Novel chiral compounds that mimic and/or modulate the activity of wild-type nucleic acids are disclosed. In general, the compounds are phosphorothioate oligonucleotides wherein the 5', and the 3'-terminal internucleoside linkages are chirally Sp and internal internucleoside linkages are chirally Rp.
1. An oligomeric compound of the formula:
wherein:
each Nu1and Nu2, independently, has the formula:
wherein
Bx is a heterocyclic base moiety; Lx is hydrogen, a protecting group or a substituent group; one of R12, R13and R14is hydroxyl, a protected hydroxyl, a covalent attachment to a solid support, a nucleoside, an oligonucleoside, a nucleotide, an oligonucleotide, a conjugate group or an optionally protected substituent group; another of R12, R13and R14is hydrogen, hydroxyl, a protected hydroxyl or an optionally protected substituent group; the remaining of R12, R13and R14, of Nu1, is L1; the remaining of R12, R13and R14, of Nu2, is L2; each L1and each L2is, independently, a phosphodiester, phosphorodithioate; chiral Sp phosphorothioate; phosphoramidate; thiophosphoramidate; phosphonate; methylene phosphonate; phosphotriesters; thionoalkylphosphonate; thionoalkylphosphotriester; boranophosphate; boranothiophosphate; thiodiester; thionocarbamate; siloxane; carbamate; sulfamate; morpholino sulfamide; sulfonamide; sulfide; sulfonate; N,N′-dimethylhvdrazine; thioformacetal; formacetal; thioketal; ketal; amine (—NH—CH2—CH2—); hydroxylamine; hydroxylimine; hydrazinyl; amide (—CH2—N(JJ)—C(O)—) and (—CH2—C(O)—N(JJ)—); oxime (—CH2—O—N═CH—); or alkylphosphorus (—C(JJ)2—P(═O)(OJJ)—C(JJ)2—C(JJ)2—) internucleoside linkage, wherein each JJ is, independently, hydrogen or C1to C10alkyl wherein at least one of L1and L2is other than phosphodiester; Y has the formula:
wherein;
each Rp is a chiral Rp phosphorothioate internucleotide linkage; and each n, m and p is, independently, from 1 to 100; where the sum of n, m and p is from 3 to about 200; wherein the oligomeric compound comprises from 5 to about 50 nucleosides. 2. The oligomeric compound of 3. The oligomeric compound of 4. The oligomeric compound of 5. The oligomeric compound of 6. The oligomeric compound of 7. The oligomeric compound of or each substituent group has one of formula I or II:
wherein:
Z0is O, S or NH; J is a single bond, O or C(═O); E is C1-C10alkyl, N(R1)(R2), N(R1)(R5), N═C(R1)(R2), N═C(R1)(R5) or has one of formula III or IV;
each R6, R7, R8, R9and R10is, independently, hydrogen, C(O)R11, substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C2-C10alkenyl, substituted or unsubstituted C2-C10alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group or a conjugate group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl; or optionally, R7and R8, together form a phthalimido moiety with the nitrogen atom to which they are attached; or optionally, R9and R10, together form a phthalimido moiety with the nitrogen atom to which they are attached; each R11is, independently, substituted or unsubstituted C1-C10alkyl, trifluoromethyl, cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy, 9-fluorenylmethoxy, 2-(trimethylsilyl)ethoxy, 2,2,2-trichloroethoxy, benzyloxy, butyryl, iso-butyryl, phenyl or aryl; R5is T-L, T is a bond or a linking moiety; L is a chemical functional group, a conjugate group or a solid support material; each R1and R2is, independently, H, a nitrogen protecting group, substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C2-C10alkenyl, substituted or unsubstituted C2-C10alkynyl, wherein said substitution is OR3, SR3, NH3+, N(R3)(R4), guanidino or acyl where said acyl is an acid amide or an ester; or R1and R2, together, are a nitrogen protecting group or are joined in a ring structure that optionally includes an additional heteroatom selected from N and O; or R1, T and L, together, are a chemical functional group; each R3and R4is, independently, H, C1-C10alkyl, a nitrogen protecting group, or R3and R4, together, are a nitrogen protecting group; or R3and R4are joined in a ring structure that optionally includes an additional heteroatom selected from N and O; Z4is OX, SX, or N(X)2; each X is, independently, H, C1-C8alkyl, C1-C8haloalkyl, C(═NH)N(H)R5, C(═O)N(H)R5or OC(═O)N(H)R5; R5is H or C1-C8alkyl; Z1, Z2and Z3comprise a ring system having from about 4 to about 7 carbon atoms or having from about 3 to about 6 carbon atoms and 1 or 2 hetero atoms wherein said hetero atoms are selected from oxygen, nitrogen and sulfur and wherein said ring system is aliphatic, unsaturated aliphatic, aromatic, or saturated or unsaturated heterocyclic; Z5is alkyl or haloalkyl having 1 to about 10 carbon atoms, alkenyl having 2 to about 10 carbon atoms, alkynyl having 2 to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms, N(R1)(R2) OR1, halo, SR1or CN; each q1is, independently, an integer from 1 to 10; each q2is, independently, 0 or 1; q3is 0 or an integer from 1 to 10; q4is an integer from 1 to 10; q5is from 0, 1 or 2; and provided that when q3is 0, q4is greater than 1. 8. The oligomeric compound of 9. The oligomeric compound of 10. The oligomeric compound of 11. The oligomeric compound of
5′-(Nu1—L1)n—Y—(L2-Nu2)p—3′
This patent application is a continuation-in-part of application Ser. No. 09/352,058, filed on Jul. 14, 1999, entitled “Oligonucleotides Having Site Specific Chiral Phosphorothioate Internucleoside Linkages”, the contents of which is incorporated herein by reference in its entirety, and a continuation of Ser. No. 09/115,027, filed Jul. 14, 1998, now U.S. Pat. No. 6,242,589. This invention relates to the design and synthesis of nuclease resistant gapped oligonucleotides which are useful for therapeutics, diagnostics and as research reagents. Oligomers are provided having internal deoxyribose regions having all chiral Rp phosphorothioate internucleoside linkages and external regions having nuclease resistant modifications. Such oligomers are resistant to nuclease degradation and are capable of modulating the activity of DNA and RNA. It is well known that most of the bodily states in multicellular organisms, including most disease states, are effected by proteins. Such proteins, either acting directly or through their enzymatic or other functions, contribute in major proportion to many diseases and regulatory functions in animals and man. For disease states, classical therapeutics has generally focused upon interactions with such proteins in efforts to moderate their disease-causing or disease-potentiating functions. In newer therapeutic approaches, modulation of the actual production of such proteins is desired. By interfering with the production of proteins, the maximum therapeutic effect can be obtained with minimal side effects. It is therefore a general object of such therapeutic approaches to interfere with or other-wise modulate gene expression, which would lead to undesired protein formation. One method for inhibiting specific gene expression is with the use of oligonucleotides, especially oligonucleotides which are complementary to a specific target messenger RNA (mRNA) sequence. Several oligonucleotides are currently undergoing clinical trials for such use. Phosphorothioate oligonucleotides are presently being used as therapeutic agents in human clinical trials against various disease states, including use as antiviral agents. In addition to such use as both indirect and direct regulators of proteins, oligonucleotides also have found use in diagnostic tests. Such diagnostic tests can be performed using biological fluids, tissues, intact cells or isolated cellular components. As with gene expression inhibition, diagnostic applications utilize the ability of oligonucleotides to hybridize with a complementary strand of nucleic acid. Hybridization is the sequence specific hydrogen bonding of oligomeric compounds via Watson-Crick and/or Hoogsteen base pairs to RNA or DNA. The bases of such base pairs are said to be complementary to one another. Oligonucleotides are also widely used as research reagents. They are useful for understanding the function of many other biological molecules as well as in the preparation of other biological molecules. For example, the use of oligonucleotides as primers in PCR reactions has given rise to an expanding commercial industry. PCR has become a mainstay of commercial and research laboratories, and applications of PCR have multiplied. For example, PCR technology now finds use in the fields of forensics, paleontology, evolutionary studies and genetic counseling. Commercialization has led to the development of kits which assist non-molecular biology-trained personnel in applying PCR. Oligonucleotides, both natural and synthetic, are employed as primers in such PCR technology. Oligonucleotides are also used in other laboratory procedures. Several of these uses are described in common laboratory manuals such as A number of chemical modifications have been introduced into oligonucleotides to increase their usefulness in diagnostics, as research reagents and as therapeutic entities. Such modifications include those designed to increase binding to a target strand (i.e. increase melting temperatures, Tm), to assist in identification of an oligonucleotide or an oligonucleotide-target complex, to increase cell penetration, to stabilize against nucleases and other enzymes that degrade or interfere with the structure or activity of the oligonucleotides, to provide a mode of disruption (terminating event) once sequence-specifically bound to a target, and to improve the pharmacokinetic properties of the oligonucleotide. The complementarity of oligonucleotides has been used for inhibition of a number of cellular targets. Complementary oligonucleotides are commonly described as being antisense oligonucleotides. Various reviews describing the results of these studies have been published including Progress In Antisense Oligonucleotide Therapeutics, Crooke, S. T. and Bennett, C. F., The pharmacological activity of oligonucleotides, like other therapeutics, depends on a number of factors that influence the effective concentration of these agents at specific intracellular targets. One important factor for oligonucleotides is the stability of the species in the presence of nucleases. It is unlikely that unmodified, naturally-occurring oligonucleotides will be useful therapeutic agents because they are rapidly degraded by nucleases. The limitations of available methods for modification of the phosphate backbone of unmodified oligonucleotides have led to a continuing and long felt need for other modifications which provide resistance to nucleases and satisfactory hybridization properties for antisense oligonucleotide diagnostics and therapeutics. Oligonucleotides having phosphorothioate modified backbones have shown therapeutic effects against numerous targets. This success is due in part to the increased nuclease resistance of the phosphorothioate backbone relative to the naturally occurring phosphodiester backbone. The phosphorothioate linkage unlike the phosphodiester linkage has 2 enantiomers, Rpand Sp. It has been shown that a 3′-Rplinkage is labile to at least one exonuclease in the cytosol of HUVEC cells (Koziolkiewicz et al. A specific feature of oligonucleotides as drugs is that they must be stable in vivo long enough to be effective. Consequently, much research has been focused on enhancing the stability of oligonucleotide therapeutics while maintaining their specific binding properties. Recently, several groups have reported that chiral phosphorothioate oligonucleotide analogs have enhanced binding properties (Rp isomer) to the target RNA as well as significant stabilization to exonucleases (Sp isomer) (See Koziolkiewicz et al., Presently, there is no method to prepare P-chiral oligonucleotides in large scale. Current methods include synthesis and chromatographic isolation of stereoisomers of the chiral building blocks. (Stec et al., Stereoregular phosphorothioate analogs of pentadecamer 5′-d(AGATGTTTGA GCTCT)-3′ were synthesized by the oxathiaphospholane method (Koziolkiewicz et al., (S)-1-(indol-2-yl)-propan-2-ol was used as a chiral auxiliary to form a dinucleotide phosphorothioate triester in 97% ee (Wang et al., A stereoselective preparation of dinucleotide phosphorothioates with a diastereomeric excess of >98%, using hydroxy(indolyl)butyronitrile I as chiral auxiliaries, is reported (Wang et al., 1,2-O-Cyclopentylidene-5-deoxy-5-isopropylamino-D-xylofuranose and its enantiomer were used as chiral auxiliaries to form, respectively, Sp and Rp dithymidine phosphorothioates in 98% diastereomeric excess, using phosphoramidite methodologies and 2-bromo-4,5-dicyanoimidazole as catalyst (Jin et al., Oligonucleotide phosphorothioates were synthesized using prokaryotic DNA polymerase and oligonucleotide template/primer (Lackey et al., Phosphorothioate oligodeoxyribonucleotides were tested for their ability to recognize double-helical DNA in two distinct triple helix motifs (Hacia et al., An enzymatic protocol has been established for the synthesis of stereoregular (all Rp) oligodeoxyribonucleotide phosphorothioates. A 25-mer oligodeoxynucleotide phosphorothioate has been synthesized and studied for biophysical and biochemical properties (Tang et al., Stability of oligo(nucleoside phosphorothioate)s (PS-oligos) in HUVEC (human umbilical vein endothelial cells) has been studied (Koziolkiewicz et al., Enzymatic hydrolysis of stereoregular oligodeoxy-ribonucleoside phosphorothioates (PS-oligos) synthesized via the oxathiaphospholane method has been used for assignment of their diastereomeric purity (Koziolkiewicz et al., An NMR study of the structure of dissolved DNA/RNA hybrid containing stereoregular Rp-phosphorothioate modifications of all DNA backbone linkages was recently examined. The complex of the enzymatically synthesized phosphorothioate DNA octamer (all-Rp)-d(GCGTCAGG) and its complementary RNA r(CCUGACGC) had an overall conformation within the A-form family (Bachelin et al., New monomers, 5′-O-DMT-deoxyribonucleoside 3′-O-(2-thio-“spiro”-4,4-penta-methylene-1,3,2-oxathiaphospholane)s, were prepared and used for the stereo-controlled synthesis of PS-Oligos via the oxathiaphospholane approach (Stec et al., The DBU-assisted 1,3,2-oxathiaphospholane ring opening condensation of the separate diastereomers of 5′-O-DMT-2′-O-TBDMS-ribonucleoside-3′-O-(2-thiono-1,3,2-oxathiaphospholane)s with 2′-TBDMSi-protected ribonucleoside bound to the solid support via the 3′-oxygen occurs with 96-100% stereospecificity and gives, after deprotection, [Rp]- or [SP]-diribonucleoside 3′,51′-phosphorothioates I (B=adenine, cytosine, guanine, uracil) in 65-97% yield (Sierzcha-la et al., Diastereomerically pure 5′-O-DMT-nucleoside 3′-O-(2-thio-1,3,2-oxathiaphospholanes) (B═T, Adebz, Cytbz) were used for the synthesis of stereo-regular phosphorothioates (Stec et al., It