, 11-14. [0153] Bargmann, C. I., and Kaplan, J. M. (1998). Signal transduction in the Caenorhabditis elegans nervous system. Annu. Rev. Neurosci. 21, 279-308. [0154] Bennett, B. D., Zeigler, F. C., Gu, Q., Fendly, B., Goddard, A. D., Gillett, N., and Matthews, W. (1995). Molecular cloning of a ligand for the EPH-related receptor protein-tyrosine kinase Htk. Proc. Natl. Acad. Sci. USA 92, 1866-1870. [0155] Bergemann, A. D., Cheng, H. -J., Brambilla, R., Klein, R., and Flanagan, J. G. (1995). ELF2, a new member of the Eph ligand family, is segmentally expressed in mouse embryos in the region of the hindbrain and newly forming somites. Mol. Cell. Biol. 15, 4921-4929. [0156] Bergemann, A. D., Zhang, L., Chiang, M. -K., Brambilla, R., Klein, R., and Flanagan, J. G. (1998). Ephrin-B3, a ligand for the receptor EphB3, expressed at the midline of the developing neural tube. Oncogene 16, 471-480. [0157] Bruckner, K., Labrador, J. P., Scheiffele. P., Herb, A., Seeburg, P. H., and Klein, R. (1999). EphrinB ligands recruit GRIP family PDZ adaptor proteins into raft membrane microdomains. Neuron 22, 511-524. [0158] Bruckner, K., Pasquale, E. B., and Klein, R. (1997). Tyrosine phosphorylation of transmembrane ligands for Eph receptors. Science 275, 1640-1643. [0159] Cai, H. B., and Reed, R. R. (1999). Cloning and characterization of neuropilin-l-interacting protein: A PSD-95/Dlg/ZO-I domain-containing protein that interacts with the cytoplasmic domain of neuropilin-1. J. Neurosci. 19, 6519-6527. [0160] Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W., and Prasher, D. C. (1994). Green fluorescent protein as a marker for gene expression. Science 263, 802-805. [0161] Ciossek, T., Lerch, M. M., and Ulrich, A. (1995). Cloning, characterization, and differential expresssion of MDK2 and MDK5, two novel receptor tyrosine kinases of the eck/eph family. Oncogene 11, 2085-2095. [0162] Corset, V., Nguyen-ba-Charvet, K. T., Forcet, C., Moyse, E., Chedotal, A., and Mehlen, P. (2000). Netrin-1-mediated axon outgrowth and cAMP production requires interaction with adenosine A2b receptor. Nature 407, 747-750. [0163] Craven, S. E., and Bredt, D. S. (1998). PDZ proteins organize synaptic signaling pathways. Cell 93, 495-498. [0164] Davis, S., Gale, N. W., Aldrich, T. H., Maisonpierre, P. C., Lhotak, V. Pawson, T., Goldfarb. M., and Yancopoulos, G. D. (1994). Ligands for EPH-related receptor tyrosine kinases that require membrane attachment or clustering for activity. Science 266, 816819. [0165] Davy, A., Gale, N. W., Murray, E. W., Klinghoffer, R. A., Soriano, P., Feuerstein, C., and Robbins, S. M. (1999). Compartmentalized signaling by GPI-anchored ephrin-A5 requires the Fyn tyrosine kinase to regulate cellular adhesion. Genes Dev. 13, 3125-3135. [0166] De Vries, L., and Farquhar, M. G. (1999). RGS proteins: more than just GAPS for heterotrimeric G proteins. Trends in Cell Biology 9, 138-144. [0167] De Vries, L., Lou, X. J., Zhao, G., Zheng, B., and Farquhar, M. G. (1998). GIPC, a PDZ domain containing protein, interacts specifically with the C terminus of RGS-GAIP. Proc. Natl. Acad. Sci. USA 95, 12340-12345. [0168] Drescher, U., Bonhoeffer, F., and Muller, B. (1997). The Eph family in retinal axon guidance. Curr. Op. Neurobiol. 7, 75-80. [0169] Druey, K. M., Blumer, K. J., Kang, V. H., and Kehrl, J. H. (1996). Inhibition of G-protein mediated MAP kinase activation by a new mammalian gene family. Nature 379, 742-746. [0170] Flanagan, J. G., Chan, D. C., and Leder, P. (1991). Transmembrane form of the kit ligand growth factor is determined by alternative splicing and is missing in the Sldmutant. Cell 64,1025-1035. [0171] Flanagan, J. G., and Vanderhaeghen, P. (1998). The ephrins and Eph receptors in neural development. Annu. Rev. Neurosci. 21, 309-345. [0172] Frisen, J., Holmberg, J., and Barbacid, M. (1999). Ephrins and their Eph receptors: multitalented directors of embryonic development. EMBO J. 18, 5159-5165. [0173] Garner, C. C., Nash, J., and Huganir, R. L. (2000). PDZ domains in synapse assembly and signaling. Trends Cell Biol. 10, 274-280. [0174] Gerety, S. S., Wang, H. U., Chen, Z. F., and Anderson, D. J. (1999). Symmetrical mutant phenotypes of the receptor EphB4 and its specific transmembrane ligand ephrin-B2 in cardiovascular development. Mol. Cell 4, 403-414. [0175] Hajdu-Cronin, Y. M., Chen, W. J., Patikoglou, G., Koelle, M. R., and Sternberg, P. W. (1999). Antagonism between G(o)alpha and G(q)alpha in Caenorhabditis elegans: the RGS protein EAT-16 is necessary for G(o)alpha signaling and regulates G(q)alpha activity. Genes Dev. 13, 1780-1793. [0176] Hart, M. J., Jiang, X., Kozasa, T., Roscoe, W., Singer, W. D., Gilman, A. G., Sternweis, P. C., and Bollag, G. (1998). Direct stimulation of the guanine nucleotide exchange activity of p115 RhoGEF by Galphal3. Science 280, 2112-2114. [0177] Hatten, M. E. (1985). Neuronal regulation of astroglial morphology and proliferation in vitro, J. Cell Biol. 100, 384-396. [0178] Hatten, M. E. (1999). Central nervous system neuronal migration. Annu. Rev. Neurosci. 22, 511-539. [0179] Henkemeyer, M., Orioli, D., Henderson, J. T., Saxton, T. M., Roder, J., Pawson, T., and Klein, R. (1996). Nuk controls pathfinding of commissural axons in the mammalian central nervous system. Cell 86, 35-46. [0180] Holder, N., and Klein, R. (1999). Eph receptors and ephrins: effectors of morphogenesis. Development 126, 2033-2044. [0181] Holland, S. J., Gale, N. W., Mbalamu, G., Yancopoulos, G. D., Henkemeyer, M., and Pawson, T. (1996). Bidirectional signalling through the EPH-family receptor Nuk and its transmembrane ligand. Nature 383, 722-725. [0182] Hollenberg, S. M., Stemglanz, R., Cheng, P. F., and Weintraub, H. (1995). Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell Biol. 15, 3813-3822. [0183] Huai, J., and Drescher, U. An ephrin-A-dependent signaling pathway controls integrin function and is linked to the tyrosine phosphorylation of a 120 kDa protein. J. Biol. Chem. e-publication ahead of print, [0184] Jones, T. L., Chong, L. D., Kim, J., Xu, R. H., Kung, H. F., and Daar, 1. 0. (1998). Loss of cell adhesion in Xenopus laevis embryos mediated by the cytoplasmic domain of Xlerk, an erythropoietin-producing hepatocellular ligand. Proc. Natl. Acad. Sci. USA 95, 576581. [0185] Karam, S. D., Burrows, R. C., Logan, C., Koblar, S., Pasquale, E. B., and Bothwell, M. (2000). Eph receptors and ephrins in the developing chick cerebellum: relationship to sagittal patterning and granule cell migration. J. Neurosci. 20, 6488-6500. [0186] Kehrl, J. H. (1998). Heterotrimeric G protein signaling—roles in immune function and finetuning by RGS proteins. Immunity 8, 1-10. [0187] Kozasa, T., Jiang, X., Hart, M. J., Sternweis, P. M., Singer, W. D., Gilman, A. G., Bollag, G., and Sternweis, P. C. (1998). p115 RhoGEF, a GTPase activiating protein for Galphal2 and Galphal3. Science 280, 2109-2111. [0188] Lin, D., Gish, G. D., Son-yang, Z., and Pawson, T. (1999). The carboxyl terminus of B class ephrins constitutes a PDZ domain binding motif. J. Biol. Chem. 274, 3726-3733. [0189] Ma, Q., Jones. D., Borghesani, P. R., Segal, R. A., Nagasawa. T., Kishimoto, T., Bronson, R. T., and Springer, T. A. (1998). Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4- and SDF-1-deficient mice. Proc. Natl. Acad. Sci. USA 95, 9448-9453. [0190] Massague, J., and Pandiella, A. (1993). Membrane-anchored Growth factors. Annu. Rev. Biochem. 62, 515-541. [0191] McGrath, K. E., Koniski, A. D., Maltby, K. M., McGann, J. K., and Palis, J. (1999). Embryonic expression and function of the chemokine SDF-1 and its receptor, CXCR4. Dev. Biol. 213, 442-456. [0192] Melchers, F., Rolink, A. G., and Schaniel, C. (1999). The role of chemokines in regulating cell migration during humoral immune responses. Cell 99, 351-354. [0193] Mellitzer, G., Xu, Q., and Wilkinson, D. G. (1999). Eph receptors and ephrins restrict cell intermingling and communication. Nature 400, 77-81. [0194] Moepps, B., Frodl, R., Rodewald, H. R., Baggiolini, M., and Gierschik, P. (1997). Two murine homologues of the human chemokine receptor CXCR4 mediating stromal cell-derived factor lalpha activation of Gig are differentially expressed in vivo. Eur. J. Immunol. 