has been previously reported that four membered cyclic sulfur compounds are kinetically and thermodynamically facile compounds to form (Eliel et al., In a similar publication the neighboring group participation of oxygen in the solvolysis of acyclic-alkoxy substituted p-toluenesulfonates was illustrated (Eliel et al., In a recent review article entitled “New gem- and vic-disubstituent effects on cyclizations”, (Jung, Michael E., In accordance with this theory, the structures 3, 8, 14, 18, 20, and 25 all have geminal disubstituents. Use of this concept to synthesize chiral phosphorothioates with the concurrent formation of 4-membered cyclic thio compounds is novel. Oligonucleotides that have chiral Sp phosphorothioate internucleotide linkages at the 3′-terminus are disclosed in International Publication Number WO 99/05160, published Feb. 4, 1999. Methods for the enzymatic synthesis of oligonucleotides are disclosed by Hyman in U.S. Pat. Ser. No., 5,602,000 issued Feb. 11, 1997, entitled “Method for Enzymatic Synthesis of Oligonucleotides”. The solid-phase stereoselective synthesis of 2′-O-methyl oligoribonucleoside phosphorothioates has been reported using bicyclic oxazaphospholidines (Guo et al., Enzymes are also being used to prepare random libraries (aptamers) having both phosphodiester and phosphorothioate internucleoside linkages where the phosphorothioate internucleoside linkages are chiral Rp linkages (King et al., The present invention provides nuclease resistant oligomeric compounds which are useful for therapeutics, diagnostics and as research reagents. The present invention provides gapped oligomeric compounds (gapmers) that have improved binding affinity and nuclease resistance relative to unmodified oligonucleotides. The gapmers are prepared having an internal chiral Rp deoxyphosphorothioate region flanked on each end by external regions. The internal region imparts enhanced binding affinity to targets such as complementary nucleic acids. The external regions of linked nucleosides are altered to impart enhanced nuclease resistance to the gapmers. Such alterations include modifying the points of attachment or the chemistry of the internucleotide linkage, the addition of substituent groups and the modification of sugar configurations. In a preferred embodiment the oligomeric compounds of the invention have the formula;
In one aspect of the present invention internucleoside linkages of one or both of the external regions are modified to enhance the nuclease resistance of the resulting oligomeric compound. Essentially all of the internucleoside linkages of the external regions could be modified in such a manner. In a preferred embodiment both of the external regions comprise a single nucleoside and a single modified internucleoside linkage bound to the internal region. Included are chemical modifications, positional modifications or combinations of both. Representative phosphorus and non-phosphorus containing internucleoside linking moieties that impart nuclease resistance are well documented in the prior art and include without limitation the following: phosphorus containing linkage
“J” denotes a substituent group which is commonly hydrogen or an alkyl group, but which can be a more complicated group that varies from one type of linkage to another. In addition to linking groups as described above that involve the modification or substitution of one or more of the —O—P(O)2—O— atoms of a naturally occurring linkage, included within the scope of the present invention are linking groups that include modification of the 5′-methylene group as well as one or more of the atoms of the naturally occurring phosphodiester linkage. Linking groups (or linkages) of this type are well documented in the literature and include without limitation the following:
Synthetic schemes for the synthesis of the substitute internucleoside linkages described above are disclosed in: WO 91/08213; WO 90/15065; WO 91/15500; WO 92/20822; WO 92/20823; WO 91/15500; WO 89/12060; EP 216860; U.S. Ser. No. 92/04294; U.S. Ser. No. 90/03138; U.S. Ser. No. 91/06855; U.S. Ser. No. 92/03385; U.S. Ser. No. 91/03680; U.S. patent applications, Ser. Nos. 07/990,848; 07,892,902; 07/806,710; 07/763,130; 07/690,786; U.S. Pat. Nos. 5,466,677; 5,034,506; 5,124,047; 5,278,302; 5,321,131; 5,519,126; 4,469,863; 5,455,233; 5,214,134; 5,470,967; 5,434,257; Stirchak, E. P., et al., Other modifications can be made to the sugar, to the base, or to the phosphate group of nucleosides in the external regions. Representative modifications are disclosed in International Publication Numbers WO 91/10671, published Jul. 25, 1991, WO 92/02258, published Feb. 20, 1992, WO 92/03568, published Mar. 5, 1992, and U.S. Pat. Nos. 5,138,045, 5,218,105, 5,223,618 5,359,044, 5,378,825, 5,386,023, 5,457,191, 5,459,255, 5,489,677, 5,506,351, 5,541,307, 5,543,507, 5,571,902, 5,578,718, 5,587,361, 5,587,469, all assigned to the assignee of this application. The use of one or more L-ribose sugars in the external regions is also amenable to the present invention (Damha M. J., et al., 1994, 33, 7877-7885). The disclosures of each of the above referenced publications are herein incorporated by reference. Preferred modified oligonucleoside linkages include, for example, chiral Sp phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3′-, and 5′-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3′-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. Various salts, mixed salts and free acid forms are also included. Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, certain of which are commonly owned with this application, and each of which is herein incorporated by reference. Preferred modified oligonucleoside linkages that do not include a phosphorus atom therein include alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thiofornacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2component parts. Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,633,360; 5,663,312; 5,677,437; and 5,677,439, certain of which are commonly owned with this application, and each of which is herein incorporated by reference. Positional modifications, also known in the art, involve the linking of nucleosides in a non-naturally occurring motif. As used herein the term “positional modification” is meant to include without limitation 2′,5′-internucleoside linkages. Combining modifications e.g. using modified chemistries and positional modifications of selected internucleoside linkages is also amenable to the present invention where for example a 2′,5′-phosphoramidate internucleoside linkage is employed. The 2′-5′-linkage has been used at the termini of oligomeric compounds to enhance the nuclease resistance (as described in U.S. application Ser. No. 09/115,043, filed Jul. 14, 1998). In another aspect of the present invention nuclease resistance is imparted to oligomeric compounds by covalently attaching a substituent group to at least one nucleoside in one or both of the external regions. In one embodiment each of the nucleosides in the external regions have a covalently attached substituent group. Generally, selected nucleosides will have a substituent group covalently attached to a 2′, 3′ or 5′-position of a sugar moiety. In addition to the sugar moiety a heterocyclic base moiety can also have a substituent group attached thereto. Substituent groups can be covalently attached to purines at the N2 or N6 position and pyrimidines at the N4 or C5 position. A preferred position is the 2′ position of the sugar moiety. A representative list of substituent groups amenable to the present invention include C1-C20alkyl, C2-C20alkenyl, C2-C20alkynyl, C5-C20aryl, O-alkyl, O-alkenyl, O-alkynyl, O-alkylamino, O-alkylalkoxy, O-alkylaminoalkyl, O-alkyl imidazole, S-alkenyl, S-alkynyl, NH-alkyl, NH-alkenyl, NH-alkynyl, N-dialkyl, O-aryl, S-aryl, NH-aryl, O-aralkyl, S-aralkyl, NH-aralkyl, N-phthalimido, halogen (particularly fluoro), keto, carboxyl, nitro, nitroso, nitrile, trifluoromethyl, trifluoromethoxy, imidazole, azido, hydrazino, hydroxylamino, isocyanato, sulfoxide, sulfone, sulfide, disulfide, silyl, heterocycle, carbocycle, polyamine, polyamide, polyalkylene glycol, and polyethers of the formula (O-alkyl)m, where m is 1 to about 10. Preferred among these polyethers are linear and cyclic polyethylene glycols (PEGs), and (PEG)-containing groups, such as crown ethers and those which are disclosed by Ouchi et al. ( Additional substituent groups amenable to the present invention include —SR and —NR2groups, wherein each R is, independently, hydrogen, a protecting group or substituted or unsubstituted alkyl, alkenyl, or alkynyl. 2′-SR nucleosides are disclosed in U.S. Pat. No. 5,670,633, issued Sep. 23, 1997, hereby incorporated by reference in its entirety. The incorporation of 2′-SR monomer synthons are disclosed by Hamm et al., Further substituent groups have one of formula I or II:
Representative substituent groups of Formula I are disclosed in U.S. patent application Ser. No. 09/130,973, filed Aug. 7, 1998, entitled “Capped 2′-Oxyethoxy Oligonucleotides,” hereby incorporated by reference in its entirety. Representative cyclic substituent groups of Formula II are disclosed in U.S. patent application Ser. No. 09/123,108, filed Jul. 27, 1998, entitled “RNA Targeted 2′-Modified Oligonucleotides that are Conformationally Preorganized,” hereby incorporated by reference in its entirety. Particularly preferred substituent groups include O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, O(CH2)nON[(CH2)nCH3)]2(where n and m are from 1 to about 10), C1to C10lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino and substituted silyl. Another particularly preferred modification includes 2′-methoxyethoxy (2′—O—CH2CH2OCH3or 2′—MOE, Martin et al., Other preferred modifications include 2′-methoxy (2′—O—CH3), 2′-aminopropoxy (2′-OCH2CH2CH2NH2) and 2′-fluoro (2′-F). Similar modifications may also be made at other positions on nucleosides and oligomers, particularly the 3′ position of the sugar on the 3′ terminal nucleoside or at a 3′-position of a nucleoside that has a linkage from the 2′-position such as a 2′-5′ linked oligomer and at the 5′-position at a 5′-terminus. Oligomers may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugars structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 30 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,0531 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned, and each of which is herein incorporated by reference, and commonly owned U.S. patent application Ser. No. 08/468,037, filed on Jun. 5, 1995, also herein incorporated by reference. Representative guanidino substituent groups that are shown in formula III and IV are disclosed in co-owned U.S. patent application Ser. No. 09/349,040, entitled “Functionalized Oligomers”, filed Jul. 7, 1999, hereby incorporated by reference in its entirety. Representative acetamido substituent groups are disclosed in U.S. patent application Ser. No. 09/XXX,XXX, entitled “2′—O—Acetamido Modified Monomers and Oligomers”, filed Aug. 19, 1999, also identified by attorney docket number ISIS-4071, hereby incorporated by reference in its entirety. Representative dimethylaminoethyloxyethyl substituent groups are disclosed in International Patent Application PCT/US99/XXXXX, entitled “2′—O—Dimethylaminoethyloxyethyl-Modified Oligonucleotides”, filed Aug. 6, 1999, also identified by attorney docket number ISIS-4045, hereby incorporated by reference in its entirety. The use of mixed modifications in the external regions to impart nuclease resistance to oligomeric compounds is also within the scope of the present invention. For example an oligomeric compound of the invention can have enhanced nuclease resistance resulting from one or more modified internucleoside linkages at the 5′ end and one or more substituent groups at the 3′ end. Another type of a mixed modification includes having a modified internucleoside linkage and a substituent group at the same end of a selected oligomeric compound. Other examples include substituent groups or modified linkages used in conjunction with a non-standard linkage such as a 2′, 5′-internucleoside linkage. Oligomeric compounds of the present invention comprise two external regions each having at least one nucleoside and one internucleoside linkage flanking a chiral Rp phosphorothioate internal region. There can be a plurality of up to about 50 linked nucleosides in each external region. A more preferred range is from 1 to about 6 with 1 to about 3 being more preferred. The chiral Rp 2′-deoxyphosphorothioate internal region can comprise a plurality of nucleosides with modern techniques allowing routine synthesis of oligomeric compounds having well over 100 nucleosides. A preferred range is from about 3 to about 48 with from about 5 to about 28 being more preferred. An even more preferred range is from about 12 to about 23 nucleosides. Oligomeric compounds according to the present invention that are hybridizable to a target nucleic acid preferably comprise from about 5 to about 50 nucleosides. It is more preferred that such compounds comprise from about 8 to about nucleosides, with 15 to 25 nucleosides being particularly preferred. Cleavage of oligomeric compounds by nucleolytic enzymes requires the formation of an enzyme-substrate complex, or in particular, a nuclease-oligomer complex. The nuclease enzymes will generally require specific binding sites located on the oligomers for appropriate attachment. If the oligomer binding sites are removed or blocked, such that nucleases are unable to attach, the oligomers will be nuclease resistant. In the case of restriction endonucleases that cleave sequence-specific palindromic double-stranded DNA, certain binding sites such as the ring nitrogen in the 3- and 7-positions of heterocyclic base moieties have been identified as required binding sites. Removal of one or more of these sites or sterically blocking approach of the nuclease to these particular positions within the oligomer has provided various levels of resistance to specific nucleases. In the context of this invention, “hybridization” shall mean hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleosides. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. “Complementary,” as used herein, also refers to sequence complementarity between two nucleotides. For example, if a nucleotide at a certain position of an oligomeric compound is capable of hydrogen bonding with a nucleotide at the same position of a DNA or RNA molecule, then the oligomeric compound and the DNA or RNA are considered to be complementary to each other at that position. The oligomeric compound and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleosides which can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligomeric compound and the DNA or RNA target. It is understood that an oligomeric compound need not be 100% complementary to its target DNA sequence to be specifically hybridizable. An oligomeric compound is specifically hybridizable when binding of the oligomeric compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligomeric compound to non-target sequences under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays or therapeutic treatment, or in the case of in vitro assays, under conditions in which the assays are performed. It is known from X-ray diffraction analysis of nucleic acid fibers (Arnott and Hukins, The primary contributor to the conformation of the pentofuranosyl moiety is the nature of the substituent at the 2′-position. Thus, the population of the C3′-endo form increases with respect to the C2′-endo form as the electronegativity of the 2′-substituent increases. For example, among 2′-deoxy-2′-haloadenosines, the 21-fluoro derivative exhibits the largest population (65%) of the C3′-endo form, and the 2′-iodo exhibits the lowest population (7%). Those of adenosine (2′—OH) and deoxyadenosine (2′-H) are 36% and 19%, respectively. Furthermore, the effect of the 2′-fluoro group of adenosine dimers (2′-deoxy-2′-fluoroadeno-sine-2′-deoxy-2′-fluoro-adenosine) is further correlated to the stabilization of the stacked conformation. Research indicates that dinucleoside phosphates have a stacked conformation with a geometry similar to that of A—A but with a greater extent of base-base overlapping than A—A. It is assumed that the highly polar nature of the C2′-F bond and the extreme preference for C3′-endo puckering may stabilize the stacked conformation in an “A” structure. Data from UV hypochromicity, circular dichroism, and1H NMR also indicate that the degree of stacking decreases as the electronegativity of the halo substituent decreases. Furthermore, steric bulk at the 2′-position of the sugar moiety is better accommodated in an “A” form duplex than a “B” form duplex. Thus, a 21-substituent on the 3′-nucleotidyl unit of a dinucleoside monophosphate is thought to exert a number of effects on the stacking conformation: steric repulsion, furanose puckering preference, electrostatic repulsion, hydrophobic attraction, and hydrogen bonding capabilities. These substituent effects are thought to be determined by the olecular size, electronegativity, and hydrophobicity of the substituent. Studies with a 2′-OMe modification of 2′-deoxy guanosine, cytidine, and uridine dinucleoside phosphates exhibit enhanced stacking effects with respect to the corresponding unmethylated species (2′-OH). In this case, it is believed that the hydrophobic attractive forces of the methyl group tend to overcome the destabilizing effects of its steric bulk. Melting temperatures (complementary binding) are increased with the 2′-substituted adenosine diphosphates. It is not clear whether the 3′-endo preference of the conformation or the presence of the substituent is responsible for the increased binding. However, greater overlap of adjacent bases (stacking) can be achieved with the 3′-endo conformation. A heterocyclic base moiety (often referred to in the art simply as a “base” or a “nucleobase”) amenable to the present invention includes both naturally and non-naturally occurring nucleobases. The heterocyclic base moiety further may be protected wherein one or more functionalities of the base bears a protecting group. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine and guanine, and the pyrimidine bases thymine, cytosine and uracil. Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in the Certain nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Id., pages 276-278) and are presently preferred base substitutions, even more particularly when combined with 2′-methoxyethyl sugar modifications. Representative United States patents that teach the preparation of modified nucleobases include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941, certain of which are commonly owned, and each of which is herein incorporated by reference, and commonly owned U.S. patent application Ser. No. 08/762,488, filed on Dec. 10, 1996, also herein incorporated by reference. The attachment of conjugate groups to oligomers is well documented in the prior art. The oligomeric compounds of the invention can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. In a preferred embodiment conjugate groups are attached at one of the 5′ or 3′-terminal ends of oligomers of the invention. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugates groups include cholesterols, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve oligomer uptake, distribution, metabolism or excretion. Representative conjugate groups are disclosed in International Patent Application PCT/US92/09196, filed Oct. 23, 1992, U.S. Pat. No. 5,578,718, issued Jul. 1, 1997, and U.S. Pat. No. 5,218,105. Each of the foregoing is commonly assigned with this application. The entire disclosure of each is incorporated herein by reference. Preferred conjugate groups amenable to the present invention include lipid moieties such as a cholesterol moiety (Letsinger et al., Other groups that can be attached to oligomeric compounds of the invention to modify antisense properties include RNA cleaving complexes, pyrenes, metal chelators, porphyrins, alkylators, hybrid intercalator/ligands and photo-crosslinking agents. RNA cleavers include o-phenanthroline/Cu complexes and Ru(bipyridine)32+ complexes. The Ru(bpy)32+ complexes interact with nucleic acids and cleave nucleic acids photochemically. Metal chelators include EDTA, DTPA, and o-phenanthroline. Alkylators include compounds such as iodoacetamide. Porphyrins include porphine, its substituted forms, and metal complexes. Pyrenes include pyrene and other pyrene-based carboxylic acids that could be conjugated using the similar protocols. Hybrid intercalator/ligands include the photonuclease/intercalator ligand 6-[[[9-[[6-(4-nitro-benzamido)hexyl]amino]acridin-4-yl]carbonyl]amino]hexanoylpentafluorophenyl ester. This compound has two noteworthy features: an acridine moiety that is an intercalator and a p-nitro benzamido group that is a photonuclease. Photo-crosslinking agents include aryl azides such as, for example, N-hydroxysucciniimidyl-4-azidobenzoate (HSAB) and N-succinimidyl-6(−4′-azido-2′-nitrophenyl-amino)hexanoate (SANPAH). Aryl azides conjugated to oligonucleotides effect crosslinking with nucleic acids and proteins upon irradiation, They also crosslink with carrier proteins (such as KLH or BSA), raising antibody against the oligonucleotides. Vitamins can also be attached to oligomeric compounds Of the invention to improve properties such as absorption and distribution. Vitamins according to the invention generally can be classified as water soluble or lipid soluble. Water soluble vitamins include thiamine, riboflavin, nicotinic acid or niacin, the vitamin B6pyridoxal group, pantothenic acid, biotin, folic acid, the B12cobamide coenzymes, inositol, choline and ascorbic acid. Lipid soluble vitamins include the vitamin A family, vitamin D, the vitamin E tocopherol family and vitamin K (and phytols). The vitamin A family, including retinoic acid and retinol, are absorbed and transported to target tissues through their interaction with specific proteins such as cytosol retinol-binding protein type II (CRBP-II), retinol-binding protein (RBP), and cellular retinol-binding protein (CRBP). These proteins, which have been found in various parts of the human body, have molecular weights of approximately 15 kD. They have specific interactions with compounds of vitamin-A family, especially, retinoic acid and retinol. As used herein, “polyamine” refers to a moiety containing a plurality of amine or substituted amine functionalities. Polyamines according to the present invention have at least two amine functionalities. “Polypeptide” refers to a polymer comprising a plurality of amino acids linked by peptide linkages, and includes dipeptides and tripeptides. The amino acids may be naturally-occurring or non-naturally-occurring amino acids. Polypeptides according to the present invention comprise at least two amino acids. The gapmers of the present invention can include appropriate activated phosphorus groups such as activated phosphate groups and activated phosphite groups. As used herein, the terms activated phosphate and activated phosphite groups refer to activated monomers or oligomers that are reactive with a hydroxyl group of another monomeric or oligomeric compound to form a phosphorus-containing internucleotide linkage. Such activated phosphorus groups contain activated phosphorus atoms in PIIIor PVvalency states. Such activated phosphorus atoms are known in the art and include, but are not limited to, phosphoramdite, H-phosphonate and phosphate triesters. A preferred synthetic solid phase synthesis utilizes phosphoramidites as activated phosphates. The phosphoramidites utilize PIIIchemistry. The intermediate phosphite compounds are subsequently oxidized to the PVstate using known methods to yield, in a preferred embodiment, phosphodiester or phosphorothioate internucleotide linkages. Additional activated phosphates and phosphites are disclosed in Tetrahedron Report Number 309 (Beaucage and Iyer, Tetrahedron, 1992, 48, 2223-2311). Functional groups including substituent-groups discussed above which may be located on heterocyclic base and sugar moieties are routinely blocked with protecting (blocking groups) during synthesis and subsequently deblocked. In general, a blocking group renders a chemical functionality of a molecule inert to specific reaction conditions and can later be removed from such functionality in a molecule without substantially damaging the remainder of the molecule. See, Green and Wuts, Protective Groups in Organic Synthesis, 2d edition, John Wiley & Sons, New York, 1991. For example, amino groups can be blocked with nitrogen protecting groups such as phthalimido, 9-fludrenylmethoxycarbonyl (FMOC), triphenylmethylsulfenyl, t-BOC or benzyl groups. Carboxyl groups can be protected as acetyl groups. Representative hydroxyl protecting groups are described by Beaucage et al., The term “nucleoside” as used in connection with this invention refers to a monomeric unit made up of a heterocyclic base moiety joined to a sugar moiety or sugar mimetic through a glycosyl linkage. The term “nucleotide” refers to a nucleoside having a phosphate group on its 3′ or 5′ sugar hydroxyl group. In the context of this invention, the terms “oligomer” and “oligomeric compound” refer to a plurality of naturally-occurring or non-naturally-occurring nucleosides joined together in a specific sequence. The terms “oligomer” and “oligomeric compound” include oligonucleotides, oligonucleotide analogs, oligonucleosides and chimeric oligomeric compounds where there are more than one type of internucleoside linkages dividing the oligomeric compound into regions. Whereas the term “oligonucleotide” has a well defined meaning in the art, the term “oligomeric compound” or “oligomer” is intended to be broader, inclusive of oligomers having all manner of modifications known in the art. Gapped or chimeric compounds are disclosed in for example, U.S. Pat. No. 5,623,065, issued Apr. 22, 1997, the contents of which are incorporated herein by reference. As used herein, the term “oligonucleoside” includes oligomers or polymers containing two or more nucleoside subunits having a non-phosphodiester linking moiety. oligonucleosides according to the invention have a ribofuranose moiety attached to a nucleobase through a glycosyl bond. Gapmer technology has been developed to incorporate modifications at the ends (“wings”) of oligomeric compounds, leaving a phosphorothioate gap in the middle for RNase H activation (Cook, P. D., Gapped oligomeric compounds of the present invention are prepared using solution phase and solid phase techniques known in the art. It may be advantageous to prepare a portion of the gapped oligomer using solution phase methodologies employing enzymatic or chemical methods and then use this piece thus synthesized in solid phase methodologies to form the desired final gapped oligomeric compound. In one aspect of the present invention oligomeric compounds are prepared using known solid phase methodologies. A first modified or unmodified nucleoside is attached to a solid support preferably via a linkage to the 3′-position. The nucleoside could alternatively be attached to a solid support through the 2′-position as when preparing positionally modified internucleoside linkages. Alternatively the solid support with the desired nucleoside is purchased from a commercial source. This nucleoside will ultimately become the nucleoside at the 3′-end of the final oligomeric compound in a standard synthesis. The solid support with the nucleoside attached is placed in a reaction vessel such as a glass reactor. One of the hydroxyl groups (preferably the 5′-hydroxyl group) is deprotected and treated with a second nucleoside having a group reactive with the hydroxyl group (preferably an activated phosphate group) in the presence of an activator such as DBU. The linkage thus formed is optionally oxidized or sulferized. The cycle is repeated to add additional nucleosides until the 3′-external region is completed. In some embodiments only one nucleoside comprises each external region. The last activated monomer added to the 3′-external region will contribute the internucleoside linkage joining the 3′-external region to the chiral Rp deoxyphosphorothioate region (internal region) and will also contribute the 3′-nucleoside for the internal region. The addition of activated monomers is continued to synthesize the remainder of the internal (uniform chiral Rp iu deoxyphosphorothioate) region by iterative addition of nucleosides prepared having chiral auxiliary protecting groups as part of their activated phosphorus groups. After each addition the chiral internucleoside linkage is sulfurized using for example Beaucage reagent. Compounds 3, 14 and 20 are examples of an activated monomers that are incorporated into oligomers to give chiral Rp deoxyphosphorothioate internucleoside linkages after deprotection. The synthesis is continued for the 5′-external region by adding further activated monomers in the same manner as for the 3′-external region. The final gapmer is deblocked and cleaved from the solid support. The deblocking and cleavage steps can be performed concurrently or separately. Traditionally the deblocking and cleavage is performed concurrently by treatment with base such as aqueous NH4OH. Preferred internucleoside linkages that are prepared as illustrated above include:
To incorporate certain internucleoside linkages at one or both of the 3′- or 5′-ends of gapmers of the invention one or more dimers must be prepared and incorporated. One such internucleoside linkage is MMI (methylene(methylimino)). A gapmer of the invention having one MMI internucleoside linkage at each of the 3′- and 5′-ends is prepared by first attaching an MMI dimer to a solid support. Next the internal region is prepared following the procedure illustrated above. The addition of an MMI dimer to the 5′-end requires that the dimer be modified to have an activated phosphorus group incorporating a chiral auxiliary protecting group attached to the 2′-position of the 3′-terminal nucleoside of the dimer if it is desired to have that position part of the chiral Rp internal region. The chiral auxiliary group will give, upon incorporation of the dimer, a chiral Rp phosphorothioate internucleoside linkage. The dimer is modified to incorporate the activated phosphorus group incorporating a chiral auxiliary protecting group as per the procedures of Examples 4, 16 and 23. The final gapped oligomeric compound prepared following this approach will have only nuclease resistant MMI internucleoside linkages separating the terminal 3′, and the 5′-nucleosides from the chiral Rp phosphorothioate internal region. A list of preferred internucleoside linkages that are more amenable to incorporation into the external regions of oligomeric compounds of the invention following the dimer strategy discussed above for MMI internucleoside linkages include:
In one aspect of the present invention, gapped oligimeric compounds are prepared using enzymatic processes or a combination of enzymatic and chemical processes. In 1985, it was reported that a variety of DNA polymerases are capable of accepting 2′-deoxynucleoside 5′-O-(1-thiotriphosphates) (dNTP-αS) of the Sp-configuration as substrates to produce oligonucleotides containing phosphorothioate linkages having the Rp-configuration (Eckstein et al., As an alternative, RNA ligase have been used with 3′-O-protected nucleotides as a substrate for the synthesis of oligonucleotides (Hyman ibid). RNA ligases are ubiquitous and promote the joining of single-stranded oligonucleotides in the absence of a complementary template strand. For example, phage T4 RNA ligase has been reported to connect a 5′-phosphate to a 3′-hydroxyl group in vitro, which makes this enzyme valuable for ligating oligonucleotides derived synthetically or enzymatically. RNA ligase can use ATP or dATP as its energy source for the ligation reactions. A wide variety of naturally occurring and non-naturally occurring e.g. synthetic nucleotide analogues, are accepted as substrates. This has enabled enzymatic synthesis of oligomeric compounds having nucleosides with modified sugar and base moieties (Brennan et al., In one aspect of the present invention a gapped oligomeric compound is prepared using methods and techniques illustrated in the prior art. To prepare a gapped oligomeric compound a first external region is prepared having one or more nucleoside residues either by standard chemical or enzymatic techniques. This first external region is connected or ligated by RNA ligase to an internal region. The internal region is easily prepared using enzymatic methods. Subsequently, the larger fragments can be either purified if necessary or further ligated to another monomer or oligomer to furnish a much larger oligomeric molecule. This process can be repeated until a desired gapped oligomeric compound is prepared having a desired length and sequence. Therefore, one can take advantage of the all-Rp isomer made via enzymatic method and enhance its stability in vivo by end capping with a modified residue synthesized separately. Enzymatic synthesis of an all-Rp phosphorothioate oligonucleotide core may have several advantages over the traditional automated phosphoramidite chemistry. For example, the coupling reaction can be performed at a lower concentration of enzymes compared to the hazardous reagents, such as dichloromethane and 1-H tetrazole required for the automated synthesis. Also, enzymatic reactions can be carried out at much higher oligomer concentration compared to the solid-phase approach which is currently performed at a 150 mmol scale. This can result in more product yield per synthesis cycle and will eventually help reduce the labor cost. From an environmental point of view, the enzymatic route is superior when compared to the synthetic route because it does not employ any organic solvents and can avoid waste disposal of complex non-biodegradable reagents. The key raw materials for solid-support synthesis are amidites which are difficult to synthesize and costly. The necessary nucleotides required for enzymatic methods can be prepared through a more direct and economical enzymatic method. In one aspect of the present invention gapped oligomeric compounds of formulas 48-51 ( For example, in order to synthesize a gapped oligomeric compound having for example formula 49 ( The compound having Formula 39 is then treated with alkaline phosphatase to remove the 3′-protecting group (Pg2, a phosphate group). Cleavage of 3′-phosphate group furnishes a compound having formula 41 ( Phosphorothioate oligonucleotides having chirally pure intersugar linkages may be analyzed in a number of ways. For example, configuration analysis of resulting sequence specific phosphorothioate oligonucleotides having substantially chirally pure all-Sp or all-Rp intersugar linkages may be determined by the use of [31P] NMR chemical shifts. Such chemical shifts have been used to identify the Rp epimer of a phosphorothioate di-nucleotide (Ludwig et al., The fidelity of sequences of phosphorothioate oligonucleotides of the invention can be determined using the sensitivities of heteroduplexes to S1 nuclease. The sequence of the phosphorothioate oligonucleotides can be further substantiated by labeling the 3′ hydroxyls of phosphorothioate oligonucleotides with [alpha-32P]cordycepin triphosphate, i.e. 3′-deoxyadenosine-5′-triphosphate. The resultant oligomeric compounds may be subjected to enzymatic degradation. The relative ability of oligomeric compounds having regions of chirally pure intersugar linkages, as compared to the identical racemic sequences, to bind to complementary nucleic acid strands is compared by determining the melting temperature of a hybridization complex of each oligomer with its complementary strand. The melting temperature (Tm), a characteristic physical property of double helixes, denotes the temperature in degrees centigrade at which 50% helical versus coiled (unhybridized) forms are present. Tmis measured by using the UV spectrum to determine the formation and breakdown (melting) of hybridization. Base stacking, which occurs during hybridization, is accompanied by a reduction in UV absorption (hypochromicity). Consequently a reduction in UV absorption indicates a higher Tm. The higher the Tm, the greater the strength of the binding of the strands. Non Watson-Crick base pairing has a strong destabilizing effect on the Tm. Consequently, as close to optimal fidelity of base pairing as possible is desired to have optimal binding of an oligomer to its targeted RNA. Oligomeric compounds of the invention are also evaluated as to their resistance to degradation by a variety of exonucleases and endonucleases. Oligomers of the invention are treated with nucleases and then analyzed, as for instance, by polyacrylamide gel electrophoresis (PAGE) followed by staining with a suitable stain such as Stains All™ (Sigma Chem. Co., St. Louis, Mo.). Degradation products are quantitated using laser densitometry. The sensitivity of heteroduplexes formed from oligomeric compounds of the invention with target nucleic acid to catalytic activity of RNase H is also easily assessed. An oligomeric compound is incubated with a radiolabeled target mRNA (synthesized as for instance via T7 RNA polymerase) at various temperatures for hybridization. Heteroduplexes can then be incubated at 37° C. with RNase H from Comparisons of the susceptibility of heteroduplexes to the catalytic action of As used herein the term “chiral auxiliary” is meant to include groups that function to provide chirality to internucleoside phosphorus linkages during the course of the synthesis of oligomeric phosphorothioates. Chiral auxiliaries will give either Sp or Rp chirality for the respective internucleoside linkage in the final oligomeric compound. Accordingly, chiral auxiliaries are allowed to remain on the growing chain, and are removed at the end of the iterative synthetic regime. Removal of chiral auxiliaries can be conveniently accomplished in a single treatment after the completion of the iterative synthesis. As used herein, the term “alkyl” includes, but is not limited to, straight chain, branched chain and alicyclic hydrocarbon groups. Alkyl groups of the present invention may be substituted. Representative alkyl substituents are disclosed in U.S. Pat. No. 5,212,295, at column 12, lines 41-50, hereby incorporated by reference in its entirety. Substituent groups include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, hydroxyl, alkoxy, alcohol, benzyl, phenyl, nitro, thiol, thioalkoxy, thioalkyl, trifluoromethyl, halo, nitrile, trifluoromethoxy and azido. As used herein, the term “lower alkyl” is intended to mean an alkyl group having 10 or fewer carbons. Alkenyl groups according to the invention are to straight chain, branch chain, and cyclic hydrocarbon groups containing at least one carbon-carbon double bond, and alkynyl groups are to straight chain, branch chain, and cyclic hydrocarbon groups containing at least one carbon-carbon triply bond. Alkenyl and alkynyl groups of the present invention can be substituted. Aryl groups are substituted and unsubstituted aromatic cyclic moieties including but not limited to phenyl, naphthyl, anthracyl, phenanthryl, pyrenyl, and xylyl groups. Alkaryl groups are those in which an aryl moiety links an alkyl moiety to a core structure, and aralkyl groups are those in which an alkyl moiety links an aryl moiety to a core structure. As used herein, the term “aralkyl” denotes alkyl groups which bear aryl groups, for example, benzyl groups. The term “alkaryl” denotes aryl groups which bear alkyl groups, for example, methylphenyl groups. As used herein, the term “aryl” denotes aromatic cyclic groups including, but not limited to, phenyl, naphthyl, anthracyl, phenanthryl and pyrenyl. Preferred aryl and aralkyl groups include, but are not limited. to, phenyl, benzyl, xylyl, naphthyl, toluyl, pyrenyl, anthracyl, azulyl, phenethyl, cinnamyl, benzhydryl, and mesityl. Typical substituents for substitution include, but are not limited to, hydroxyl, alkoxy, alcohol, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, or alkyl, aryl, alkenyl, or alkynyl groups. As used herein, the term “alkanoyl” has its accustomed meaning as a group of formula —C(═O)-alkyl. A preferred alkanoyl group is the acetyl group. For therapeutic or pharmaceutical use, the oligomeric compounds of the present invention may be taken up in pharmaceutically acceptable carriers such as, for example, solutions, suspensions, tablets, capsules, ointments, elixirs and injectable compositions. The dosage administered depends upon factors such as the nature and severity of the condition, the stage of the condition, and the condition of the patient. An effective amount of oligomeric compound of the invention may be from about 10 μg/kg body weight to about 1000 μg/kg body weight. The oligomeric compounds of the present invention can be used in diagnostics, therapeutics and as research reagents and kits. The oligomeric compounds of the present invention can also be used in pharmaceutical compositions by including a suitable pharmaceutically acceptable diluent or carrier. The oligomeric compounds can further be used for treating organisms having a disease characterized by the undesired production of a protein. For this purpose, the organism is contacted with an oligomer having a sequence that is capable of specifically hybridizing with a strand of nucleic acid encoding the undesirable protein. Treatments of this type can be practiced on a variety of organisms ranging from unicellular prokaryotic and eukaryotic organisms to multicellular eukaryotic organisms. Any organism that utilizes DNA-RNA transcription or RNA-protein translation as a fundamental part of its hereditary, metabolic or cellular control is susceptible to therapeutic and/or prophylactic treatment in accordance with the invention. Seemingly diverse organisms such as bacteria, yeast, protozoa, algae, all plants and all higher animal forms, including warm-blooded animals, can be treated. Further, each cell of multicellular eukaryotes can be treated, as they include both DNA-RNA transcription and RNA-protein translation as integral parts of their cellular activity. Furthermore, many of the organelles (e.g., mitochondria and chloroplasts) of eukaryotic cells also include transcription and translation mechanisms. Thus, single cells, cellular populations or organelles can also be included within the definition of organisms that can be treated with therapeutic or diagnostic oligomeric compounds of the invention. The formulation of therapeutic compositions and their subsequent administration is believed to be within the skill of those in the art. In general, for therapeutics, a patient in need of such therapy is administered an oligomer in accordance with the invention, commonly in a pharmaceutically acceptable carrier, in doses ranging from 0.01 μg to 100 g per kg of body weight depending on the age of the patient and the severity of the disease state being treated. Further, the treatment may be a single dose or may be a regimen that may last for a period of time which will vary depending upon the nature of the particular disease, its severity and the overall condition of the patient, and may extend from once daily to once every 20 years. Following treatment, the patient is monitored for changes in his/her condition and for alleviation of the symptoms of the disease state. The dosage of the oligomer may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disease state is observed, or if the disease state has been abated. In some cases it may be more effective to treat a patient with an oligomer of the invention in conjunction with other traditional therapeutic modalities. For example, a patient being treated for AIDS may-be administered an oligomer in conjunction with AZT, or a patient with atherosclerosis may be treated with an oligomer of the invention following angioplasty to prevent reocclusion of the treated arteries. Dosing is dependent on severity and responsiveness of. the disease condition to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligomers, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 μg to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to several years. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligomer is administered in maintenance doses, ranging from 0.01 μg to 100 g per kg of body weight, once or more daily, to once every several years. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including-ophthalmic, vaginal, rectal, intranasal, transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, or intrathecal or intraventricular administration. Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Compositions for intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives. Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives. There are a many therapeutic indications and general uses for oligomeric compounds of the present invention. Representative indications and uses include the following: One therapeutic indication of particular interest is psoriasis. Psoriasis is a common chronic and recurrent disease characterized by dry, well-circumscribed, silvery, scaling papules and plaques of various sizes. The disease varies in severity from a few lesions to widespread dermatosis with disabling arthritis or exfoliation. The ultimate cause of psoriasis is not known, but the thick scaling that occurs is probably due to increased epidermal cell proliferation ( Another type of therapeutic indication of interest is inflamrmnatory disorders of the skin. These occur in a variety of forms including, for example, lichen planus, toxic epidermal necrolyis (TEN), ertythema multiforme and the like ( Other antisense targets for skin inflammatory disorders are VCAM-1 and PECAM-1. Intraperitoneal administration of a monoclonal antibody to VCAM-1 decreases ovalbumin-induced eosinophil infiltration into the skin of mice (Hakugawa et al., Another type of therapeutic indication of interest for oligonucleotides encompasses a variety of cancers of the skin. Representative skin cancers include benign tumors (warts, moles and the like) and malignant tumors such as, for example, basal cell carcinoma, squamous cell carcinoma, malignant melanoma, Paget's disease, Kaposi's sarcoma and the like ( The ras oncogenes are guanine-binding proteins that have been implicated in cancer by, e.g., the fact that activated ras oncogenes have been found in about 30% of human tumors generally; this figure approached 100% in carcinomas of the exocrine pancreas (for a review, see Downward, Protein Kinase C (PKC) proteins have also been implicated in tumorigenesis. Antisense compounds targeted to Protein Kinase C (PKC) proteins are described in U.S. Pat. Nos. 5,620,963 to Cook et al. and 5,681,747 to Boggs et al. Also of interest are AP-1 subunits and JNK proteins, particularly in regard to their roles in tumorigenesis and metastasis. The process of metastasis involves a sequence of events wherein (1) a cancer cell detaches from its extracellular matrices, (2) the detached cancer cell migrates to another portion of an animal's body, often via the circulatory system, and (3) attaches to a distal and inappropriate extracellular matrix, thereby created a focus from which a secondary tumor can arise. Normal cells do not possess the ability to invade or metastasize and/or undergo apoptosis (programmed cell death) if such events occur (Ruoslahti, Several studies have shown that regulation of the MMP-9 gene may be controlled by the AP-1 transcription factor (Kerr et al., Furthermore, AP-1 is itself activated in certain circumstances by phosphorylation of the Jun subunit at an amino-terminal position by Jun N-terminal kinases (JNKs). Thus, inhibition of one or more JNKs is expected to result in decreased AP-1 activity and, consequentially, reduced MMP expression. Antisense compounds targeted to JNKs are described in co-pending U.S. patent application Ser. No. 08/910,629, filed Aug. 13, 1997, by Dean et al. Infectious diseases of the skin are caused by viral, bacterial or fungal agents. In the case of Lyme disease, the tick borne causative agent thereof, the spirochete Other infectious disease of the skin which are tractable to treatment using the compositions and methods of the invention include disorders resulting from infection by bacterial, viral or fungal agents ( With regards to infections of the skin caused by viral agents, U.S. Pat. Nos. 5,166,195, 5,523,389 and 5,591,600 provide oligonucleotide inhibitors of Human Immunodeficiency Virus (HIV). U.S. Pat. No. 5,004,810 provides oligomers capable of hybridizing to herpes simplex virus Vmw65 mRNA and inhibiting its replication. U.S. Pat. No. 5,194,428 and 5,580,767 provide antisense compounds having antiviral activity against influenzavirus. U.S. Pat. No. 4,806,463 provides antisense compounds and methods using them to inhibit HTLV-III replication. U.S. Pat. Nos. 4,689,320, 5,442,049, 5,591,720 and 5,607,923 are directed to antisense compounds as antiviral agents specific to cytomegalovirus (CMV). U.S. Pat. No. 5,242,906 provides antisense compounds useful in the treatment of latent Epstein-Barr virus (EBV) infections. U.S. Pat. Nos. 5,248,670, 5,514,577 and 5,658,891 provide antisense compounds useful in the treatment of herpesvirus infections. U.S. Pat. Nos. 5,457,189 and 5,681,944 provide antisense compounds useful in the treatment of papillomavirus infections. The antisense compounds disclosed in these patents, which are herein incorporated by reference, may be used with the compositions of the invention to effect prophylactic, palliative or therapeutic relief from diseases caused or exacerbated by the indicated pathogenic agents. Antisense oligomeric compounds employed in the compositions of the present invention may also be used to determine the nature, function and potential relationship of various genetic components of the body to disease or body states in animals. Heretofore, the function of a gene has been chiefly examined by the construction of loss-of-function mutations in the gene (i.e., “knock-out” mutations) in an animal (e.g., a transgenic mouse). Such tasks are difficult, time-consuming and cannot be accomplished for genes essential to animal development since the “knock-out” mutation would produce a lethal phenotype. Moreover, the loss-of-function phenotype cannot be transiently introduced during a particular part of the animal's life cycle or disease state; the “knock-out” mutation is always present. “Antisense knockouts,” that is, the selective modulation of expression of a gene by antisense compounds, rather than by direct genetic anipulation, overcomes these limitations (see, for example, Albert et al., The administration of therapeutic or pharmaceutical compositions comprising the oligomeric compounds of the invention is believed to be within the skill of those in the art. In general, a patient in need of therapy or prophylaxis is administered a composition comprising an oligomeric compound of the invention, commonly in a pharmaceutically acceptable carrier, in doses ranging from 0.01 ug to 100 g per kg of body weight depending on the age of the patient and the severity of the disorder or disease state being treated. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution or prevention of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual antisense compounds, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In the context of the invention, the term “treatment regimen” is meant to encompass therapeutic, palliative and prophylactic modalities of administration of one or more compositions of the invention. A particular treatment regimen may last for a period of time which will vary depending upon the nature of the particular disease or disorder, its severity and the overall condition of the patient, and may extend from once daily to once every 20 years. Following treatment, the patient is monitored for changes in his/her condition and for alleviation of the symptoms of the disorder or disease state. The dosage of the composition may either be increased in the event the patient does not respond significantly to current dosage levels, or the dose may be decreased if an alleviation of the symptoms of the disorder or disease state is observed, or if the disorder or disease state has been ablated. An optimal dosing schedule is used to deliver a therapeutically effective amount of the oligomeric compound of the invention. The term “therapeutically effective amount,” for the purposes of the invention, refers to the amount of oligomer-containing pharmaceutical composition which is effective to achieve an intended purpose without undesirable side effects (such as toxicity, irritation or allergic response). Although individual needs may vary, determination of optimal ranges for effective amounts of pharmaceutical compositions is within the skill of the art. Human doses can be extrapolated from animal studies (Katocs et al., Chapter 27 For therapeutic use the oligomeric compound is administered to an animal suffering from a disease modulated by some protein. It is preferred to administer to patients suspected of suffering from such a disease an amount of oligonucleotide analog that is effective to reduce the symptomology of that disease. One skilled in the art can determine optimum dosages and treatment schedules for such treatment regimens. It is preferred that the RNA or DNA portion which is to be modulated be preselected to comprise that portion of DNA or RNA which codes for the protein whose formation or activity is to be modulated. The targeting portion of the composition to be employed is, thus, selected to be complementary to the preselected portion of DNA or RNA, that is to be an antisense oligomer for that portion. In accordance with one preferred embodiment of this invention, the compounds of the invention hybridize to HIV mRNA encoding the tat protein, or to the TAR region of HIV mRNA. In another preferred embodiment, the compounds mimic the secondary structure of the TAR region of HIV mRNA, and by doing so bind the tat protein. Other preferred compounds complementary sequences for herpes, papilloma and other viruses. It is generally preferred to administer the therapeutic agents in accordance with this invention internally such as orally, intravenously, or intramuscularly. Other forms of administration, such as transdermally, topically, or intralesionally may also be useful. Inclusion in suppositories may also be useful. Use of pharmacologically acceptable carriers is also preferred for some embodiments. This invention is also directed to methods for the selective binding of RNA for research and diagnostic purposes. Such selective, strong binding is accomplished by interacting such RNA or DNA with compositions of the invention which are resistant to degradative nucleases and which hybridize more strongly and with greater fidelity than known oligonucleotides or oligonucleotide analogs. In accordance with one preferred embodiment of this invention, the compounds of the invention hybridize to HIV mRNA encoding the tat protein, or to the TAR region of HIV mRNA. In another preferred embodiment, the compounds mimic the secondary structure of the TAR region of HIV mRNA, and by doing so bind the tat protein. Other preferred compounds complementary sequences for herpes, papilloma and other viruses. It is generally preferred to administer the therapeutic agents in accordance with this invention internally such as to orally, intravenously, or intramuscularly. Other forms of administration, such as transdermally, topically, or intralesionally may also be useful. Inclusion in suppositories may also be useful. Use of pharmacologically acceptable carriers is also preferred for some embodiments. This invention is also directed to methods for the selective binding of RNA for research and diagnostic purposes. Such selective, strong binding is accomplished by interacting such RNA or DNA with compositions of the invention which are resistant to degradative nucleases and which hybridize more strongly and with greater fidelity than known oligonucleotides or oligonucleotide analogs. Those skilled in the art will appreciate that numerous changes and modifications may be made to the preferred embodiments of the invention and that such changes and modifications may be made without departing from the spirit of the invention. It is, therefore, intended that the appended claims cover all such equivalent variations as fall within the true spirit and scope of the invention. General Solvents were dried by distillation: THF over sodium benzophenone ketyl; acetonitrile and triethylamine over calcium hydride; and pyridine over barium oxide. DBU is distilled under vacuum and then stored over 4 Å Linde molecular sieves under argon. PCl3is first degassed by refluxing for 2 h under argon followed by fractional distillation and storage under argon. Water is HPLC grade obtained from Aldrich Chemical Co. Inc. R-4-mercapto-4-methyl-2-pentanol and S-4-mercapto-4-methyl-2-pentanol are synthesized according to the procedure of Eliel and Morris-Natschke (Eliel, E. L., Morris-Natschke, S., PCl3(1.3 mL, 15 mmol) is introduced via a syringe into a dry 100-mL round-bottomed flask containing 20 mL of dry THF that has been flushed with argon and sealed with a septum. The flask is cooled to −78° C. in a dry ice/acetone bath, and a solution of