27, 2102-2112. [0195] Nakamura, F., Kalb, R. G., and Strittmatter, S. M. (2000). Molecular basis of semaphorinmediated axon guidance. J. Neurobiol. 44, 219-229. [0196] Parent, C. A., and Devreotes, P. N. (1999). A cell's sense of direction. Science 284, 765-770. [0197] Pfeffer, S., and Ullrich, A. (1985). Epidermal growth factor. Is the precursor a receptor? Nature 313, 184. [0198] Rakic, P. (1990). Principles of neural cell migration. Experientia 46, 882-891. [0199] Rupp, R. A., Snider, L., and Weintraub, H. (1994). Xenopus embryos regulate the nuclear localization of XMyoD. Genes Dev. 8, 1311-1323. [0200] Schwartz, P. M., Borghesani, P. R., Levy, R. L., Pomeroy, S. L., and Segal, R. A. (1997). Abnormal cerebellar development and foliation in BDNF−/− mice reveals a role for neurotrophins in CNS patterning. Neuron 19, 269-281. [0201] Sheng, M., and Pak, D. T. (2000). Ligand-gated ion channel interactions with cytoskeletal and signaling proteins. Annu. Rev. Physiol. 62, 755-778. [0202] Simons, K., and Ikonen, E. (1997). Functional rafts in cell membranes. Nature 387, 569-572. [0203] Song, H. J., Ming, G. L., and Poo, M. M. (1997). cAMP-induced switching in turning direction of nerve growth cones. Nature 388, 275-279. [0204] Son-yang, Z., Fanning, A. S., Fu, C., Xu, J., Marfatia, S. M., Chishti, A. H., Crompton, A., Chan, A. C., Anderson, J. M., and Cantley, L. C. (1997). Recognition of unique carboxylterminal motifs by distinct PDZ domains. Science 275, 73-77. [0205] Suzuki, G., Sawa, H., Kobayashi, Y., Nakata, Y., Nakagawa, K., Uzawa, A., Sakiyama, H., Kakinuma, S., Iwabachi, K., and Nagashima, K. (1999). Pertussis toxin-sensitive signal controls the trafficking of thymocytes across the corticomedullary junction in the thymus. J. Immunol. 162, 5981-5985. [0206] Torres, R., Firestein, B. L., Dong, H. L., Staudinger, J., Olson, E. N., Huganir, R. L., Bredt, D. S., Gale, N. W., and Yancopoulos, G. D. (1998). PDZ proteins bind, cluster, and synaptically colocalize with Eph receptors and their ephrin ligands. Neuron 21, 1453-1463. [0207] Vancura, K. L., and Jay, D. G. (1998). G proteins and axon growth. Sem. Neurosci. 9, 209219. [0208] Wang, H. U., Chen, Z. F., and Anderson, D. J. (1998). Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor EphB4. Cell 93, 741-753. [0209] Wang, L. H., Kalb, R. G., and Strittmatter, S. M. (1999). A PDZ protein regulates the distribution of the transmembrane semaphorin, M-SemF. J. Biol. Chem. 274, 14137-14146. [0210] Watson, S., and Arkinstall, S. (1994). The G-protein linked receptor factsbook. (London: Academic Press). [0211] Xu, Q., Mellitzer, G., Robinson, V., and Wilkinson, D. G. (1999). In vivo cell sorting in complementary segmental domains mediated by Eph receptors and ephrins. Nature 399, 267-271. [0212] Zheng, B., De Vries, L., and Farquhar, M. G. (1999). Divergence of RGS proteins: evidence for the existence of six mammalian RGS subfamilies. Trends Biochem. Sci. 24, 411-414. [0213] Zou, Y. R., Kottmann, A. H., Kuroda, M., Taniuchi, I., and Littman, D. R. (1998). Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 393, 595-599. CROSS REFERENCE TO RELATED APPLICATIONS
GOVERNMENT FUNDING
TECHNICAL FIELD AND BACKGROUND ART
SUMMARY OF THE INVENTION
BRIEF DESCRIPTION OF THE DRAWINGS
DETAILED DESCRIPTION OF SPECIFIC EMBODIMENTS
EXAMPLES
EXAMPLE 1
Investigation of Reverse Signaling by B ephrin
EXAMPLE 2
Correlated Expression Patterns in Cerebellar Development and Possible Mechanism for Reverse Signaling
EXAMPLE 3
Effect of PDZ-RGS3 on Leukocyte Migration
EXAMPLE 4
Another Possible Function of PDZ-RGS3
REFERENCES