Compound 1 in hexane is treated with morpholine by careful dropwise addition at 0° C. The cold bath is removed, and the mixture is stirred at room temperature for an additional 1 hour. Morpholine hydrochloride is removed by filtration, and Compound 2 is purified by silica gel column chromatography. To a sample of 2′-deoxy-5′-O-DMT nucleoside (2′-O-deoxy, 5′-O-DMT-6-N-benzoyl adenosine, 2′-O-deoxy, 5′-O-DMT-4-N-benzoyl cytidine, 2′-O-deoxy, 5′-O-DMT-2-N-isobutyl guanosine, 2′-O-deoxy-5′-O-DMT-thymidine or a modified optionally protected 5-0-DMT-nucleoside) 10 mmol in dry CH2Cl2at −78° C. is added 20 mL of a 15 mmol solution of 1H-tetrazole (11 mmol), in THF via syringe. The reaction mixture is stirred at −78° C. for 30 min, the cooling bath is removed, and the solution is warmed to room temperature. To this solution is added Compound 2 in THF (11 mmol) dropwise with stirring for 2-4 hours. The sulfurization reagent 3H-1,2-benzodithiole-3-one-1,1-dioxide (2% in CH3CN), (Iyer et al., Thymidine was attached to solid support following a literature procedure (Damha et al., To a sintered glass funnel are added 5′-HO-T-CPG (27 mg, 1 mol) and a solution of Structure 3, where the base is thymine, in acetonitrile (0.2 mL, 0.1 M) followed by 30 μL of DBU (0.2 mmol) added by syringe. After 15 minutes, the solid support is washed with acetonitrile (3×2 mL), and then Beaucage's reagent (0.2 mL, 0.1M in THF) is added. The solid support on washing with anhydrous CH3CN gives the title dimer. Compound 4 is treated with NH4OH (28%) at 50° C. for 2 h. The solution is evaporated to dryness, and the residue is dissolved in water (1 mL) and filtered. The resulting crude material which has been cleaved from the solid support is purified and analyzed by HPLC to give Compound 5, a TT dimer having a chiral Rp internucleoside linkage. Compound 6 is prepared following the procedures used to prepare Compound 1, Example 2. S-4-mercapto-4-methyl-2-pentanol (15 mmol) is treated with PCl3(15 mmol) to give upon purification Compound 6. Compound 6 in hexane is treated with morpholine by careful dropwise addition at 0° C. The cold bath is removed, and the mixture is stirred at room temperature for an additional 1 hour. Morpholine hydrochloride is removed by filtration, and Compound 7 is purified by silica gel column chromatography. Compound 7 is reacted with a 5′-O-DMT nucleoside in the presence of tetrazole followed by addition of sulfur (Beaucage reagent) to give the desired oxathiane phosphorous derivative compound 8. This procedure is illustrated for the Rp isomer in Example 4 above. Compound 8 is purified by silica gel column chromatography. To a sintered glass funnel are added 5′-HO-T-CPG (Example 5) (27 mg, 1 mmol), a solution of compound 8 in acetonitrile (0.2 mL, 0.1 M), and 30 μL of DBU (0.2 mmol, via syringe). After 15 minutes, the solid support is washed with acetonitrile (3×2 mL), and then Beaucage's reagent (0.2 mL, 0.1M in THF) is added. The solid support on standing for 10 minutes followed by washing with anhydrous CH3CN gives the title dimer. Compound 9 is treated with NH4OH (28%) at 50° C. for 2 h. The solution is evaporated to dryness, and the residue is dissolved in water (1 mL) and filtered. Compound 10 is purified and analyzed using HPLC. The four membered thiane formation facilitates the formation of the product (Compound 10). Compound 11, is obtained from (+)-pulegone, readily available in enantiomerically pure form following a literature procedure (Lynch et al., Compound 11 and phosphorous trichloride are added in equimolar proportions to CH2Cl2containing two equivalents of pyridine at −78. After stirring for 1 hour, pyridinium hydrochloride is filtered off, and the solution is concentrated and purified to give Compound 12. Compound 12 in hexane is treated with morpholine by careful dropwise addition at 0° C. The cold bath is removed, and the mixture is stirred at room temperature for an additional 1 hour. Morpholine hydrochloride is removed by filtration and Compound 13 is purified by silica gel column chromatography. To a selected 2′-deoxy-5-O-DMT-nucleoside (2′-O-deoxy-5′-O-DMT-6-N-benzoyl adenosine, 2′-Q-deoxy-5′-O-DMT-4-N-benzoyl cytodine, 2′-O-deoxy-5′-CDMT-2-N-butyryl guanosine, 2′-O-deoxy-5′-O-DMT-thymidine or modified optionally protected 5-0-DMT-nucleoside) 10 mmol in dry CH2Cl2is added 1H tetrazole (11 mmol). Compound 13 (11 mmol) is added dropwise with stirring for 2-4 hours. The resulting intermediate is oxidized with Beaucage reagent as described above for Compound 3. The nucleoside oxathiane intermediate is purified by silica gel column chromatography. Compound 14 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside, using DBU to give a compound having Structure 15 as described above for Compound 4. Dimers having Structure 15 are treated as per the procedure of Example 7 to cleave the dimer from the CPG and to deblock the phosphorus thereby giving the free deblocked dimer having Structure 15a. Starting from (−)-pulegone, commercially available from Fluka, the isomer of (−)-5-methyl-2-(1-methyl-1-thioethyl) cyclohexanol is obtained following literature procedures (Lynch ibid). The compound (−)-5-methyl-2-(1-methyl-1-thioethyl) cyclohexanol is treated with PCl3in CH2Cl2containing two equivalents of pyridine at −78° C. After stirring for 1 hour, pyridinium hydrochloride is filtered off, and the solution is concentrated and purified to give Compound 16. Compound 16 in hexane is treated with morpholine by careful dropwise addition at 0° C. The cold bath is removed, and the mixture is stirred at room temperature for an additional 1 hour. Morpholine hydrochloride is removed by filtration, and Compound 17 is purified by silica gel column chromatography. To a selected 2′-deoxy-5-0-DMT-nucleoside (2′-O-deoxy-5′-O-DMT-6-N-benzoyl adenosine, 2′-O-deoxy-5′-O-DMT-4-N-benzoyl cytodine, 2′-O-deoxy-5′-O-DMT-2-N-butyryl guanosine, 2′-O-deoxy-5′-O-DMT-thymidine or modified optionally protected 5-O-DMT-nucleoside) 10 mmol in dry CH2Cl2is added 1H tetrazole (11 mmol) followed by dropwise addition of Compound 17 (11 mmol)and stirring for 2-4 hours. The sulfurization reagent 3H-1,2-benzodithiole-3-one-1, 1-dioxide (2% in CH3CN, Iyer ibid), is added and stirred for 1 hour. Solvent is evaporated and the crude material is purified by silica gel column chromatography to give Compound 18. Compound 18 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside, using DBU to give a compound having Structure 18a as described above for Compound 4. Dimers prepared from Compound 18a are cleaved from the CPG and deblocked thereby giving the free deblocked Sp chiral dimer 18b. The title compound is synthesized according to a literature procedure using (+)-pulegone (He et al., Compound 19 and phosphorous trichloride are added in equimolar proportions to CH2Cl2containing two equivalents of pyridine at −78° C. After stirring for 1 hour, pyridinium hydrochloride is filtered off, and the solution is concentrated and purified to give a chloro-intermediate compound. The chloro-intermediate compound in hexane is treated with morpholine by careful dropwise addition at 0° C. The cold bath is removed, and the mixture is stirred at room temperature for an additional 1 hour. Morpholine hydrochloride is removed by filtration, and the morpholino compound is purified by silica gel column chromatography. To a selected 2′-deoxy-5-O-DMT-nucleoside (2′-O-deoxy-5′-O-DMT-6-N-benzoyl adenosine, 2′-O-deoxy-5′-O-DMT-4-N-benzoyl cytodine, 2′-O-deoxy-5′-O-DMT-2-N-butyryl guanosine, 2′-O-deoxy-5′-O-DMT-thymidine or modified optionally protected 5-O-DMT-nucleoside) 10 mmol in dry CH2Cl2is added 1H tetrazole (11 mmol) followed by dropwise addition of the morpholino compound (11 mmol) and stirring for 2-4 hours. The sulfurization reagent 3H-1,2-benzodithiole-3-one-1,1-dioxide (2% in CH3CN, Iyer ibid), is added and stirred for 1 hour. Solvent is evaporated and the nucleoside oxathiane intermediate Compound 20 is purified by silica gel column chromatography. Compound 20 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside, using DBU to give a compound having Structure 21 as described above for Compound 4. A capping step is added to cap the free amine formed. Compound 21 is treated with concentrated ammonium hydroxide for 16 hours to give the cleaved deblocked dimer as the Rp isomer and the chiral adjuvant derived products 22 and 23. From the naturally occuring (−)-pulegone (available from Fluka), compound 24 is obtained as a Chiral Adjuvant following a literature procedure (He et al., Compound 24 is treated with PCl3(1 equivalent) with excess of Hunig base in THF solvent at −5° C. for 10 minutes. The resulting chloro compound is treated with a selected 2′-deoxy-5-O-DMT-nucleoside having a free 3′-OH group (2′-O-deoxy-5′-O-DMT-6-N-benzoyl adenosine, 2′-O-deoxy-5′-O-DMT-4-N-benzoyl cytodine, 2′-O-deoxy-5′-O-DMT-2-N-butyryl guanosine, 2′-O-deoxy-5′-O-DMT-thymidine or modified optionally protected 5-O-DMT-nucleoside). TLC and13C NMR analysis is used to reveal the formation of a single diastereomer. The crude material is washed with saturated sodium bicarbonate and dried over anhydrous sodium sulfate. The resulting material is purified either by crystallization or by silica gel column chromatography. Purified compound 25 is condensed with a 5′-HO-T-CPG (Example 5), or other solid support bound 5′-OH-nucleoside (such as 2′-O-deoxy-6-N-benzoyl adenosine, 2′-O-deoxy-4-N-benzoyl cytidine, 2′-O-deoxy-2-N-isobutyryl guanosine or other modified optionally protected 5′-OH′-3′-CPG-nucleoside), for 2 hours using tetrazole as the coupling agent. The resultant free amine is capped with acetic anhydride, and the dimer is oxidized with Beaucage reagent to give Compound 26 attached to solid support. Compound 26 is cleaved from the solid support and deprotected by treatment with concentrated ammonium hydroxide (30%, 12 hours). The chiral auxiliary is removed as an isomer of compound 22 or 23 and the oligomer is purified by HPLC. The nucleoside dimer is treated with 80% aqueous acetic acid to remove the 5′-triyl group. The Sp configuration is assigned as described below in the procedures. 50 milligram (2 μmole) of 5′-O-dimethoxytritylthymidine bound to CPG (controlled pore glass) through an ester linkage is taken up in a glass reactor, and a toluene solution of 3% dichloroacetic acid (v/v) is added to deprotect the 5′-hydroxyl group. The product is washed with acetonitrile and a 0.2 M solution of Compound 8 (B=T) in acetonitrile (25 fold excess) and a 0.5 M solution of DBU in acetonitrile (200 fold excess) is added and allowed to react at room temperature for 15 minutes. The product is washed with acetonitrile followed by the addition of a 0.2 M solution of Beaucage reagent in acetonitrile with reaction allowed to progress at room temperature for 5 minutes. This sulfurization step is repeated one more time for 5 minutes. The support is washed with acetonitrile, and then a solution of acetic anhydride/lutidine/THF (1:1:8), and N-methyl imidazole/THF is added to cap any unreacted 5′-hydroxyl groups. The product is washed with acetonitrile. In the next cycle Compound 3 (B=T) is used as the incoming monomer and the cycle is repeated. This complete cycle is repeated four more times to introduce the Rp linkages. In the final cycle Compound 8 is used as the incoming monomer which introduces the terminal Sp linkage. The solid support containing the heptamer is treated with 30% aqueous ammonium hydroxide solution for 90 minutes at room temperature. The aqueous solution is filtered, and concentrated under reduced pressure to give the chirally pure phosphorothioate heptamer. 50 milligram (2 μmole) of 5′-O-dimethoxytritylthymidine bound to CPG (controlled pore glass) through an ester linkage is taken up in a glass reactor, and a toluene solution of 3% dichloroacetic acid in toluene (volume/volume) is added to deprotect the 5′-hydroxyl group. The product is washed with acetonitrile, a 0.2 M solution of Compound 8 with B=dCBzin acetonitrile (25 fold excess) and a 0.5 M solution of DBU in acetonitrile (250 fold excess) are added, and allowed to react at room temperature for 15 minutes. The product is washed with acetonitrile and a 0.2 M solution of Beaucage reagent in acetonitrile is added and allowed to react at room temperature for 5 minutes. This sulfurization step is repeated one more time for 5 minutes. The support is washed with acetonitrile, and then a solution of acetic anhydride/lutidine/THF (1:1:8), and N-methyl imidazole/THF is added to cap any unreacted 5′-hydroxyl groups followed by washing with acetonitrile. In the next cycle Compound 3 (B=dABz) is used as the incoming monomer and the cycle is repeated. Thus, a 0.2 M solution of Compound 3 with B=dABzin acetonitrile (25 fold excess) and a 0.5 M solution of DBU in acetonitrile (250 fold excess) is added and allowed to react at room temperature for 15 minutes. The product is washed with acetonitrile and a 0.2 M solution of Beaucage reagent in acetonitrile is added and allowed to react at room temperature for 5 minutes. This sulfurization step is repeated one more time for 5 minutes. The support is washed with acetonitrile, a solution of acetic anhydride/lutidine/THF (1:1:8) and a solution of N-methyl imidazole/THF are added to cap any unreacted 5′-hydroxyl groups. The product is washed with acetonitrile. A solution of 3% dichloroacetic acid in toluene (v/v) is added to deprotect the 5′-hydroxyl groups and the product is washed with acetonitrile. Compound 8 (0.2 M solution) with B=dGiBuin acetonitrile (25 fold excess) and a 0.5 M solution of DBU in acetonitrile (200 fold excess) are added and allowed to react at room temperature for 15 minutes. The product is washed with acetonitrile, and then a 0.2 M solution of Beaucage reagent in acetonitrile is added and allowed to react at room temperature for 5 minutes. This sulfurization step is repeated one more time for 5 minutes. The support is washed with acetonitrile and then a solution of acetic anhydride/lutidine/THF (1:1:8) and a solution of N-methyl imidazole/THF are added to cap any unreacted 5′-hydroxyl groups. The product is washed with acetonitrile. The desired tetramer is deblocked and cleaved from the solid support by treatment with a 30% aqueous solution of ammonium hydroxide for 90 minutes at room temperature followed by heating to 55° C. for 12 hours. The aqueous solution is filtered and concentrated under reduced pressure to give the title phosphorothioate tetramer of 5′-dGSp-dARpdCSpT-3′. The oligonucleotides listed in Table 1 are synthesized by following the procedures described above. For generarating chirally mixed (Rp and Sp) sites, commercial amidites (Perseptive Biosystems) are used and standard synthesis conditions are used. For introducing Rp linkages with appropriate nucleobases monomers 3, 14 or 20 are used. For introducing Sp linkages with appropriate nucleobases monomers 8, 18 or 25 are used. The solid support employed is controlled pore glass CPG with sarcosinyl-succinonyl linker (Brown et al., The sulfurization reagent employed is 3H-1,2-benzodithiole-3-one-1,1-dioxide (2% in CH3CN, Iyer ibid). A solution of acetic anhydride/lutidine/THF (1:1:8), and N-methyl imidazole/THF is added mixture to cap any unreacted 5′-hydroxyl group. The preferred reagents have been listed above for the synthesis of chirally pure oligonucleotides. Those skilled in the art will realize that many other reagents and materials are equally amenable to the present invention and that this list is not exclusive. The 5′-external region is prepared by first attaching a selected nucleoside to a solid support. A modified and protected nucleoside is used to incorporate specific nuclease resistant chemistries at the 5′-terminus. An ester or amide attachment through the 3′-hydroxyl is preferred but other motifs described above can be utilized (5′, or 2′-attachment). The 5′-hydroxyl (or other hydroxyl) is deprotected and the next activated nucleoside is reacted with this hydroxyl to lengthen the solid support bound compound. Alternate chemistries may be employed to prepare nuclease resistant internucleoside linkages as discussed above. An alternative to the monomer approach is to attach a dimer to the solid support that has a desired internucleoside linkage. This approach allows for the preparation of more complicated internucleoside linkages such as MMI. The incorporation of monomers, dimers or larger molecules is continued until the 5′-external region is completed. The protected hydroxyl group on the last nucleoside extending from the solid support is deprotected and reacted with a chiral auxiliary that will give a chiral Rp internucleoside linkage. Chiral Rp auxiliary compounds are illustrated in Examples 4, 16 and 23. The procedure of adding chiral Rp auxiliary nucleosides is illustrated in examples 29-31 above. After the addition of a desired number and sequence of monomers having chiral Rp internucleoside linkages the 5′-hydroxyl group from the last nucleoside extending from the solid support is deblocked. The addition of a nucleoside, a nucleosidic dimer or larger molecule to the internal region in order to form the 5′-external region is identical to the procedure for additions to the 3′ external region. After synthesis of the desired length and sequence the gapmer is cleaved from the solid support and deblocked. These two steps are routinely performed concurrently as illustrated in examples 29-31 above. Synthesis of 3′-OH Nucleoside 27 Modified or unmodified nucleosides, such as Compound 27 ( Synthesis of Backbone Modified Block 28 Detailed synthesis of a variety of backbone modified blocks has been published in Comprehensive Natural Products Chemistry: DNA and Aspects of Molecular Biology, Vol. 7, Vol. Ed. E. Kool, Eds-in-chief, D. Barton, K. Nakanishi and A. Meth-Cohn, Pergamon Press, 1999, p285. The nucleosidic block can be a dimer, trimer, tetramer or pentamer based on the synthesis requirements. After synthesis of an appropriate block, it is protected with Pg1 in a manner described above. Synthesis of dNTP(αS) 29 Natural and synthetic dNTP(αS) are commercially available from many sources. One such source is Amersham Pharmacia Biotech. Appropriate dNTP(αS) are then protected at 3′-OH with Pg2using standard chemistry. Some of the preferred Pg2groups are esters and phosphates. These groups can be removed under neutral or mild conditions using specific enzymes. A detailed list of such enzymes is described in Protective Groups in Organic Synthesis, Eds. T. W. Green and P. Wuts, Wiley, 1999. Synthesis of AppsNpg231 The synthesis of Compound 31 is performed enzymatically using RNA ligase. AppdNp is one such example that has been described in the literature (Benkovic et al., Synthesis of 32, 33 and 34 Starting with Compound 27, synthesis of dNTP(αS) 32 with a 2′-substituent group can be accomplished following the standard literature procedure described by Eckstein ibid. Reaction of 3′,5′-diphosphate 34 with ATP in presence of RNA ligase and inorganic pyrophosphate as described in U.S. Pat. No. 5,602,000 cited above will give the desired activated dimer block 33. Synthesis of 35, 36 and 37 Starting with nucleosidic dimer, Compound 28, synthesis of dNTP(αS) Compound 36 having a substituent group at the 2′-position is accomplished following standard literature procedures (see Eckstein ibid). Reaction of 3′,5′-diphosphate Compound 35 with ATP in the presence of RNA ligase and inorganic pyrophosphate as described in U.S. Pat. No. 5,602,000 will give the desired activated dimer block 37. The overall synthesis of chimeric oligonucleotides having formulas 48-51 is accomplished following a six-step protocol. The first step involves coupling of any 5′-piece as illustrated above and in The purpose of the second step is to expose the 3′-OH group such that it can be coupled with an appropriate block. Step three is very similar to step one, both require use of RNA ligase and similar reaction conditions. The next step (four) effects removal of the Pg2group, exposing the 3′-OH group. Therefore, coupling and removal of Pg2groups is continued until a desired length of phosphorothioate oligo is obtained. A further coupling is performed in step 5, thereby attaching the 3′-terminal residue to furnish completed oligomers 46 or 47. After the last coupling, the protected oligonucleotide is purified using reverse phase column chromatography as described in the literature (Sanghvi et al. in Manuals of Antisense Technology, Eds. G. Hartmann and S. Endres, Kulver Press, 1999, p3). Reverse phase purification will give oligomers having high purity (>95%). Removal of the 3′ and 5′ protecting groups Pg1is simultaneously performed during step 6 using mild conditions. One such condition is the use of fluoride ions for the removal of silyl groups. Photolytic removal of protecting groups is also viable at this stage and that has been succesfully practiced in the synthesis of oligomers (McGall et al. J. Am. Chem. Soc. 1997, 119, 5081). Alternatively, the terminal ends could be interchanged to provide oligomers having formulas 50 and 51, both bearing a dissimilar nucleosidic unit on the 3′ and 5′ ends. After the final monomer or blockmer has been added the solid support bound oligonucleotide is deprotected (trityl on) in 1-5 mL 28.0-30% ammonium hydroxide (NH4OH) for approximately 16 hours at 55° C. (small scale). For larger scale synthesis of oligonucleotides (20 μmol/synthesis) 20 mL of 28.0-30% ammonium hydroxide is used. In general, oligonucleotides are cleaved and deprotected in 5-20 mL 28.0-30% NH4OH at 55° C. for approximately 16 hours. Following cleavage and deprotection the crude oligonucleotides are filtered from CPG using Gelman 0.45 μm nylon acrodisc syringe filters. Excess NH4OH is evaporated away in a Savant AS160 automatic speed vac. The crude yield is measured on a Hewlett Packard 8452A Diode Array Spectrophotometer at 260 nm. Crude samples are then analyzed by mass spectrometry (MS) on a Hewlett Packard electrospray mass spectrometer and by capillary gel electrophoresis (CGE) on a Beckmann P/ACE system 5000. Trityl-on oligonucleotides are purified by reverse phase preparative high performance liquid chromatography (HPLC). HPLC conditions are as follows: Waters 600E with 991 detector; Waters Delta Pak C4 column (7.8×300 mm); Solvent A: 50 mM triethylammonium acetate (TEA-Ac), pH 7.0; B: 100% acetonitrile; 2.5 mL/min flow rate; Gradient: 5% B for first five minutes with linear increase in B to 60% during the next 55 minutes. Larger oligo yields from the larger 20 μmol syntheses are purified on larger HPLC columns (Waters Bondapak HC18HA) and the flow rate is increased to 5.0 mL/min. Appropriate fractions are collected and solvent is removed via speed vac. Oligonucleotides are detritylated in 80% acetic acid for approximately 45 minutes and lyophilized again. Free trityl and excess salt are removed by passing detritylated oligonucleotides through Sephadex G-25 (size exclusion chromatography) and collecting appropriate samples with a Pharmacia fraction collector. Concentration of selected fractions gives the purified oligonucleotides which are analyzed for purity by CGE, HPLC (flow rate: 1.5 mL/min; Waters Delta Pak C4 column, 3.9×300 mm), and MS. The final yield is determined by spectrophotometer at 260 nm. Determination of Configuration of Chiral Thioates The Rp and Sp configuration of chiral thioates are determined according to the reported procedure (Slim, G., Gait, M. J., Digestion by Snake Venom Phosphodiesterase An aliquot (2 OD)of each P═S oligonucleotide dimer (both earlier and later eluting peaks by reversed-phase) HPLC is treated for 8 hours at 37° C. with snake venom phosphodiesterase (0.1 μg, Boehringer) and calf alkaline phosphatase (6.0 μg, Boehringer) in 0.1 M Tris. HCl (pH 8.5), 0.3 mM dithiothreotol (DTT), 0.3 mM MgCl2in a reaction volume of 150 μL. The products are analyzed by reverse phase HPLC. The Rp isomer (the earlier eluting peak) is hydrolyzed while the Sp isomer remains intact. Digestion by Nuclease P1 An aliquot of each P═S oligonucleotide dimer (2 ODs) is digested with nuclease P1 (2.0 μg, Boehringer) in distilled water (120 μL) for 1 hour at 37° C. The solution is buffered with 16 μL 0.1 M Tris HCl (pH 8.5) and digested with calf alkaline phosphatase (6.0 μg, Boehringer) for 1 hour at 37° C. The product is analyzed by reverse phase HPLC. In this case, the Sp isomer is degraded while the Rp isomer is resistant to nuclease. Evaluation of In Vivo Stability of Chimeric Chiral Oligonucleotides Mouse Experiment Procedures For each oligonucleotide tested, 9 male BALB/c mice (Charles River, Wilmington, Mass.), weighing about 25 g are used (Crooke et al., Evaluation of In Vivo Stability of Chimeric Chiral Oligonucleotides SEQ ID NO: 5 was used in a comparative study to determine the effect of chiral internucleotide linkages at predetermined positions compared to the same sequence having racemic linkages at each position. The capillary gel electrophoretic analysis indicated the relative nuclease resistance of Chiral 3′-Sp-capped oligomers compared to ISIS 3082 (XVI,uniform 2′-deoxy phosphorothioate). Because of the resistance of Sp linkage to nucleases, Compounds XVII and XVIII are found to be stable in plasma, kidney and liver while XVI (3082) is not. On the other hand, the data from 5′,-3′-bis Sp capped oligomers show total exonucleolytic stability in plasma as well as in tissues (liver and kidney). Compounds are stable at various time points such as 1, 3, and 24 hours. The fact that no degradation is detected proved that 5′-exonucleases and 3′-exonuclease are prevalent in tissues and endonucleases are not active. Furthermore, a single chiral linkage (Sp thioate linkage) is sufficient as a gatekeeper against nucleases at the termini. RNase H Studies with Chimeric Rp and Sp Modified Oligonucleotides 32P Labeling of Oligonucleotides The oligoribonucleotide (sense strand) is 5′-end labeled with32P using [32P]ATP, T4 polynucleotide kinase, and standard procedures (Ausubel et al., Determination of RNase H Cleavage Patterns Hybridization reactions were prepared in 120 μL of reaction buffer [20 mM Tris-HCl (pH 7.5), 20 mM KCl, 10 mM MgCl2, 0.1 mM DTT] containing 750 nM antisense oligonucleotide, 500 nM sense oligoribonucleotide, and 100,000 cpm32P-labeled sense oligoribonucleotide. Reactions were heated at 90° C. for 5 minutes and 1 unit of Inhibit-ACE is added. Samples were incubated overnight at 37° C. degrees. Hybridization reactions were incubated at 37° C. with 1.5×10.8−8mg of Hybridization reactions were prepared in 120 μL of reaction buffer [20 mM Tris-HC (pH 7.5), 20 mM KCl, 10 mM MgCl2, 0.1 mM DTT] containing 750 nM antisense oligonucleotide, 500 nM sense oligoribonucleotide, and 100,000 cpm32P-labeled sense oligoribonucleotide. Reactions were heated at 90° C. for 5 min and 1 unit of Inhibit-ACE is added. Samples were incubated overnight at 37° C. degrees. Hybridization reactions were incubated at 37° C. with 1.5×10.8−8mg of Control of H-ras Gene Expression with Chirally Defined Phosphorothioate Oligomers H-ras targeted antisense oligonucleotides were tested for the ability to'specifically reduce H-ras mRNA in T-24 cells (ATCC, Manassas, Va.). T-24 cells were routinely maintained in complete growth media, DMEM supplemented with 10% fetal calf serum and 100 units per milliliter penicillin and 100 micrograms per milliliter streptomycin (Lifetechnologies, Grand Island, N.Y.) in a humidified incubator at 37° C. For antisense experiments T-24 cells were plated in 6-well plates (Becton Dickinson Labware, Franklin Lakes, N.J.) at a density of 2×105cells per well in complete growth medium and incubated as above. Twenty-four hours after plating the growth media is aspirated and the monolayer is washed once with serum free media (Optimem, Lifetechnologies, Grand Island, N.Y.). Oligonucleotides were formulated in serum free Optimem and Lipofectin (Lifetechnologies, Grand Island, N.Y.) at a constant ratio of 3 micrograms per milliliter Lipofectin per 100 nanomolar oligonucleotide. For oligonucleotide treatment two milliliters of formulated oligonucleotide is added to each well and the cells were incubated for four hours at 37° C. Following incubation the formulated oligonucleotide is aspirated from the monolayer, replaced with growth media, and incubated overnight. Twenty-four hours after treatment total RNA is prepared using RNAzol (TEL-TEST, Inc., Friendswood, Tex.) following manufactures protocol. RNA is fractionated through 1.2% agarose-formaldehyde gels and transferred to nylon membranes (Amersham Pharmacia Biotech, Piscataway, N.J.) following standard protocols (Sambrook et al. Molecular Cloning a Laboratory Manual, 2ndedition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989). Nylon membranes were probed for H-ras (Oncogene Research Products, Cambridge, Mass.) using standard32P random priming labeling and hybridization protocols (Sambrook et al. Molecular Cloning a Laboratory Manual, 2ndedition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989). Following hybridization membranes were imaged using a Phosphorlmager (Molecular Dynamics, Sunnyvale, Calif.) and the images quantified using Image Quant 5.0 software (Molecular Dynamics, Sunnyvale, Calif.). Following image analysis membranes were striped of H-ras probe and reprobed for G3PDH (Clonetech, Palo Alto, Calif.) and analyzed as above. H-ras signal is normalized to G3PDH. The mean normalized percent control of triplicates and standard deviation for H-ras signal is calculated. Using this procedure Compounds IV, V and VI are tested. Compounds V and VI show faster efficient reduction of H-ras messages. Determination of ICAM-1 Expression Oligonucleotide Treatment of HUVECs Cells were washed three times with Opti-MEM (Life Technologies, Inc.) prewarmed to 37° C. Oligonucleotides were premixed with 10 g/mL Lipofectin (Life Technologies, Inc.) in Opti-MEM, serially diluted to the desired concentrations, and applied to washed cells. Basal and untreated (no oligonucleotide) control cells were also treated with Lipofectin. Cells were incubated for 4 hours at 37° C., at which time the medium is removed and replaced with standard growth medium with or without 5 mg/mL TNF-α (R & D Systems). Incubation at 37° C. is continued until the indicated times. Quantitation of ICAM-1 Protein Expression by Fluorescence-activated Cell Sorter Cells were removed from plate surfaces by brief trypsinization with 0.25% trypsin in PBS. Trypsin activity is quenched with a solution of 2% bovine serum albumin and 0.2% sodium azide in PBS (+Mg/Ca). Cells were pelleted by centrifugation (1000 rpm, Beckman GPR centrifuge), resuspended in PBS, and stained with 3 l/105cells of the ICAM-1 specific antibody, CD54-PE (Pharmingin). Antibodies were incubated with the cells for 30 min at 4C in the dark, under gently agitation. Cells were washed by centrifugation procedures and then resuspended in 0.3 ml of FacsFlow buffer (Becton Dickinson) with 0.5% formaldehyde (Polysciences). Expression of cell surface ICAM-1 is then determined by flow cytometry using a Becton Dickinson FACScan. Percentage of the control ICAM-1 expression is calculated as follows: [(oligonucleotide-treated ICAM-1 value)−(basal ICAM-1 value)/(non-treated ICAM-1 value)−(basal ICAM-1 value)]. (Baker et al., When ICAM-1 expression is tested with oligomers I, II and III, it is observed that the ICAM-1 expression data reveal that the oligomers II and III are more efficacious than oligomer I in HUVEC cells. The oligomers are presumably working by a improved nuclease resistance in case of oligomer II and enhanced RNaseH activity and improved nuclease resistance in the case of oligomer III. 5-Lipoxygenase Analysis and Assays A. Therapeutics For therapeutic use, an animal suspected of having a disease characterized by excessive or abnormal supply of 5-lipoxygenase is treated by administering the macromolecule of the invention. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Such treatment is generally continued until either a cure is effected or a diminution in the diseased state is achieved. Long term treatment is likely for some diseases. B. Research Reagents The oligonucleotides of this invention will also be useful as research reagents when used to cleave or otherwise modulate 5-lipoxygenase mRNA in crude cell lysates or in partially purified or wholly purified RNA preparations. This application of the invention is accomplished, for example, by lysing cells by standard methods, optimally extracting the RNA and then treating it with a composition at concentrations ranging, for instance, from about 100 to about 500 ng per 10 Mg of total RNA in a buffer consisting, for example, of 50 mm phosphate, pH ranging from about 4-10 at a temperature from about 30° to about 50° C. The cleaved 5-lipoxygenase RNA can be analyzed by agarose gel electrophoresis and hybridization with radiolabeled DNA probes or by other standard methods. C. Diagnostics The oligonucleotides of the invention will also be useful in diagnostic applications, particularly for the determination of the expression of specific mRNA species in various tissues or the expression of abnormal or mutant RNA species. In this example, while the macromolecules target a abnormal mRNA by being designed complementary to the abnormal sequence, they would not hybridize to normal mRNA. Tissue samples can be homogenized, and RNA extracted by standard methods. The crude homogenate or extract can be treated for example to effect cleavage of the target RNA. The product can then be hybridized to a solid support which contains a bound oligonucleotide complementary to a region on the 5′ side of the cleavage site. Both the normal and abnormal 5′ region of the mRNA would bind to the solid support. The 3′ region of the abnormal RNA, which is cleaved, would not be bound to the support and therefore would be separated from the normal mRNA. Targeted mRNA species for modulation relates to 5-lipoxygenase; however, persons of ordinary skill in the art will appreciate that the present invention is not so limited and it is generally applicable. The inhibition or modulation of production of the enzyme 5-lipoxygenase is expected to have significant therapeutic benefits in the treatment of disease. In order to assess the effectiveness of the compositions, an assay or series of assays is required. D. In Vitro Assays The cellular assays for 5-lipoxygenase preferably use the human promyelocytic leukemia cell line HL-60. These cells can be induced to differentiate into either a monocyte like cell or neutrophil like cell by various known agents. Treatment of the cells with 1.3% dimethyl sulfoxide, DMSO, is known to promote differentiation of the cells into neutrophils. It has now been found that basal HL-60 cells do not synthesize detectable levels of 5-lipoxygenase protein or secrete leukotrienes (a downstream product of 5-lipoxygenase). Differentiation of the cells with DMSO causes an appearance of 5-lipoxygenase protein and leukotriene biosynthesis 48 hours after addition of DMSO. Thus induction of 5-lipoxygenase protein synthesis can be utilized as a test system for analysis of oligonucleotides which interfere with 5-lipoxygenase synthesis in these cells. A second test system for oligonucleotides makes use of the fact that 5-lipoxygenase is a “suicide” enzyme in that it inactivates itself upon reacting with substrate. Treatment of differentiated HL-60 or other cells expressing 5 lipoxygenase, with 10 μM A23187, a calcium ionophore, promotes translocation of 5-lipoxygenase from the cytosol to the membrane with subsequent activation of the enzyme. Following activation and several rounds of catalysis, the enzyme becomes catalytically inactive. Thus, treatment of the cells with calcium ionophore inactivates endogenous 5-lipoxygenase. It takes the cells approximately 24 hours to recover from A23187 treatment as measured by their ability to synthesize leukotriene B4. Macromolecules directed against 5-lipoxygenase can be tested for activity in two HL-60 model systems using the following quantitative assays. The assays are described from the most direct measurement of inhibition of 5-lipoxygenase protein synthesis in intact cells to more downstream events such as measurement of 5-lipoxygenase activity in intact cells. A direct effect which oligonucleotides can exert on intact cells and which can be easily be quantitated is specific inhibition of 5-lipoxygenase protein synthesis. To perform this technique, cells can be labeled with35S-methionine (50 μCi/mL) for 2 hours at 37° C. to label newly synthesized protein. Cells are extracted to solubilize total cellular proteins and 5-lipoxygenase is immunoprecipitated with 5-lipoxygenase antibody followed by elution from protein A Sepharose beads. The immunoprecipitated proteins are resolved by SDS-polyacrylamide gel electrophoresis and exposed for autoradiography. The amount of immunoprecipitated 5-lipoxygenase is quantitated by scanning densitometry. A predicted result from these experiments would be as follows. The amount of 5-lipoxygenase protein immunoprecipitated from control cells would be normalized to 100%. Treatment of the cells with 1 μM, 10 μM, and 30 μM of the macromolecules of the invention for 48 hours would reduce immunoprecipitated 5-lipoxygenase by 5%, 25% and 75% of control, respectively. Measurement of 5-lipoxygenase enzyme activity in cellular homogenates could also be used to quantitate the amount of enzyme present which is capable of synthesizing leukotrienes. A radiometric assay has now been developed for quantitating 5-lipoxygenase enzyme activity in cell homogenates using reverse phase HPLC. Cells are broken by sonication in a buffer containing protease inhibitors and EDTA. The cell homogenate is centrifuged at 10,000×g for 30 min and the supernatants analyzed for 5-lipoxygenase activity. Cytosolic proteins are incubated with 10 μM14C-arachidonic acid, 2 mM ATP, 50 μM free calcium, 100 μg/mL phosphatidylcholine, and 50 mM bis-Tris buffer, pH 7.0, for 5 min at 37° C. The reactions are quenched by the addition of an equal volume of acetone and the fatty acids extracted with ethyl acetate. The substrate and. reaction products are separated by reverse phase HPLC on a Novapak C18 column (Waters Inc., Millford, Mass.). Radioactive peaks are detected by a Beckman model 171 radiochromatography detector. The amount of arachidonic acid converted into di-HETE's and mono-HETE's is used as a measure of-5-lipoxygenase activity. A predicted result for treatment of DMSO differentiated HL-60 cells for 72 hours with effective the macromolecules of the invention at 1 μM, 10 μM, and 30 μM would be as follows. Control cells oxidize 200 pmol arachidonic acid/5 min/106cells. Cells treated with 1 μM, 10 μM, and 30 μM of an effective oligonucleotide would oxidize 195 pmol, 140 pmol, and 60 pmol of arachidonic acid/5 min/106cells respectively. A quantitative competitive enzyme linked immunosorbant assay (ELISA) for the measurement of total 5-lipoxygenase protein in cells has been developed. Human 5-lipoxygenase expressed in Predicted results from such an assay using a 30 mer oligonucleotide at 1 μM, 10 μM, and 30 μM would be 30 ng, 18 ng and 5 ng of 5-lipoxygenase per 106cells, respectively with untreated cells containing about 34 ng 5-lipoxygenase. A net effect of inhibition of 5-lipoxygenase biosynthesis is a diminution in the quantities of leukotrienes released from stimulated cells. DMSO-differentiated HL-60 cells release leukotriene B4 upon stimulation with the calcium ionophore A23187. Leukotriene B4 released into the cell medium can be quantitated by radioimmunoassay using commercially available diagnostic kits (New England Nuclear, Boston, Mass.). Leukotriene B4 production can be detected in HL-60 cells 48 hours following addition of DMSO to differentiate the cells into a neutrophil-like cell. Cells (2×105cells/mL) will be treated with increasing concentrations of the macromolecule for 48-72 hours in the presence of 1.3% DMSO. The cells are washed and resuspended at a concentration of 2×106cell/mL in Dulbecco's phosphate buffered saline containing 1% delipidated bovine serum albumin. Cells are stimulated with 10 μM calcium ionophore A23187 for 15 min and the quantity of LTB4 produced from 5×105cell determined by radioimmunoassay as described by the manufacturer. Using this assay the following results would likely be obtained with an oligonucleotide directed to the 5-LO mRNA. Cells will be treated for 72 hours with either 1 μM, 10 μM or 30 μM of the macromolecule in the presence of 1.3% DMSO. The quantity of LTB4produced from 5×105cells would be expected to be about 75 pg, 50 pg, and 35 pg, respectively with untreated differentiated cells producing 75 pg LTB4. E. In Vivo Assay Inhibition of the production of 5-lipoxygenase in the mouse can be demonstrated in accordance with the following protocol. Topical application of arachidonic acid results in the rapid production of leukotriene B4, leukotriene C4and prostaglandin E2in the skin followed by edema and cellular infiltration. Certain inhibitors of 5-lipoxygenase have been known to exhibit activity in this assay. For the assay, 2 mg of arachidonic acid is applied to a mouse ear with the contralateral ear serving as a control. The polymorphonuclear cell infiltrate is assayed by myeloperoxidase activity in homogenates taken from a biopsy 1 hour following the administration of arachidonic acid. The edematous response is quantitated by measurement of ear thickness and wet weight of a punch biopsy. Measurement of leukotriene B4produced in biopsy specimens is performed as a direct measurement of 5-Lipoxygenase activity in the tissue. Oligonucleotides will be applied topically to both ears 12 to 24 hours prior to administration of arachidonic acid to allow optimal activity of the compounds. Both ears are pretreated for 24 hours with either 0.1 μmol, 0.3 μmol, or 1.0 μmol of the macromolecule prior to challenge with arachidonic acid. Values are expressed as the mean for three animals per concentration. Inhibition of polymorphonuclear cell infiltration for 0.1 μmol, 0.3 μmol, and 1 μmol is expected to be about 10%, 75% and 92% of control activity, respectively. Inhibition of edema is expected to be about 3%, 58% and 90%, respectively while inhibition of leukotriene B4production would be expected to be about 15%, 79% and 99%, respectively. It is intended that each of the patents, applications, printed publications, and other published documents mentioned or referred to in this specification be herein incorporated by reference in their entirety. Those skilled in the art will appreciate that numerous changes and modifications can be made to the preferred embodiments of the invention and that such changes and modifications can be made without departing from the spirit of the invention. It is therefore intended that the appended claims cover all such equivalent variations as fall within the true spirit and scope of the invention.CROSS REFERENCE TO RELATED APPLICATIONS
FIELD OF THE INVENTION
BACKGROUND OF THE INVENTION
SUMMARY OF THE INVENTION
BRIEF DESCRIPTION OF THE DRAWINGS
DETAILED DESCRIPTION OF THE INVENTION
5′-(Nu1—L1)n—Y—(L2—Nu2)p-3′
wherein;
wherein
wherein;
non-phosphorus containing linkages
wherein:
EXAMPLES
Example 1
Isomerically Pure R and S Isomers of 4-mercapto-4-methyl-2-pentanol
Example 2
Rp Precursor, Compound 1
Example 3
Compound 2
Example 4
General Procedure for the Synthesis of Monomers used for Synthesizing Rp Linkages, Structure 3
Example 5
Attachment of Thymidine to Solid Support (5′-HO-T-CPG)
Example 6
Solid Support Bound T-Rp-T Dimer, Compound 4
Example 7
T-Rp-T Dimer, Compound 5
Example 8
Compound 6
Example 9
Compound 7
Example 10
Monomers Used for Sp Linkages, Structure 8
Example 11
Solid Support Bound T-Sp-T Dimer, Compound 9
Example 12
T-Sp-T Dimer, Compound 10
Example 13
5-methyl-2-(1-methyl-1-thioethyl) Cyclohexanol, Compound 11
Example 14
Compound 12
Example 15
Compound 13
Example 16
Chiral Monomers Used for Rp Linkages, Structure 14
Example 17
General Procudure for Preparing Chiral Dimers Having Structure 15
Example 18
Compound 16
Example 19
Compound 17
Example 20
Synthesis of Monomers Having Structure 18
Example 21
General Procudure for Preparing Sp Dimers Using Compound 18
Example 22
5c-Mothyl-2t [(1-methyl-1-methylamino) ethyl]-cyclohexan-1r-ol 19
Example 23
Compound 20
Example 24
Compound 21
Example 25
Generation of Rp Dimer 21a from Compound 21
Example 26
Compound 24
Example 27
Monomer, Compound 25
Example 28
Protected Dimer, Compound 26
Example 29
Synthesis of Chirally Pure 5′-TSpTRpTRpTRpTRpTSpT-3′ Phosphorothioate Heptamer
Example 30
Synthesis of Chirally Pure 5′-d(GSpARpCSpT)-3′ Phosphorothioate Tetramer
Example 31
Oligonucleotide Synthesis: General Procedures
I GCCCAAGCTG GCATCCGTCA (ISIS-2302)/Human ICAM-1 II GSpCCCAAGCTG GCATCCGTCSpA III GSpCRpCRpCRpARpARpGRpCRpTRpGRpGRpCRpARpTRpCRpCRpGRpTRpCSpA IV TCCGTCATCGCTCCTCAGGG (ISIS-2503)/Human H-ras V TSpCCGTCATCGCTCCTCAGGSpG VI TSpCRpCRpGRpTRpCRpARpTRpCRpGRpCRpTRpCRpCRpTRpCRpARpGRpGSpG VII GTTCTCGCTGGTGAGTTTCA (ISIS-3521)/Human PKC-α VIII GSpTTCTCGCTGGTGAGTTTCSpA IX GSpTRpTRpCRpTRpCRpGRpCRpTRpGRpGRpTRpGRpARpGRpTRpTRpTRpCSpA X TCCCGCCTGTGACATGCATT (ISIS-5312)/Human C-raf XI TSpCCCGCCTGTGACATGCATSpT XII TSpCRpCRpCRpGRpCRpCRpTRpGRpTRpGRpARpCRpARpTRpGRpCRpARpTSpT XIII GTGCTCATGGTGCACGGTCT (ISIS-14803)/Human HCV XIV GSpTGCTCATGGTGCACGGTCSpT XV GSpTRpGRpCRpTRpCRpARpTRpGRpGRpTRpGRpCRpARpCRpGRpGRpTRpCSpT XVI TGCATCCCCCAGGCCACCAT (ISIS-3082)/Murine ICAM-1 XVII TSpGCATCCCCCAGGCCACCASpT XVIII TSpGRpCRpARpTRpCRpCRpCRpCRpCRpARpGRpGRpCRpCRpARpCRpCRpASpT 1 I GCCCAAGCTG GCATCCGTCA (ISIS-2302) 2 IV TCCGTCATCG CTCCTCAGGG (ISIS-2503) 3 VII GTTCTCGCTG GTGAGTTTCA (ISIS-3521) 4 X TCCCGCCTGT GACATGCATT (ISIS-5312) 5 XIII GTGCTCATGG TGCACGGTCT (ISIS-14803). Example 32
General Procedure for the Synthesis of Gapmer Oligomeric Compounds using Solid Phase Methodologies 5′-external Region
Example 33
5′-Building-Blocks
Example 34
Internal Pieces
Example 35
3′-Building Blocks
Example 36
Synthesis of Chimeric Oligonucleotide with 3′ and or 5′-modified Ends
Example 37
General Procedure for Oligonucleotide Purification
Procedure 1
Procedure 2
Procedure 3
Procedure 4
Procedure 5
Procedure 6